Split (1)

train · ~61.6M rows (showing the first 1.1M)

added stringdate 2024-06-03 18:26:11 2024-06-04 03:14:13	created stringdate 2013-04-29 18:49:42 2014-01-03 01:38:26	id stringlengths 32 32	metadata dict	source stringclasses 2 values	text stringlengths 237 356k	version stringclasses 1 value
2024-06-03T18:26:15.484Z	2013-12-06T05:54:50.000Z	6cm233sqkewfpb3gfcvpzhfj5t6bmnlm	{ "content_type": "text/html", "provenance": "cccc-CC-MAIN-2013-48-0004.json.gz:14061", "uncompressed_offset": 255599011, "url": "www.biomedcentral.com/1472-6963/11/304", "warc_date": "2014-01-03T03:19:48.000Z", "warc_filename": "<urn:uuid:d58b4257-7314-48e4-89f2-7302a38b160a>", "warc_url": "http://www.biomedcentral.com/1472-6963/11/304" }	cccc_CC-MAIN-2013-48	Email updates Keep up to date with the latest news and content from BMC Health Services Research and BioMed Central. Study protocol Effectiveness of classroom based crew resource management training in the intensive care unit: study design of a controlled trial Peter F Kemper1*, Martine de Bruijne1, Cathy van Dyck2 and Cordula Wagner13 Author Affiliations 1 Department of Public and Occupational Health; EMGO+ Institute for Health and Care Research, VU Medical Center, Van der Boechorststraat 7, 1081 BT Amsterdam, The Netherlands 2 Faculty of Social Sciences, Department of Organization Sciences, VU University, De Boelelaan 1081, 1081 HV Amsterdam, The Netherlands 3 The Netherlands Institute of Health Services Research (NIVEL), Otterstraat 118, 3513 CR Utrecht, The Netherlands For all author emails, please log on. BMC Health Services Research 2011, 11:304 doi:10.1186/1472-6963-11-304 The electronic version of this article is the complete one and can be found online at: http://www.biomedcentral.com/1472-6963/11/304 Received:18 July 2011 Accepted:10 November 2011 Published:10 November 2011 © 2011 Kemper et al; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Abstract Background Crew resource management (CRM) has the potential to enhance patient safety in intensive care units (ICU) by improving the use of non-technical skills. However, CRM evaluation studies in health care are inconclusive with regard to the effect of this training on behaviour and organizational outcomes, due to weak study designs and the scarce use of direct observations. Therefore, the aim of this study is to determine the effectiveness and cost-effectiveness of CRM training on attitude, behaviour and organization after one year, using a multi-method approach and matched control units. The purpose of the present article is to describe the study protocol and the underlying choices of this evaluation study of CRM in the ICU in detail. Methods/Design Six ICUs participated in a paired controlled trial, with one pre-test and two post test measurements (respectively three months and one year after the training). Three ICUs were trained and compared to matched control ICUs. The 2-day classroom-based training was delivered to multidisciplinary groups. Typical CRM topics on the individual, team and organizational level were discussed, such as situational awareness, leadership and communication. All levels of Kirkpatrick's evaluation framework (reaction, learning, behaviour and organisation) were assessed using questionnaires, direct observations, interviews and routine ICU administration data. Discussion It is expected that the CRM training acts as a generic intervention that stimulates specific interventions. Besides effectiveness and cost-effectiveness, the assessment of the barriers and facilitators will provide insight in the implementation process of CRM. Trial registration Netherlands Trial Register (NTR): NTR1976 Background The risks, potential harm and costs of adverse events for patients at intensive care units (ICU) are larger than in other hospital departments [1], making improvement of patient safety in ICUs all the more important. The ICU is particularly vulnerable in terms of patient safety threats related to ineffective teamwork or failure to follow protocol [2,3]. Results of a Dutch record review study revealed that 9.4% of all patients admitted to the ICU experienced one or more adverse events, which is far above the average of a hospital (5.7%)[4]. Of these adverse events 50% were considered highly preventable. Similarly, Vincent and colleagues [5] reported 1.7 adverse events per patient per day in a medical-surgical ICU. It has been demonstrated that unsafe care more often originates from problems with non-technical skills than from a lack of technical expertise [6,7]. Non-technical skills are 'the cognitive, social and personal resource skills that complement technical skills and contribute to safe and efficient task performance' [8]. For example to be explicit in coordinating tasks or to share information. Studies have shown that a lack of non-technical skills led to poor teamwork resulting in critical incidents in the ICU [9,10]. Both national and international health authorities have advocated crew resource management (CRM) as a method to improve non-technical skills, especially in emergency departments, surgery and intensive care [11-13]. CRM, which has its roots in high-risk industries such as aviation [14], was developed in the early 1980's as a response to the finding that unsafe flight conditions were frequently the result of failures in pilots' non-technical skills rather than a lack in technical knowledge [15]. It has been shown that CRM can effectively improve safety in a variety of professional domains, such as nuclear power and offshore oil production [16,17]. It is plausible that the general principles of CRM can be used in the ICU as well, because the ICU shares characteristics with workplaces where CRM has been proven to be effective, such as high-stake outcomes, complex actions, and high time pressure [18]. CRM is based on the premise that human error is avoidable, but can never be eradicated. It is typically directed at creating awareness of human factors and performance limiters [19], and at teaching behaviours to neutralize these threats, for instance through leadership and speaking up [15]. Furthermore, it forces participants to assess and think about personal and peer behaviour. Concepts that are introduced during the training include inquiry, seeking relevant task related information, advocacy, communicating proposed actions, conflict resolution and decision making [19-21]. Thus, CRM is directed at increasing awareness of human limitations and changing team behaviour and communication in order to improve the management unsafe situations and, as a result, reduce adverse events. Although several studies have been carried out to evaluate the effectiveness of CRM in health care [22,23], none were conducted at an ICU. Rabøl and colleagues [24] conducted a systematic review about the reported effects of CRM training in health care. They found that the first reaction to the training was very positive and that attitudes changed in favour of the CRM principles. For instance, France and colleagues [25] reported that trainees indicated that CRM has the potential to increase patient safety and quality of care. However, going one step further, looking at behavioural change and the impact of the training on the organisational level (e.g. reduced number of bed days per patient), the results are less straight forward. For example, McCulloch and colleagues [26] found an increase of the use of non-technical skills for nurses, but not for anaesthetists and surgeons. There are several reasons for these inconsistent findings, which stipulate the necessity for the present research. It can be argued that a lack of consistent findings on a behavioural and organizational level is due to weak study designs. Most of the studies evaluate the effect of CRM within six months [24], which is a relatively short period for an innovation to be completely adopted and to become part of the daily routine [27]. In addition, most evaluations rely on a pre- and post training comparison, but do not include a control group [24]. In some studies the trained and non-trained participants were not separated in data gathering. Furthermore, observations have hardly ever been used to measure behavioural change, despite the high validity of this method as it measures behaviours when they actually occur. Therefore the aim of the study is to determine the effectiveness and cost-effectiveness of CRM on attitude, behaviour and organization one year after the training. In order to reach this goal, we will use a multi-method approach using questionnaires, direct observations, and interviews. Trained ICUs will be compared with matched control units using pre- and post measurements. The purpose of the present article is to describe the study protocol and the underlying choices of this evaluation study of CRM in the ICU in detail. Methods/Design Design and setting Ideally, a CRM training should be evaluated in a large multicenter trial [28]. In our case, time and money were limited, thus we looked for an alternative way to control for institutional variation. We chose for a paired controlled trial, with one pre-test and two post test measurements. Three pairs of comparable ICUs were selected out of a predefined cluster of eligible medium sized units (10 to 16 beds and 55 to 88 employees) of non-academic teaching hospitals. This type of ICU was chosen because these are large enough to form an independent unit, yet small enough to train all of the staff. Moreover, most ICUs in the Netherlands belong to this category or aim to accomplish this. Per pair one ICU received the training directly after the pre-test measurement and one ICU served as a control group. The participating hospitals had on average 641 beds and are located in an urban environment. Data collection took place from November 2009 until May 2010 (pre-test), June 2010 until September 2010 (post-test 1), and in November 2010 until May 2011 (post-test 2). In each measurement period data were simultaneously collected for the intervention and control unit, and consecutively for all pairs. Per pair each measurement period took 7 to 9 weeks. The intervention units received the training directly after the pre-test. The first post measurement was conducted three months after the training and the second post-measurement followed one year after the training. ICUs that fitted the profile of a possible intervention unit (i.e. hospital type; ICU size, level and staffing; closed format; taking part in the Dutch National Intensive Care Evaluation (NICE) registry [29]) were approached to participate in the present study (n = 12). Most of these ICUs were interested in CRM but unable to fulfil financial needs to start within the study period. Four ICUs were willing to act as an intervention unit and able to pass formal barriers, like finance and organisational arrangements. Of these four, one unit served as a pilot unit, and the other three units served as the intervention group in the main study. The remaining eight ICUs that fitted the profile were assessed to determine whether they could be matched to one of the intervention ICUs and act as control unit. This assessment comprised a structured conversation with the medical head and team leader and a measurement of the patient safety culture of all the IC-staff by means of the patient safety culture questionnaire [30], which was assessed in the intervention units as well. Important determinants in the matching procedure were the number of beds of the ICU, the number of ICU physicians (fte's), urban or rural area, the perception of patient safety, and the frequency of event reporting. The ICUs that were most similar to one of the intervention ICUs were matched to that ICU and served as a control unit. A total of three pairs of ICUs participated in our study. The study was approved by the Ethical Committee of the VU University Medical Centre and is in accordance with Dutch privacy regulations. The trial is registered in the Dutch Trial Registration record NTR1976. Pilot study A pilot study was conducted in one ICU with the aim to test whether the planned measurements were organisationally and logistically feasible. Furthermore, the pilot offered a chance for the researchers to get more acquainted with the CRM training as well as with the general daily routine at an ICU. The results of the pilot study indicated that the training was well received and that the planning of the measurements was realistic. Some measurements needed a bit more refinement. For instance, some important verbal behaviours were added to the observation form (e.g. the participant asks for input). Furthermore, the pilot indicated that a CRM change team was important to follow up the plans of action resulting from the training. It was suggested to include three or four IC employees with different backgrounds (e.g. a nurse, an ICU physician, a manager) in the change team. Therefore, in the main study we stimulated to form this change team during the training. Intervention: Crew Resource Management training A commercial vendor of CRM, QST Safe Skies, was contracted to deliver the training. This vendor has much experience with CRM trainings in the aviation sector, as well as in health care. Before the training, all ICU personnel was informed about the study and the training by means of an oral presentation and an information leaflet. Contact between the vendor and the researcher was kept to a minimum during the period in which the ICUs were trained. The training was classroom based and consisted of a class education session of two consecutive days from 9 till 17 o'clock. Due to a maximum of 15 participants per session, several trainings were organized to educate all members of the IC staff. To limit the period between the training of the first and the last group, every week at least one group was trained. It was made sure that in each group all professions were represented. The main objectives of the training sessions were to create awareness regarding the threats of suboptimal performance and ways to recognize these threats and prevent their negative consequences. To establish this goal, the participants were educated about CRM concepts and principles, discussed their own experiences with each other, and developed ready to use ideas, all in a setting of trust and openness. With situational awareness as a starting point to identify pitfalls and opportunities for enhancement of the quality of care, several topics were discussed on an organizational, team, and individual level (see Figure 1 and Table 1). Each topic was first introduced by describing the global working mechanisms. This was followed by the risks associated with the specific topic and a suggested approach to overcome these risks. Exercises were used to illustrate or highlight some of the key points. For instance, communication was first theoretically discussed using the sender-receiver model [31]. This was followed by a discussion about what can go wrong in this communication process. To further illustrate communication flaws participants heard a story which they then had to repeat to another person. This showed how quick people forget or even alter parts of a message. Near the end of this part of the training solutions were given to overcome the risks and pitfalls regarding communication (e.g. verify with your sender whether you understood the message correctly). Figure 1. Schematic representation of the structure of the CRM training. Table 1. A specification of the most important models and theories that were discussed during the CRM training There were two ways in which CRM concepts were translated into ready to use ideas. At the beginning of the training a discussion about the team roles of different professions in an ICU was carried out. These roles were interactively defined and written down on a sheet. These sheets were readily accessible for modification or adding content when something new was learned. At the end of both the first and second day, plans of action on organizational, team and individual level were formulated by the participants. A CRM change team was formed in each trained ICU to stimulate and facilitate the implementation of CRM initiatives after the training had ended. This team consisted of enthused representatives of all the professions and management which. The plans of actions of all the training sessions formed the starting point. Who and how many people exactly joined the change team was different for each ICU. Part of the training is that the two CRM instructors offer their help as consultant for one day or two day parts after the ICU was trained. It was up to the change team how to utilize this help (e.g. get organised; implement changes; reiterate theory). Framework of analysis and data collection The present study uses the evaluation framework for training programmes of Kirkpatrick [32] to determine the effectiveness and cost-effectiveness of CRM training. This framework comprises four levels of evaluation and is often applied in the CRM literature [17,24]. The first level is the reaction of the participant to CRM training. This is followed by the level of learning, which includes the gaining of new knowledge or skills and the constitution of new attitudes. The third level entails whether CRM changes behaviour. The fourth level is the organizational impact, for instance a decrease in the number of adverse events as a result of CRM. Each level is assessed with different measurements at the different data collection periods (see Table 2). In addition to the levels of Kirkpatrick, barriers and facilitators for successful implementation of CRM are assessed, to gain insight in the change process. Table 2. Overview of the measurements for each level of Kirkpatrick All measurements were administered simultaneously in each pair of intervention and control unit, except for the questionnaires regarding reaction to, and evaluation of the training. All measurements are described below in detail. Measurements - Questionnaires End-of-course critique The End-of-Course Critique (ECC) of Grogan and colleagues [22] was used to assess the reaction immediately after the training and assessed the perceived relevance and utility of the specific topics covered in the CRM training (e.g. 'The lecture about 'Human Factors' was relevant and useful'). The ECC consists of 21 statements that have to be rated on a 5-point scale varying from 'strongly disagree' to 'strongly agree' and one open end question. Evaluation questionnaire This questionnaire was used to assess the extent to which the training altered the awareness regarding CRM topics in their daily work, like the influence of personal and environmental factors on performance. Furthermore, it assesses to what extent the participant felt that there was more situational awareness and enhanced patient safety in the ICU as a result of the training. This was measured with thirteen statements that had to be rated on a 5-point scale, varying from 'not at all' to 'fully applicable'. In addition to these items, the participant was presented with possible reasons why they did or did not use CRM after the training. A set of 24 reasons were derived from implementation literature [27] and the pilot study. The participant could tick the reason(s) which applied to them (e.g. 'I have no time for CRM' or 'I am convinced that CRM is relevant'). SafeTeam questionnaire The SafeTeam questionnaire is a newly developed questionnaire which is partly based on the Operating Room Management Attitudes Questionnaire (ORMAQ) [33], specifically its items on teamwork and information sharing. Other items were newly developed, derived from insights on speaking up [34] and error management [35]. The SafeTeam contains two sections with seven dimensions each (see Table 3). The A-section assesses attitudes regarding behaviours emphasized in the CRM training. The B-section measures self-reported behaviour regarding CRM principles. This distinction between attitudes and actual behaviour is unique in the setting of CRM evaluations. Both questionnaires use a 5-point Likert scale as answering scale, varying from 'not at all' to 'fully applicable'. The psychometric properties of the SafeTeam will be assessed during this study. Table 3. Dimensions and sample items of the two sections of the SafeTeam questionnaire Process control questionnaire The process control questionnaire is an abridged version of the Tripod survey [36] and queries about daily work circumstances that may result in substandard acts, or active failures [37]. These circumstances are called basic risk factors. Groeneweg distinguishes 11 of these basic risk factors, six of which are specific for the branch in which the Tripod is developed (i.e. the oil industry) and five are generic. These five generic risk factors regard training, communication, organisation, procedures, and incompatible goals. If these factors are not managed properly, they can start a process that can result in a substandard situation. For instance, when existing guidelines or instructions are not available or of insufficient quality, the chance on non-adherence to these guidelines increases, making procedures a risk factor. In the present study relevant items in the context of CRM evaluation were selected for each of the generic basic risk factors, thereby reducing the number of items from 75 to 28. For each of the statements participants were asked whether they represented their experiences of the last six months (e.g. 'I could not find the information that I needed to accomplish my task'). The participant could answer 'yes', 'no' or 'do not know'. Patient safety culture The COMPaZ questionnaire [30] was used to measure the patient safety culture in the ICU. The COMPaZ is the translated Dutch version of the Hospital Survey on Patient Safety Culture (HSOPS) [38]. During translation and validation the COMPaZ was slightly altered from the HSOPS which resulted in 11 dimensions instead of 12 by combining two dimensions of the HSOPS and removing two items. Both questionnaires have successfully been used in previous research [30,38-40]. The COMPaZ consists of 40 items that assess the 11 dimensions. Each item posits a statement that has to be rated on a 5-point scale varying from 'strongly disagree' to 'strongly agree' or 'never' to 'always'. In addition, the COMPaZ comprises a subjective rating of the quality of patient safety in the ICU and incident reporting over the last year. Error culture The Error Culture Questionnaire (ECQ), developed and validated by Van Dyck [35,41] was used to assess shared attitudes towards, and common responses to error on unit level. According to Van Dyck error culture can be split up into four dimensions, i.e. mastery (trying to overcome errors by learning, analysing and correction), aversion (a rigid and negative attitude towards error occurrence and their deliberate covering up), social (sharing and helping) and awareness (a general readiness to handle errors). Each dimension consists of two or three scales, with a total of 11 scales for all dimensions. These scales are measured with 47 items. Each item is a statement regarding one of the 11 scales. Participants have to rate to which extend this statement applies to the unit on a 5-point scale, varying from 'not at all' to 'completely'. The ECQ has been successfully used in previous research [35,41,42]. Job satisfaction and affective commitment to the ICU Job satisfaction was measured with the Dutch translation [43] of the job satisfaction dimension of the Occupational Stress Inventory (OCI) [44]. The OCI job satisfaction contains six scales that can be used separately. Three scales were selected for the present study (i.e. satisfaction with (1) the job, (2) the organizational design and structure, and (3) the organizational processes). The other three scales were considered to be of less relevance to a CRM evaluation (i.e. appreciation, personal relations, and rewards). The three scales that were used comprised a total of 12 items, which are to be rated on a 5-point scale, varying from 'strongly disagree' to 'strongly agree'. One additional item was added to ask the participant point-blank how satisfied they are with their job (i.e. "Overall, how satisfied are you with your job?"). Affective commitment was assessed with the Dutch translation [45] of the affective subscale of the three component conceptualization of organizational commitment [46]. The questions were slightly altered to the ICU setting by renaming the term 'organization' to 'ICU' in all of the items. The affective commitment scale comprises 6 statements, which are to be answered on a 5-point Likert scale, varying from 'not at all' to 'fully applicable'. Demographics Several demographic characteristics were administered, including age, gender, position, tenure, experience with working in the hospital and in the ICU, working hours per week, and whether or not the participant has interaction with patients. Observation of non-technical skills Direct observations were used to determine the use of non-technical skills by the IC staff who had direct contact with patients. To assess non-technical skills, an observational model of the Royal Dutch Airlines was used (i.e. SHAPE) [47], which was adjusted for health care (Explicit Professional Oral Communication measurement (EPOC); development and psychometric results will be published separately). The EPOC classifies explicit professional oral communication of an observed person into six dimensions; assertiveness, working with others, task-oriented leadership, people-oriented leadership, situational awareness, and planning and anticipation. Each dimension is subdivided into several concrete verbal behaviours that together represent the dimension. Throughout an observation of 30 minutes an independent observer tallies how often each verbalization is displayed by the observed person, e.g. 'asks for input', 'coordinates tasks', or 'expresses concerns'. Only professional interaction with co-workers of the ICU was tallied, so social talk or conversations with the patients or family were not tallied. All observers had a non-medical background in social sciences and were trained for four days. During this training the observers learned the definitions of the verbal behaviours and practised observing at an ICU. To ensure that all observers rated behaviour in the same way and were consistent over time during the data collection period, regular meetings were organized to discuss complex cases. Additionally, 8% of observations were double coded by two independent observers contemporaneously. Furthermore, a 17 minute video of an ICU nurse was used to check the observers' consistency over time. Blinding observers for intervention status of a unit was not possible. Therefore, medical staff was instructed not to discuss the training or CRM issues with the observers and the observers were kept ignorant of the content of the training. The ICU staff was observed during daily practice, preferably two or three times on different days. All observations took place between 7 am and 7 pm. Each observation had a duration of 30 minutes. At the end of each observation the observed person was asked to fill out the NASA Task Load Index (NASA-TLX) [48] to measure the perceived workload during the observation. The observer independently scored workload as well. Next, the observer filled out which tasks the observed person had done during the thirty minutes of observation, whether there were enough possibilities for professional communication to display non-technical skills, what the level of care the patient received, the number of professional interactions, and with whom. Other Measurements Interview implementation progress Semi-structured interviews were conducted directly after the training and again one year later, to assess if and how CRM had been implemented and what, if any, the stimulating and hindering factors were in this process. Directly after the training the first interview was conducted with one or two persons who introduced CRM to the ICU. The aim of this interview was to discover how CRM came and stayed on the agenda, whether a change team was formed, whether there had been contact with the CRM trainers prior to the training, and whether and how CRM was embedded with existing processes or structures at the unit. One year after the training, during the second follow-up data collection period, an interview was held with the chairman of the change team. The aim of this interview was to examine whether, and if so, in what ways the ICU had actually implemented CRM after the training. Furthermore, it was asked what their present CRM initiatives were, and what the future directions were. As in the first interview there was special attention to factors that enhanced or hindered successful implementation of CRM. In addition, this second interview aimed to examine the tangible effects of CRM as well as to document the 'do's' and 'don'ts' for future CRM trained departments. Adverse events Adverse events were assessed using the 'top 9' of adverse outcomes as defined by the adverse outcome committee of the Dutch Association of Intensive Care [49], which are (1) Myocardial infarction; (2) Cardiac arrest, (3) Pneumothorax; (4) Cerebrovascular accident; (5) Critical illness neuro-myopathy; (6) Airway related problems except tracheotomy related problems; (7) Tracheotomy related complications; (8) Problems with vascular access; (9) Bleeding in the proximal and distant digestive tracts. These adverse outcomes were measured using an electronic registration form which was integrated with the digital medical record. Registration was done by the IC physicians as part of the medical record. Patient outcomes Patient characteristics were registered following current registration standards from the Dutch National Intensive Care Evaluation study [29]. These data were obtained from routine administrative systems following strict definitions and quality checks [50]. Baseline characteristics were collected, using these systems, as defined in the minimal dataset of NICE, which includes general characteristics, such as age, sex, acute and chronic diagnoses, number of admissions, mortality and standardized mortality ratio, Variable Life-Adjusted Display curve, start time and end time of mechanical ventilation, and discharge data from the ICU and hospital. Furthermore, several scoring systems were used to assess the severity of disease(s) and life expectancy of the patient, such as APACHE II [51], APACHE IV [52] and SAPS II [53]. These scores were used to adjust for differences in patient mix. All patient data for this study are anonymous. Additional ICU data - Intake questionnaire The intake questionnaire assessed basic information about the ICU and was filled out by the head of the ICU. It assessed the number of ICUs within the hospital and the corresponding number of beds per ICU, the total of full time employees, the number of permanent (more than six months) and temporary (less than six months) staff, the percentage of sick leave, participation in NICE registration, the teaching possibilities, the method and use of incident reporting, and the level of the ICU. ICU level refers to the complexity of care that the ICU can manage, varying from a close watch of critical patients for a short number of days (level one) to complex treatment that requires advanced technology and 24 hours per day availability of IC physician (level three). Finally, the intake comprised a question whether the ICU has a closed (specialized IC physician as main clinician) or an open format (the referring physician as main clinician). Statistical analyses The collected data will be checked for completeness and the characteristics and frequency of missing data will be described. Descriptive statistics will be used to describe baseline characteristics of patients, staff and ICU. Comparability of paired intervention and control ICUs will be assessed by comparing baseline data and structural indicators (e.g. number of beds). The effect of the CRM training will be assessed by comparing the before and after measurements of the intervention and control ICUs on all levels of Kirkpatrick's evaluation framework. Changes in patient safety culture, attitude and teamwork behaviour will be described and tested with the ANOVA procedure for repeated measures. This will be done on an individual level with adjustment for the unit. With the observations it is plausible that the different observations within one person will cluster with each other. To control for this clustering, a multilevel analysis will be applied with additional adjustment for the unit. Changes in patient outcomes or incidence of adverse outcomes during the follow-up will be assessed using linear regression analysis while adjusting for case-mix differences and clustering within an ICU. Cost-effectiveness analysis An economic evaluation will be carried out from a societal perspective and according to the Dutch guidelines for costing in economic evaluations [54,55]. The costs of CRM training will be assessed bottom-up, based on personnel time, material, housing and travel costs spend on the training. Direct medical costs of hospital stay will be assessed by multiplying the number of bed days in- and outside ICU with standard cost-prices from a societal perspective. If relevant, costs of extra interventions related to adverse outcomes during ICU stay will be included. To assess the cost-effectiveness of CRM training compared to no training with regard to patient safety at ICUs, the incremental costs per prevented adverse outcome will be computed. In addition a cost-benefit analysis will be performed to compare incremental costs of training with incremental costs of hospital stay. Interpretation of the results To describe the expected effects of the CRM training the causal chain of Brown [56] can be used (see Figure 2). This model is based on Donabedian's [57] distinction between structure, process and outcome. Structure, the exogenous factors that cannot be completely determined by managers within the organization, influences the endogenous processes within the organization. These processes in turn affect the outcomes and throughput of the organization. According to Brown [56] interventions can influence the process component of this model. He distinguishes two types of interventions: A generic and a specific intervention. A generic intervention is directed at the management or organizational processes of an organisation. A specific intervention focuses on clinical processes. This distinction can be compared to the latent and active failures of Reason [37]. Intervening variables, like morale and culture, connect the management and clinical processes. Figure 2. Causal chain linking interventions to outcomes [56]. Prerequisite for a successful intervention is that the fidelity is high. The fidelity of an intervention is the extent to which it is executed as it was supposed to be executed [58] or as Brown [59] states: "Did it do what was said on the can?" (p.172). We expect that the training has a high fidelity. First of all because the intervention ICUs are highly motivated to receive the training as they invested money and staff time. Furthermore, the training is well developed through previous experience of the instructors. This is also illustrated by the first reaction of the participants of the pilot study, of which over 87% (n = 71) stated that the presentations and exercises were relevant and useful. When CRM is positioned in the causal chain, it can be labelled as a generic intervention that generates specific interventions. By raising awareness of, and creating a shared perspective on, the threats and opportunities in their daily work processes, it enables personnel to recognise strengths and weaknesses [60]. It is expected that this will result in specific interventions to improve these weaknesses and maintain the strengths. For instance, the trained ICU staff can apply the CRM lessons about communication to develop a checklist for clinical handovers in order to minimize miscommunication in this particular situation. It is expected that the training will result in changes in the intermediate variables of the causal chain, which will result in specific improvement actions in practice. First, small interventions may be implemented to gain rapid success, i.e. installing and using a white board for communication. It may take more time to implement more complex and structural changes, such as implementing a protocol for safe patient transport. The ultimate goal of the training is that CRM principles are structurally embedded in the organization of the ICU and adopted as an integral part of the patient safety and error management culture. Concluding remarks The present study design is developed to assess the effects of CRM in the ICU, as well as to describe the process that explain such effects. What makes this study unique relative to other CRM evaluations is the combination of the long follow up of one year, the assessment of behavioural change with observations, and the use of matched control units. As recommended and used by several authors [17,23] the framework of Kirkpatrick is employed to distinguish different levels of effect. Besides the observations, a mix of different instruments is used in order to explain the effect on the levels of Kirkpatrick's framework. The matched control units protect the study against secular trends and sudden changes [61]. This study design pays particular attention to practicalities of implementing CRM, by incorporating the assessment of barriers and facilitators to follow up on CRM initiatives developed during the training. This will increase the understanding of the effect of CRM training at the behavioural and organizational level [24]. Furthermore, knowledge on barriers and facilitators will provide a pragmatic start for units that consider training their unit. Improving the use of non-technical skills of health care professionals in the ICU provides an opportunity to enhance the quality of care and decrease the number of adverse events. CRM appears to take full advantage of this opportunity. It stimulates the individual, as well as the team, to be aware of threats and risks and to manage unsafe situations effectively, for instance by communicating more explicitly. The plans of action resulting from the CRM training provide concrete starting points to implement CRM initiatives, which in turn can create a snowball effect of generic and specific interventions aimed at the improvement of quality and safety of the ICU. These initiatives may improve the management and clinical processes of the unit as well as patient outcomes. By learning from previous research, incorporating new perspectives and keeping an eye on the practical implications, this study design will determine how and to what extent CRM training accomplishes these effects. Abbreviations APACHE: Acute Physiology and Chronic Health Evaluation; CRM: Crew Resource Management; ICU: Intensive Care Unit; NICE: Dutch National Intensive Care Evaluation; SAPS: Simplified Acute Physiology Score Competing interests The authors declare that they have no competing interests. Authors' contributions PK drafted the final manuscript. MdB conceived the design of the study, drafted the initial research proposal and helped to draft the final manuscript. CvD and CW participated in the design of the study and helped to draft the manuscript. All authors read and approved the final manuscript. Acknowledgements This study is funded by Zon-MW, the Dutch Organisation for Health Research and Development. We would like to thank Patricia Antersijn, Fred Bleeker, Inge van Noord, Ellen Smit, Ralph So and Peter Tangkau for their contributions and advice in the development of this study design. References 1. Pronovost P: A passion for quality. In Accelerating Change Today (A.C.T.) for America's health: care in the ICU-teaming up to improve quality. National Coalition on Health Care, Institute for Healthcare Improvement. Washington; 2002::2-3. 2. Pronovost PJ, Thompson DA, Holzmueller CG, Lubomski LH, Morlock LL: Defining and measuring patient safety. Critical Care Clinics 2005, 21:1-19. vii PubMed Abstract \| Publisher Full Text 3. Rodriguez-Paz JM, Kennedy M, Salas E, Wu AW, Sexton JB, Hunt EA, Pronovost PJ: Beyond "see one, do one, teach one": toward a different training paradigm. Quality and Safety in Health Care 18:63-68. 4. Zegers M, de Bruijne MC, Wagner C, Hoonhout LHF, Waaijman R, Smits M, Hout FAG, Zwaan L, Christiaans-Dingelhoff I, Timmermans DRM, et al.: Adverse events and potentially preventable deaths in Dutch hospitals: results of a retrospective patient record review study. Quality and Safety in Health Care 2009, 18:297-302. PubMed Abstract \| Publisher Full Text 5. Vincent C, Taylor-Adams S, Stanhope N: Framework for analysing risk and safety in clinical medicine. BMJ 1998, 316:1154-1157. PubMed Abstract \| Publisher Full Text \| PubMed Central Full Text 6. Yule S, Flin R, Paterson-Brown S, Maran N: Non-technical skills for surgeons in the operating room: a review of the literature. Surgery 2006, 139:140-149. PubMed Abstract \| Publisher Full Text 7. Wolff AM, Bourke J: Reducing medical errors: a practical guide. Medical Journal of Australia 2000, 173:247-251. PubMed Abstract 8. Flin R, Patey R, Glavin R, Maran N: Anaesthetists' non-technical skills. British Journal of Anaesthesia 2010, 105:38-44. PubMed Abstract \| Publisher Full Text 9. Reader TW, Flin R, Mearns K, Cuthbertson BH: Developing a team performance framework for the intensive care unit. Critical Care Medicine 2009, 37:1787-1793. PubMed Abstract \| Publisher Full Text 10. Wright MC, Phillips-Bute BG, Petrusa ER, Griffin KL, Hobbs GW, Taekman JM: Assessing teamwork in medical education and practice: relating behavioural teamwork ratings and clinical performance. Medical Teacher 2009, 31:30-38. PubMed Abstract \| Publisher Full Text 11. Kohn LT, Corrigan JM, Donaldson MS: To Err is Human: Building a Safer Health Care System. Washington, D.C.: National Academy Press; 2000. 12. Raad voor Gezondheidsonderzoek [Advisory Council on Health Research]: Onderzoek Patiëntveiligheid [Patient Safety Research]. Den Haag; 2005. 13. Pizzi L, Goldfrab NI, Nash DB: Crew Resource Management and its applications in medicine. In Making Health Care Safer: A Critical Analysis of Patient Safety Practices. Edited by Shojania KG, Duncan BW, MacDonald KM, Wachter RM, Markowitz AJ. Rockville, MD: Agency for Healthcare Research and Quality; 2001. 14. Helmreich RL, Merritt AC, Wilhelm JA: The evolution of Crew Resource Management training in commercial aviation. International Journal of Aviation Psychology 1999, 9:19-32. PubMed Abstract \| Publisher Full Text 15. Helmreich RL: On error management: lessons from aviation. BMJ 2000, 320:781-785. PubMed Abstract \| Publisher Full Text \| PubMed Central Full Text 16. Salas E, Fowlkes JE, Stout RJ, Milanovich DM, Prince C: Does CRM training improve teamwork skills in the cockpit?: Two evaluation studies. Human Factors 1999, 41:326-343. Publisher Full Text 17. Salas E, Wilson KA, Burke CS, Wightman DC: Does crew resource management training work? An update, an extension, and some critical needs. Human Factors 2006, 48:392-412. PubMed Abstract \| Publisher Full Text 18. Morey JC, Simon R, Jay GD, Wears RL, Salisbury M, Dukes KA, Berns SD: Error reduction and performance improvement in the emergency department through formal teamwork training: evaluation results of the MedTeams project. Health Services Research 2002, 37:1553-1581. PubMed Abstract \| Publisher Full Text \| PubMed Central Full Text 19. Oriol MD: Crew resource management: applications in healthcare organizations. Journal of Nursing Administration 2006, 36:402-406. PubMed Abstract \| Publisher Full Text 20. Thomas EJ, Sherwood GD, Helmreich RL: Lessons from aviation: teamwork to improve patient safety. Nursing Economics 2003, 21:241-243. PubMed Abstract 21. Kosnik LK: The new paradigm of crew resource management: just what is needed to re-engage the stalled collaborative movement? Joint Commission Journal on Quality Improvement 2002, 28:235-241. PubMed Abstract 22. Grogan EL, Stiles RA, France DJ, Speroff T, Morris JA Jr, Nixon B, Gaffney FA, Seddon R, Pinson CW: The impact of aviation-based teamwork training on the attitudes of health-care professionals. Journal of the American College of Surgeons 2004, 199:843-848. PubMed Abstract \| Publisher Full Text 23. Haller G, Garnerin P, Morales MA, Pfister R, Berner M, Irion O, Clergue F, Kern C: Effect of crew resource management training in a multidisciplinary obstetrical setting. International Journal for Quality in Health Care 2008, 20:254-263. PubMed Abstract \| Publisher Full Text 24. Rabol LI, Ostergaard D, Mogensen T: Outcomes of classroom-based team training interventions for multiprofessional hospital staff. A systematic review. Quality and Safety in Health Care 2010, 19:1-11. 25. France DJ, Stiles R, Gaffney EA, Seddon MR, Grogan EL, Nixon WR Jr, Speroff T: Crew resource management training-- clinicians' reactions and attitudes. AORN 2005, 82:214-224. 26. McCulloch P, Mishra A, Handa A, Dale T, Hirst G, Catchpole K: The effects of aviation-style non-technical skills training on technical performance and outcome in the operating theatre. Quality and Safety in Health Care 2009, 18:109-115. PubMed Abstract \| Publisher Full Text 27. Grol R, Wensing M: What drives change? Barriers to and incentives for achieving evidence-based practice. Medical Journal of Australia 2004, 180:S57-S60. PubMed Abstract \| Publisher Full Text 28. Nielsen PE, Goldman MB, Mann S, Shapiro DE, Marcus RG, Pratt SD, Greenberg P, McNamee P, Salisbury M, Birnbach DJ, et al.: Effects of teamwork training on adverse outcomes and process of care in labor and delivery: a randomized controlled trial. Obstetrics & Gynecology 2007, 109:48-55. PubMed Abstract \| Publisher Full Text 29. Arts D, de KN, Scheffer GJ, de JE: Quality of data collected for severity of illness scores in the Dutch National Intensive Care Evaluation (NICE) registry. Intensive Care Medicine 2002, 28:656-659. PubMed Abstract \| Publisher Full Text 30. Smits M, Christiaans-Dingelhoff I, Wagner C, Wal G, Groenewegen PP: The psychometric properties of the 'Hospital Survey on Patient Safety Culture' in Dutch hospitals. BMC Health Services Research 2008, 8:230-238. PubMed Abstract \| BioMed Central Full Text \| PubMed Central Full Text 31. Schulz von Thun F: Hoe bedoelt u? [What do you mean?]. Groningen: Noordhoff Uitgevers BV; 2003. 32. Kirkpatrick DL, Kirkpatrick JD: Evaluating Training Programs: The Four levels. San Francisco: Berrett-Koehler Publishers Inc.; 2006. 33. Schaefer H, Helmreich R: The Operating Room Management Attitudes Questionnaire (ORMAQ). Austin: University of Texas; 1993. 34. Edmondson AC: Speaking up in the operating room: How team leaders promote learning in interdisciplinary action teams. Journal of Management Studies 2003, 40:1419-1452. Publisher Full Text 35. Van Dyck C: Putting errors to good use: Error management culture in organizations. Amsterdam: University of Amsterdam; 2000. 36. Groeneweg J: Controlling the uncontrollable: Preventing business upsets. Leiden: Global Safety Group; 2002. 37. Reason J: Human error: models and management. Western Journal of Medicine 2000, 172:393-396. PubMed Abstract \| Publisher Full Text \| PubMed Central Full Text 38. Sorra JS, Nieva VF: Hospital Survey on Patient Safety Culture. Rockville, MD: Agency for Healthcare Research and Quality; 2004. 39. Marshall DA, Manus DA: A team training program using human factors to enhance patient safety. AORN 2007, 86:994-1011. Publisher Full Text 40. Van Noord I, De Bruijne MC, Twisk JW: The relationship between patient safety culture and the implementation of organizational patient safety defences at emergency departments. International Journal for Quality in Health Care 2010, 22:162-169. PubMed Abstract \| Publisher Full Text 41. Van Dyck C, Frese M, Baer M, Sonnentag S: Organizational error management culture and its impact on performance: A two-study replication. Journal of Applied Psychology 2005, 90:1228-1240. PubMed Abstract \| Publisher Full Text 42. Hofmann DA, Mark B: An investigation of the relationship between safety climate and medication errors as well as other nurse and patient outcomes. Personnel Psychology 2006, 59:847-869. Publisher Full Text 43. Broers P, Evers A, Cooper CL: Differences in Occupational Stress in 3 European Countries. International Journal of Stress Management 1995, 2:171-180. Publisher Full Text 44. Cooper CL, Marshall J: Occupational Sources of Stress - Review of Literature Relating to Coronary Heart-Disease and Mental Ill Health. Journal of Occupational Psychology 1976, 49:11-28. Publisher Full Text 45. De Gilder D, Van den Heuvel H, Ellemers N: A three component model of organizational commitment. Gedrag en Organisatie 1997, 10:95-106. 46. Allen NJ, Meyer JP: The Measurement and Antecedents of Affective, Continuance and Normative Commitment to the Organization. Journal of Occupational Psychology 1990, 63:1-18. Publisher Full Text 47. Antersijn PAM, Verhoef MC: Assessment of non-technical skills: Is it possible? In Applications of psychology to the aviation system: Proceedings of the 21st conference of the European Association for Aviation Psychology (EAAP). Volume 1. Edited by McDonald N, Johnston N, Fuller R. Aldershot, England: Avebury Aviation; 1995::243-250. 48. Hart SG, Staveland LE: Development of NASA-TLX (Task Load Index): Results of empirical and theoretical research. In Human Mental Workload. Edited by Hancock PA, Meshkati N. Amsterdam: North Holland Press; 1988. 49. Arbous MS, Beishuizen A, Bosman RJ, Buise MP, Dawson L, Meeder JHJ, Salet GAM: Complicatieregistratie van de Intensive Care in Nederland. Netherlands Journal of Critical Care 2008, 12:294-301. 50. Arts DG, de Keizer NF, Scheffer GJ: Defining and improving data quality in medical registries: a literature review, case study, and generic framework. Journal of the American Medical Informatics Association 2002, 9:600-611. PubMed Abstract \| Publisher Full Text \| PubMed Central Full Text 51. Knaus WA, Draper EA, Wagner DP, Zimmerman JE: APACHE II: a severity of disease classification system. Critical Care Medicine 1985, 13:818-829. PubMed Abstract \| Publisher Full Text 52. Brinkman S, Bakhshi-Raiez F, Abu-Hanna A, De Jonge E, Bosman RJ, Peelen L, De Keizer NF: External validation of Acute Physiology and Chronic Health Evaluation IV in Dutch intensive care units and comparison with Acute Physiology and Chronic Health Evaluation II and Simplified Acute Physiology Score II. Journal of Critical Care 2010, 26:11-18. 53. Le Gall JR, Lemeshow S, Saulnier F: A new Simplified Acute Physiology Score (SAPS II) based on a European/North American multicenter study. Journal of the American Medical Association 1993, 270:2957-2963. PubMed Abstract \| Publisher Full Text 54. Oostenbrink JB, Buijs-Van der WT, van AM, Koopmanschap MA, Rutten FF: Unit costs of inpatient hospital days. Pharmacoeconomics 2003, 21:263-271. PubMed Abstract \| Publisher Full Text 55. Oostenbrink JB, Koopmanschap MA, Rutten FF: Standardization of costs: The Dutch Manual for Costing in economic evaluations. Pharmacoeconomics 2002, 20:443-454. PubMed Abstract \| Publisher Full Text 56. Brown C, Hofer T, Johal A, Thomson R, Nicholl J, Franklin BD, Lilford RJ: An epistemology of patient safety research: a framework for study design and interpretation. Part 1. Conceptualising and developing interventions. Quality and Safety in Health Care 2008, 17:158-162. PubMed Abstract \| Publisher Full Text 57. Donabedian A: Explorations in quality assessment and monitoring. In The definition of quality and approaches to it assessment. Edited by Griffith JR. Ann Arbor: Health Administration Press; 1980. 58. Rabin BA, Brownson RC, Haire-Joshu D, Kreuter MW, Weaver NL: A glossary for dissemination and implementation research in health. Journal of Public Health Management and Practice 2008, 14:117-123. PubMed Abstract \| Publisher Full Text 59. Brown C, Hofer T, Johal A, Thomson R, Nicholl J, Franklin BD, Lilford RJ: An epistemology of patient safety research: a framework for study design and interpretation. Part 3. End points and measurement. Quality and Safety in Health Care 2008, 17:170-177. PubMed Abstract \| Publisher Full Text 60. Taylor CR, Hepworth JT, Buerhaus PI, Dittus R, Speroff T: Effect of crew resource management on diabetes care and patient outcomes in an inner-city primary care clinic. Quality and Safety in Health Care 2007, 16:244-247. PubMed Abstract \| Publisher Full Text \| PubMed Central Full Text 61. Eccles M, Grimshaw J, Campbell M, Ramsay C: Research designs for studies evaluating the effectiveness of change and improvement strategies. Quality and Safety in Health Care 2003, 12:47-52. PubMed Abstract \| Publisher Full Text \| PubMed Central Full Text 62. Edwards E: Man and Machine: Systems for safety. In British Airline Pilots Associations Technical Symposium. London; :21-36. 63. Hawkins FH: Human factors in flight. Aldershot: Ashgate; 1987. 64. Shapell SA, Wiegman DA: The Human Factors Analysis and Classification System. Washington DC; 2000. 65. Hersey P, Blanchard KH: Management of Organizational Behavior. New Jersey: Prentice Hall; 1977. 66. Endsley MR: Theoretical underpinnings of situational awareness: A critical review. In Situation awareness analysis and measurement. Edited by Endsley MR, Garland DJ. Mahwah: Lawrence Erlbaum Associates; 2000. 67. Ingham H: The Johari window a graphic model of interpersonal awareness. In Western training laboratory in group development. Los Angeles; 68. Janis I: Victims of groupthink: A psychological study of forgein-policy decisions and fiascoes. Boston: Houghton Mifflin; 1972. Pre-publication history The pre-publication history for this paper can be accessed here: http://www.biomedcentral.com/1472-6963/11/304/prepub	v0
2024-06-03T18:26:15.484Z	2013-12-06T05:40:51.000Z	i7mir4o7fzja3g5rcml7orggdses4brp	{ "content_type": "text/html", "provenance": "cccc-CC-MAIN-2013-48-0004.json.gz:14062", "uncompressed_offset": 255636678, "url": "www.biomedcentral.com/1756-0500/4/5", "warc_date": "2014-01-03T03:19:48.000Z", "warc_filename": "<urn:uuid:d58b4257-7314-48e4-89f2-7302a38b160a>", "warc_url": "http://www.biomedcentral.com/1756-0500/4/5" }	cccc_CC-MAIN-2013-48	Email updates Keep up to date with the latest news and content from BMC Research Notes and BioMed Central. Short Report Biofilm formation at the solid-liquid and air-liquid interfaces by Acinetobacter species Sara Martí1, Jesús Rodríguez-Baño2, Manuella Catel-Ferreira1, Thierry Jouenne1, Jordi Vila3, Harald Seifert4 and Emmanuelle Dé1 Author Affiliations 1 Laboratory "Polymères, Biopolymères, Surfaces", University of Rouen, UMR 6270 & FR 3038 CNRS, IFRMP23, Mont-Saint-Aignan, France 2 Infectious Diseases and Clinical Microbiology Unit, Hospital Universitario Virgen Macarena, Seville, Spain 3 Department of Microbiology, Hospital Clinic, Barcelona, Spain 4 Institute for Medical Microbiology, Immunology and Hygiene, University of Cologne, Cologne, Germany For all author emails, please log on. BMC Research Notes 2011, 4:5 doi:10.1186/1756-0500-4-5 The electronic version of this article is the complete one and can be found online at: http://www.biomedcentral.com/1756-0500/4/5 Received:7 September 2010 Accepted:11 January 2011 Published:11 January 2011 © 2011 Martí et al; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Abstract Background The members of the genus Acinetobacter are Gram-negative cocobacilli that are frequently found in the environment but also in the hospital setting where they have been associated with outbreaks of nosocomial infections. Among them, Acinetobacter baumannii has emerged as the most common pathogenic species involved in hospital-acquired infections. One reason for this emergence may be its persistence in the hospital wards, in particular in the intensive care unit; this persistence could be partially explained by the capacity of these microorganisms to form biofilm. Therefore, our main objective was to study the prevalence of the two main types of biofilm formed by the most relevant Acinetobacter species, comparing biofilm formation between the different species. Findings Biofilm formation at the air-liquid and solid-liquid interfaces was investigated in different Acinetobacter spp. and it appeared to be generally more important at 25°C than at 37°C. The biofilm formation at the solid-liquid interface by the members of the ACB-complex was at least 3 times higher than the other species (80-91% versus 5-24%). In addition, only the isolates belonging to this complex were able to form biofilm at the air-liquid interface; between 9% and 36% of the tested isolates formed this type of pellicle. Finally, within the ACB-complex, the biofilm formed at the air-liquid interface was almost 4 times higher for A. baumannii and Acinetobacter G13TU than for Acinetobacter G3 (36%, 27% & 9% respectively). Conclusions Overall, this study has shown the capacity of the Acinetobacter spp to form two different types of biofilm: solid-liquid and air-liquid interfaces. This ability was generally higher at 25°C which might contribute to their persistence in the inanimate hospital environment. Our work has also demonstrated for the first time the ability of the members of the ACB-complex to form biofilm at the air-liquid interface, a feature that was not observed in other Acinetobacter species. Findings The observation of natural habitats has shown that bacteria generally aggregate in biofilm structures to persist [1]. Biofilm is an association of microbial cells which are surrounded by a matrix of polysaccharide material; this structure is an optimal environment for genetic material exchange between the different microorganisms [2]. Biofilm formation has been linked to the survival of pathogenic bacteria in the hospital environment and it has been connected to infections associated with indwelling medical devices. Indeed, biofilm bacterial communities confer a protection from environmental hazards [1,3]. The surface colonization can take place either at the solid-liquid interface (SLI-biofilm) or at the air-liquid interface (ALI-biofilm) where it forms a pellicle on the top of the liquid media as observed in other microorganisms such as Pseudomonas aeruginosa or Salmonella spp. [4,5]. The members of the genus Acinetobacter are ubiquitous Gram-negative cocobacilli that are frequently found in the environment but also in the hospital setting where they have been associated with outbreaks of nosocomial infections [6]. The so-called Acinetobacter calcoaceticus - Acinetobacter baumannii (ACB) complex contains phenotypically closely related species, i.e. the clinically most important species, A. baumannii, Acinetobacter Genospecies 3 and Acinetobacter Genospecies 13TU, also referred to as the A. baumanni group, and the environmental species A. calcoaceticus [7]. Although these species are very difficult to differentiate in the laboratory, their importance in the clinical environment is clearly different: A. baumannii and Acinetobacter Genospecies 13TU are responsible for most of the infections while Acinetobacter Genospecies 3 is less often associated with disease. On the other hand, A. calcoaceticus is mainly an environmental microorganism rarely involved in human infections [7]. Among them, A. baumannii has emerged as the most common pathogenic species involved in hospital-acquired infections [6,8-10]; this multiresistant opportunistic pathogen can survive on nutrient-limited surfaces for several days, even in dry conditions and in the harsh hospital environment [11]. One reason for this emergence may be its persistence in the hospital wards, in particular in the intensive care unit; this persistence could be partially explained by the capacity of these microorganisms to form biofilm. Therefore, our main objective was to study the prevalence of the two main types of biofilm formed by the most relevant Acinetobacter species. Overall, this study has shown the capacity of the members of the ACB-complex to form two different types of biofilm (SLI and ALI), and it revealed that biofilm formation increased at 25°C, a condition that might contribute to their persistence in the hospital environment. Bacterial strains This study has investigated the ALI and SLI-biofilm formation in different Acinetobacter spp.: 64 clonally unrelated A. baumannii clinical isolates collected during the GEIH-Ab2000 project [12]; Acinetobacter johnsonii (n = 34); Acinetobacter lwoffii (n = 26); Acinetobacter radioresistens (n = 20); Acinetobacter Genospecies 3 (n = 46); Acinetobacter Genospecies 13TU (n = 60); A. calcoaceticus (n = 10); Acinetobacter junii (n = 5). The Acinetobacter spp. other than A. baumannii were mainly recovered from catheter-related bloodstream infections and from the skin of patients outside the ICU and of healthy controls [13-15]. Both biofilm analyses were carried out on all the isolates in parallel. SLI-Biofilm formation SLI-biofilm formation was performed in 96-well plates; biofilm formation was determined in Mueller Hinton broth (Oxoid, France) using an initial OD600 of 0.01 and incubated at 25°C or 37°C for 48 h without shaking. Two wells were left uninoculated and used as negative controls. After checking that all the isolates had grown at a similar rate, the culture media was removed by inversion and the wells were washed twice with distilled water. The biofilm was stained with 0.5% crystal violet (w/v) for 20 minutes at room temperature and the wells were washed again to remove the unbound crystal violet. Biofilm formation was finally quantified at 550 nm after solubilisation with 95% ethanol. The bacterial isolates were considered to be positive for SLI-biofilm formation when the readings obtained were at least 3 times greater than the negative control. ALI-Biofilm formation ALI-biofilm formation was performed in 5 ml polystyrene tubes with a diameter of 12.8 mm; biofilm formation was determined in Mueller Hinton broth (Oxoid, France) using an initial OD600 of 0.01 and incubated at 25°C or 37°C for 72 h without shaking. Positive ALI-biofilm samples were identified visually (Figure 1); the isolates were considered positive when a pellicle was covering the whole liquid surface. Figure 1. ALI-biofilm formation by A. baumannii. a) the positive strain forms a pellicle on the top of the liquid media and the culture broth remains transparent; b) pellicle observed from above; c) inversed tube shows the pellicle strength. Data analysis All the experiments were performed in duplicate at two independent time-points. The percentages of isolates producing biofilm were compared by the chi squared test, or the Fisher exact test, as appropriate. A 2- tailed P value < 0.05 was considered significant. The percentage of isolates of the various Acinetobacter spp. producing biofilm is illustrated in Table 1. Table 1. SLI and ALI-biofilm formation in Acinetobacter spp. Results and discussion As shown in Table 1 SLI-biofilm was more frequently produced at both 25°C and 37°C in Acinetobacter Genospecies 3, Acinetobacter Genospecies 13TU, and A. baumannii than in A. johnsonii, A. lwoffii, and A. radioresistens (p < 0.05 for all comparisons). Thus, these results might explain, at least in part, the marked persistence of the three former species in hospitals and their involvement in nosocomial infections. Moreover, in a previous study (using the same collection of A. baumannii clinical isolates), Rodriguez-Baño et al. [16] showed that 63% of A. baumannii clinical isolates formed SLI-biofilm at 37°C. Based on these results, our study revealed that the rates of SLI-biofilm formation obtained for Acinetobacter Genospecies 13TU and A. baumannii were similar, as well as their variation related to the temperature (higher at 25°C than at 37°C). Likewise, ALI-biofilm was significantly more frequent at both 25°C and 37°C in Acinetobacter Genospecies 13TU and A. baumannii than in A. johnsonii, A. lwoffii, A. radioresistens, and Acinetobacter Genospecies 3 (p < 0.05). Overall, this similar behaviour in biofilm formation between A. baumannii and Acinetobacter G13TU is coherent with the fact that these two species are the most commonly found in the hospital. Our results showed (see Table 1) that ALI-biofilm was mainly formed by the members of the ACB-complex. Although A. junii had some capacity to form this characteristic biofilm, the number of isolates studied was too small to draw conclusions. By contrast, as a member of the ACB-complex, A. calcoaceticus has shown a different pattern at 37°C with a complete absence of ALI-biofilm formation together with a reduced ability to form SLI-biofilm, both of which could be explained by the fact that this species' natural habitat is the environment where lower temperatures usually prevail. Finally, as biofilm formation generally predominated at 25°C rather than 37°C, this mechanism could explain the observed persistence of the members of the A. baumannii group in the inanimate hospital environment. Previous studies have already reported that the members of the A. baumannii group and especially A. baumannii survive desiccation better than other Acinetobacter spp., comparing the survival rate of A. baumannii to those obtained for Staphylococcus aureus [7,17]. In addition, in a recent study, Wisplinghoff et al showed that all disinfectants tested inhibited the growth of A. baumannii [18] which suggests that these microorganisms in their planktonic state are susceptible to most disinfectants. As already demonstrated for other bacterial species, extracellular polymeric substances from the biofilm matrix play an important role in the resistance and tolerance to dehydration [19], suggesting that biofilm formation contributes to the ability of A. baumannii, and possibly the other members of the A. baumannii group, to survive better in the hospital environment and to resist the action of disinfectants. For A. baumannii, SLI-biofilm has already been described in several reports [20-22] and it has been linked to some device-associated infections [16]. Indeed, de Breij et al [21] have recently compared SLI-biofilm formation by the members of the ACB complex and concluded that there was no difference between clinically relevant and less-relevant Acinetobacter strains and species; in the same way, no temperature related differences were found for biofilm formation. Our results slightly differ from theirs possibly due to the higher number of strains and species analysed. They suggested a reduced biofilm formation for the Acinetobacter Genospecies 13TU although only 3 isolates had been studied; by contrast, after studying 60 isolates, our results clearly show that the behaviour for biofilm formation of this species is highly related to A. baumannii. On the other hand, although we have only studied 10 A. calcoaceticus isolates, the results also indicate an association between biofilm and temperature in this non-pathogenic species, a tendency that can be observed in most of the analysed species. The comparison with other non-pathogenic species outside the ACB-complex has shown a relevant difference for biofilm formation that was even increased when looking at the ALI-biofilm formation, an ability that to our knowledge has never been described in clinical isolates of the Acinetobacter spp. In summary, the members of the A. baumannii group have a higher ability to form SLI-and ALI-biofilm than other less clinically related species. Nevertheless, A. calcoaceticus, the environmental representative of the ACB-complex, showed a reduced biofilm formation at 37°C when compared to the other members of this complex. This feature could be connected to the higher colonization rate of patients by pathogenic Acinetobacter species (mainly A. baumannii and Acinetobacter Genospecie 13TU), and probably contributing to the increased risk of clinical infection. List of abbreviations SLI: Solid-Liquid Interface; ALI: Air-Liquid Interface; ACB-Complex: Acinetobacter calcoaceticus - Acinetobacter baumannii complex Competing interests The authors declare that they have no competing interests. Authors' contributions SM carried out the biofilm studies, participated in the design of the study and drafted the manuscript; JRB performed the statistical analysis and helped to draft the manuscript; MCF helped to perform the biofilm studies; TJ participated in the design of the study; JV participated in the design of the study and helped to draft the manuscript; HS participated in the design of the study and helped to draft the manuscript; ED participated in the design and coordination of the study and helped to draft the manuscript. All authors have read and approved the final manuscript. Consent Due to the observational and retrospective design of the study, the Ethic Committee of the participating centres waived the need for obtaining written informed consent. Acknowledgements The study was supported by the Centre National de la Recherche Scientifique (CNRS) and the Université de Rouen (France). We thank the Grupo de Estudio de la Infección Hospitalaria (GEIH) from the Sociedad Española de Enfermedades Infecciosas y Microbiología Clínica (SEIMC) and Ministerio de Sanidad y Consumo, Instituto de Salud Carlos III - FEDER, Spanish Network for the Research in Infectious Diseases (REIPI RD09/0008) for supporting this study. S.M has a post-doctoral fellowship from the region Haute Normandie. References 1. Davey ME, O'Toole GA: Microbial biofilms: from ecology to molecular genetics. Microbiol Mol Biol Rev 2000, 64:847-867. PubMed Abstract \| Publisher Full Text \| PubMed Central Full Text 2. Donlan RM: Microbial life on surfaces. Emerg Infect Dis 2002, 8:881-890. PubMed Abstract \| PubMed Central Full Text 3. Branda SS, Vik S, Friedman L, Kolter R: Biofilms: the matrix revisited. Trends Microbiol 2005, 13:20-26. PubMed Abstract \| Publisher Full Text 4. Friedman L, Kolter R: Genes involved in matrix formation in Pseudomonas aeruginosa PA14 biofilms. Mol Microbiol 2004, 51:675-690. PubMed Abstract \| Publisher Full Text 5. Solano C, Garcia B, Valle J, Berasain C, Ghigo JM, Gamazo C, Lasa I: Genetic analysis of Salmonella enteritidis biofilm formation: critical role of cellulose. Mol Microbiol 2002, 43:793-808. PubMed Abstract \| Publisher Full Text 6. Bergogne-Bérézin E, Towner KJ: Acinetobacter spp. as nosocomial pathogens: microbiological, clinical and epidemiological features. Clin Microbiol Rev 1996, 8:148-165. 7. Peleg AY, Seifert H, Paterson DL: Acinetobacter baumannii: emergence of a successful pathogen. Clin Microbiol Rev 2008, 21:538-582. PubMed Abstract \| Publisher Full Text \| PubMed Central Full Text 8. Dijkshoorn L, Nemec A, Seifert H: An increasing threat in hospitals: multidrug-resistant Acinetobacter baumannii. Nature Rev Microbiol 2007, 5:939-951. Publisher Full Text 9. Joly-Guillou M: Clinical impact and pathogenicity of Acinetobacter. Clin Microbiol Infect 2005, 11:868-873. PubMed Abstract \| Publisher Full Text 10. Wisplinghoff H, Hippler C, Bartual SG, Haefs C, Stefanik D, Higgins PG, Seifert H: Molecular epidemiology of clinical Acinetobacter baumannii and Acinetobacter genomic species 13TU isolates using a multilocus sequencing typing scheme. Clin Microbiol Infect 2008, 14:708-715. PubMed Abstract \| Publisher Full Text 11. Towner KJ: The genus Acinetobacter. Prokaryotes 2006, 6:746-758. Publisher Full Text 12. Rodriguez-Bano J, Cisneros JM, Fernandez-Cuenca F, Ribera A, Vila J, Pascual A, Martinez-Martinez L, Bou G, Pachon J: Clinical features and epidemiology of Acinetobacter baumannii colonization and infection in Spanish hospitals. Infect Control Hosp Epidemiol 2004, 25:819-824. PubMed Abstract \| Publisher Full Text 13. Seifert H, Strate A, Schulze A, Pulverer G: Vascular catheter-related bloodstream infection due to Acinetobacter johnsonii (formerly Acinetobacter calcoaceticus var. lwoffi): report of 13 cases. Clin Infect Dis 1993, 17:632-636. PubMed Abstract \| Publisher Full Text 14. Seifert H, Strate A, Schulze A, Pulverer G: Bacteremia due to Acinetobacter species other than Acinetobacter baumannii. Infection 1994, 22:379-385. PubMed Abstract \| Publisher Full Text 15. Seifert H, Dijkshoorn L, Gerner-Smidt P, Pelzer N, Tjernberg I, Vaneechoutte M: Distribution of Acinetobacter species on human skin: comparison of phenotypic and genotypic identification methods. J Clin Microbiol 1997, 35:2819-2825. PubMed Abstract \| PubMed Central Full Text 16. Rodriguez-Baño J, Marti S, Soto S, Fernandez-Cuenca F, Cisneros JM, Pachon J, Pascual A, Martinez-Martinez L, McQueary C, Actis LA, et al.: Clin Microbiol Infect. 2008, 14:276-278. PubMed Abstract \| Publisher Full Text 17. Jawad A, Seifert H, Snelling AM, Heritage J, Hawkey PM: Survival of Acinetobacter baumannii on dry surfaces: comparison of outbreak and sporadic isolates. J Clin Microbiol 1998, 36:1938-1941. PubMed Abstract \| PubMed Central Full Text 18. Wisplinghoff H, Schmitt R, Wohrmann A, Stefanik D, Seifert H: Resistance to disinfectants in epidemiologically defined clinical isolates of Acinetobacter baumannii. J Hosp Infect 2007, 66:174-181. PubMed Abstract \| Publisher Full Text 19. Stoodley P, Sauer K, Davies DG, Costerton JW: Biofilms as complex differentiated communities. Annu Rev Microbiol 2002, 56:187-209. PubMed Abstract \| Publisher Full Text 20. de Breij A, Gaddy J, van der Meer J, Koning R, Koster A, van den Broek P, Actis L, Nibbering P, Dijkshoorn L: CsuA/BABCDE-dependent pili are not involved in the adherence of Acinetobacter baumannii ATCC19606(T) to human airway epithelial cells and their inflammatory response. Res Microbiol 2009, 160:213-218. PubMed Abstract \| Publisher Full Text 21. de Breij A, Dijkshoorn L, Lagendijk E, van der Meer J, Koster A, Bloemberg G, Wolterbeek R, van den Broek P, Nibbering P: Do biofilm formation and interactions with human cells explain the clinical success of Acinetobacter baumannii? PLoS One 2010, 5:e10732. PubMed Abstract \| Publisher Full Text \| PubMed Central Full Text 22. Tomaras AP, Dorsey CW, Edelmann RE, Actis LA: Attachment to and biofilm formation on abiotic surfaces by Acinetobacter baumannii: involvement of a novel chaperone-usher pili assembly system. Microbiology 2003, 149:3473-3484. PubMed Abstract \| Publisher Full Text	v0
2024-06-03T18:26:15.484Z	2013-12-06T05:39:02.000Z	x6jgn6tuth7sxqehsx2tfelvq3p5okau	{ "content_type": "text/html", "provenance": "cccc-CC-MAIN-2013-48-0004.json.gz:14067", "uncompressed_offset": 298732907, "url": "www.crummy.com/2003/02/11/2", "warc_date": "2014-01-03T03:19:48.000Z", "warc_filename": "<urn:uuid:d58b4257-7314-48e4-89f2-7302a38b160a>", "warc_url": "http://www.crummy.com/2003/02/11/2" }	cccc_CC-MAIN-2013-48	< Dude, Where's My Lawyer? Next > : Brilliant! Tim works around the nonexistence of a Hiptop SDK by hooking up to AIM a Unix implementation of the software he wanted to implement on the Hiptop. Specifically, you can now play IF games on your Hiptop. (Found via referer logs thanks to Mike's tendency to mention GTV! and Degeneracy everywhere; thanks, Mike!) Filed under: , [Main] [Edit] Unless otherwise noted, all content licensed by Leonard Richardson under a Creative Commons License.	v0
2024-06-03T18:26:15.484Z	2013-12-06T05:44:18.000Z	y6rxs7ktelw3lzizafyrhhsmztemn4iq	{ "content_type": "text/html", "provenance": "cccc-CC-MAIN-2013-48-0004.json.gz:14071", "uncompressed_offset": 325423661, "url": "www.eea.europa.eu/data-and-maps/data/waterbase-transitional-coastal-and-marine-waters-5/tables-metadata", "warc_date": "2014-01-03T03:19:48.000Z", "warc_filename": "<urn:uuid:d58b4257-7314-48e4-89f2-7302a38b160a>", "warc_url": "http://www.eea.europa.eu/data-and-maps/data/waterbase-transitional-coastal-and-marine-waters-5/tables-metadata" }	cccc_CC-MAIN-2013-48	Personal tools Notifications Get notifications on new reports and products. Frequency: 3-4 emails / month. Subscriptions Sign up to receive our reports (print and/or electronic) and quarterly e-newsletter. Follow us Twitter Facebook YouTube channel RSS Feeds More Write to us For the public: For media and journalists: Contact EEA staff Contact the web team FAQ Call us Reception: Phone: (+45) 33 36 71 00 Fax: (+45) 33 36 71 99 next previous items Skip to content. \| Skip to navigation Sound and independent information on the environment Tables metadata File contains metadata definitions of all data tables. Category Additional information Files Geographical coverage: [+] Show Map Document Actions European Environment Agency (EEA) Kongens Nytorv 6 1050 Copenhagen K Denmark Phone: +45 3336 7100	v0
2024-06-03T18:26:15.484Z	2013-12-06T05:42:13.000Z	gcizuy6zupwz5gyd3lw6fuyv5txkbjh6	{ "content_type": "text/html", "provenance": "cccc-CC-MAIN-2013-48-0004.json.gz:14073", "uncompressed_offset": 328923044, "url": "www.eoearth.org/view/article/51cbeffb7896bb431f69fbea/?topic=60468", "warc_date": "2014-01-03T03:19:48.000Z", "warc_filename": "<urn:uuid:d58b4257-7314-48e4-89f2-7302a38b160a>", "warc_url": "http://www.eoearth.org/view/article/51cbeffb7896bb431f69fbea/?topic=60468" }	cccc_CC-MAIN-2013-48	Wind Wind Power: The World's Second-Largest Source of Greenhouse Gas-Free Energy May 7, 2012, 6:08 pm Topics: Modern, three-bladed vertical wind turbine. Signals from the wind vane control the yaw drive that turns the turbine into the wind. “Nacelle” is the aerodynamic housing that covers the machinery. Wind power is the second-largest source of renewable energy that does not produce greenhouse gases, surpassed only by hydroelectric power. Many countries are rapidly constructing wind power facilities, and within a few decades, wind power should provide about 4% of global electricity. As much as 72,000 gigawatts (GW) of wind power might be commercially feasible worldwide, many times the current total energy demand. [1] Winds derive from temperature differences between the Tropics and the Poles, between land and sea, and between Earth’s surface and upper atmosphere that produce pressure differentials among air masses. Electric power generated from wind is proportional to its speed (velocity) to the third power. Most potential sites for wind turbines are located just offshore, where land/sea temperature differentials drive winds and where open water presents few impediments. Modern wind turbines fall into two major categories. Horizontal turbine designs position the main turbine rotor shaft and electrical generator at the top of a support tower. They are more efficient in slower winds than are vertical designs, but require stiff, precisely aligned blades (oriented into the wind) to be efficient and to avoid interference from the support tower itself as well as uneven stresses on the blades and the bearings. To minimize stress on the rotor shaft, modern horizontal turbines have an odd number of blades, most commonly three (Figure 8.32). The other category of wind turbine has a vertical main rotor shaft. Typical designs, such as the Darrieus “eggbeater," allow ground placement of the generator and gearbox for easy access. These turbines operate without needing to be oriented into the wind but suffer from low efficiency, particularly at slow wind speeds, and sometimes require electric motors to start their rotation at low wind velocities. The intermittent nature of wind makes it an unpredictable energy source. Worse yet, demand for electricity may not coincide with periods of high winds. For instance, in the United States, the state of Texas generates the most wind power; the hottest days in Texas, which have the peak demands for electricity to power air conditioning, tend to be those with the least wind. Thus the success of wind power depends on integration into a large energy grid with a high capacity for energy storage such as hydroelectric power. On the positive side, the cost of wind power is competitive with other energy sources. Wind power has negligible fuel costs and relatively low maintenance costs; most costs are for construction and transmission. European power companies, which have extensive experience in wind turbines,have found them so profitable that they are financing two-thirds of the wind projects under construction in Texas. [2] Ecological concerns about wind turbines center largely on injuries to animals that fly into turbine blades. [3] However, wind turbines are responsible for a minute fraction— less than 0.003%—of bird deaths from collisions with human structures. Data is sparse, but fatal encounters between bats and turbines appear to occur at rates similar to those for birds in most places in the United States with the exception of the Appalachian Mountain region, where the rates for bats are several times higher. [3] Wind farms also face local opposition if their turbines obstruct scenic views. To improve their aesthetics, new installations have more widely spaced turbines, which look less cluttered than old installations, and offshore installations are located farther out to sea. [1] Archer, C. L. and M. Z. Jacobson (2005) Evaluation of global wind power. Journal of Geophysical Research-Atmospheres 110:- doi:D12110 Doi 10.1029/2004jd005462. [2] Krauss, C. (2008) Move over, oil, there's money in Texas wind. The New York Times, New York, February 23, 2008. [3] National Research Council (2007) Environmental Impacts of Wind-Energy Projects, National Academies of Sciences, Washington, D.C. This is an excerpt from the book Global Climate Change: Convergence of Disciplines by Dr. Arnold J. Bloom and taken from UCVerse of the University of California. ©2010 Sinauer Associates and UC Regents Glossary Citation Bloom, A. (2012). Wind Power: The World's Second-Largest Source of Greenhouse Gas-Free Energy. Retrieved from http://www.eoearth.org/view/article/51cbeffb7896bb431f69fbea	v0
2024-06-03T18:26:15.484Z	2013-12-06T05:40:16.000Z	ype7cogwm572d55sdwpn4rhv3m7g5fhp	{ "content_type": "text/html", "provenance": "cccc-CC-MAIN-2013-48-0004.json.gz:14075", "uncompressed_offset": 348874422, "url": "www.forensicswiki.org/w/index.php?action=info&title=Recovering_deleted_data", "warc_date": "2014-01-03T03:19:48.000Z", "warc_filename": "<urn:uuid:d58b4257-7314-48e4-89f2-7302a38b160a>", "warc_url": "http://www.forensicswiki.org/w/index.php?title=Recovering_deleted_data&action=info" }	cccc_CC-MAIN-2013-48	Information for "Recovering deleted data" Jump to: navigation, search Basic information Display titleRecovering deleted data Default sort keyRecovering deleted data Page length (in bytes)720 Page ID19 Page content languageEnglish (en) Search engine statusIndexable Number of views2,542 Redirects to this page0 Counted as a content pageYes Page protection EditAllow all users MoveAllow all users Edit history Page creatorJessek (Talk \| contribs) Date of page creation11:21, 29 October 2005 Latest editor.FUF (Talk \| contribs) Date of latest edit10:54, 13 June 2008 Total number of edits13 Total number of distinct authors8 Recent number of edits (within past 91 days)0 Recent number of distinct authors0	v0
2024-06-03T18:26:15.484Z	2013-12-06T05:52:42.000Z	bnojicb45xkufc2jzn6hnbpl3jldvrsj	{ "content_type": "application/xhtml+xml", "provenance": "cccc-CC-MAIN-2013-48-0004.json.gz:14083", "uncompressed_offset": 376412253, "url": "www.hindawi.com/journals/jna/2010/646109/cta/", "warc_date": "2014-01-03T03:19:48.000Z", "warc_filename": "<urn:uuid:d58b4257-7314-48e4-89f2-7302a38b160a>", "warc_url": "http://www.hindawi.com/journals/jna/2010/646109/cta/" }	cccc_CC-MAIN-2013-48	About this Journal Submit a Manuscript Table of Contents Journal of Nucleic Acids Volume 2010 (2010), Article ID 646109, 10 pages http://dx.doi.org/10.4061/2010/646109 Review Article Plant DNA Recombinases: A Long Way to Go Plant Biochemistry Section, Molecular Biology Division, Bhabha Atomic Research Center, Trombay, Mumbai 400 085, India Received 8 July 2009; Accepted 8 September 2009 Academic Editor: Aidan Doherty Copyright © 2010 Rajani Kant Chittela and Jayashree K. Sainis. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. How to Cite this Article Rajani Kant Chittela and Jayashree K. Sainis, “Plant DNA Recombinases: A Long Way to Go,” Journal of Nucleic Acids, vol. 2010, Article ID 646109, 10 pages, 2010. doi:10.4061/2010/646109	v0
2024-06-03T18:26:15.484Z	2013-12-06T05:42:50.000Z	nebcho2hvx5uplcebdwoan34g4whkrh4	{ "content_type": "application/xhtml+xml", "provenance": "cccc-CC-MAIN-2013-48-0004.json.gz:14084", "uncompressed_offset": 376417466, "url": "www.hindawi.com/journals/jnm/2012/193734/", "warc_date": "2014-01-03T03:19:48.000Z", "warc_filename": "<urn:uuid:d58b4257-7314-48e4-89f2-7302a38b160a>", "warc_url": "http://www.hindawi.com/journals/jnm/2012/193734/" }	cccc_CC-MAIN-2013-48	About this Journal Submit a Manuscript Table of Contents Journal of Nanomaterials Volume 2012 (2012), Article ID 193734, 2 pages http://dx.doi.org/10.1155/2012/193734 Editorial Bulk Nanostructured Metals and Alloys: Processing, Structure, and Thermal Stability 1Department of Chemical Engineering and Materials Science, University of California, Davis, CA 95616, USA 2Department of Materials Science and Engineering, North Carolina State University, Raleigh, NC 27695-7907, USA 3Department of Materials Science and Engineering, University of North Texas, Denton, TX 76203, USA 4Department of Metals and Materials Engineering, University of British Columbia, Vancouver, BC, V6T 1Z4, Canada Received 21 October 2012; Accepted 21 October 2012 Copyright © 2012 Hamed Bahmanpour et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Nanostructured metals and alloys have been the focus of research during the past few decades due to their interesting microstructures and promising mechanical properties. Despite the fact that this class of materials shows intriguing properties, there are roadblocks that prevent large-scale production and industrial application of these materials that include but not limited to low ductility and poor thermal stability. In this regard, tailoring mechanical and microstructural properties by developing new alloys and inducing different microstructural features via various processing routes have been the major point of interest for researchers to overcome the difficulties in industrialization of nanomaterials. High tendency of nanograins to reduce their energy by grain coalescence and growth brings the thermodynamics and kinetics of grain growth to attention in order to understand the phenomena and develop thermally stable nanostructures. Attempts in this regard include reducing the mobility of a grain boundary by means of mechanisms such as solute drag, second-phase particle pinning, and chemical ordering. On the other hand, the demand for producing large-sized bulk parts, especially in structural applications, has led to the emergence of new processing techniques and further application-based approaches to the issue of the nanostructured metals and alloys. This special issue addresses the different challenges for up scaling the production of nanostructured metals and alloys with emphasis on processing, microstructure, and thermal stability. We would like to express our appreciation to all authors in this special issue for their help and efforts in addressing these current issues in the field. Furthermore, thanks are extended to all reviewers for enhancing the quality of these papers. This special issue contains six papers related to synthesis and characterization of nanostructured metals and alloys. In “Thermal stability of neodymium aluminates high-k dielectric deposited by liquid injection MOCVD using single-source heterometallic alkoxide precursors,” P. Taechakumput et al. studied the effects of high-temperature post deposition annealing (PDA) on the properties of the thin films, deposited by metalorganic chemical vapor deposition (MOCVD) using single-source precursor. These thin films were shown to remain amorphous up to 50°C as indicated by XRD. No significant level of crystallinity or movement of metal ions was evident after annealing at 950°C as indicated by MEIS energy spectra. Good electrical integrity was maintained even after 950°C PDA showing the extracted dielectric permittivity of 12, a low leakage density of 7 × 10−7 Acm−2 at 2 MV cm−1, and a density of interface states at flat band of 4.01 × 1011 cm−2 eV−1. These features make the neodymium aluminate a potential candidate for the dielectric replacement. In their paper, Z. S. Hu et al. studied “Align Ag nanorods via oxidation reduction growth using RF-sputtering” and demonstrated an oxidation reduction growth (ORG) technique with mixed-gas sputtering to create Ag nanorod arrays via oxide-assisted growth without any chemical solutions or contamination from aqueous solution. The ORG methodology is used to deposit an Ag buffer layer with silver oxide nanoclusters to obtain Ag nanorod arrays using a two-step mixed gaseous process. The Ag nanorods grew in the original locations of reduced metal nuclei after thermal composition of silver oxide nanoclusters. The Ag nanorods stood vertically on the Ag buffer interlayer and grew from the interface between the Ag grains and the Ag buffer interlayer. The success of the technique provides support for the oxidation reduction growth (ORG) mechanism and proves suitable for fabrication of Ag nanorods in the semiconductor industry. Due to photoactivation caused by radiative recombination of Fermi level electrons and d-band holes, the observed photoluminescence spectra of the Ag nanorods were observed to be 2.17 eV in both air and vacuum. In “Synthesis of bulk nanostructured DO22 superlattice of Ni3(Mo, Nb) with high strength, high ductility, and high thermal stability,” H. M. Tawancy showed that bulk nanostructured DO22-type superlattice with high strength, high ductility, and high thermal stability can be synthesized in a Ni-Mo-Nb alloy with a composition approaching Ni3(Mo, Nb) by a simple aging heat treatment at 700°C. Upon thermal aging, the grains of the high temperature fcc phase are subdivided into ordered crystals on the nanoscale (10–20 nm) with room-temperature yield strength of about 820 MPa and tensile ductility of 35%. Plastic deformation in the ordered state is found to predominantly occur by twinning on (111) planes of the parent fcc structure indicating that the superlattice preserves the twinning systems of the parent phase leading to the observed high ductility. In their paper, E. Huerta et al. presented “Elastic modulus determination of Al-Cu film alloys prepared by thermal diffusion.” In this study, the elastic modulus of Al-50 at.% Cu alloy films with 50–250 nm thickness, prepared by thermal evaporation on Kapton 50HN flexible substrates and postthermal diffusion, was investigated. The morphology and mechanical properties of the Kapton foil substrate and metallic alloys were investigated to distinguish features and properties of the formed Al-Cu alloy from the bare substrate. Pure Al and Cu films with thickness of 50 nm were analyzed for comparison. The elastic modulus of 50–250 nm thick Al-50 at.% Cu alloys thermally evaporated on to Kapton substrates and postformed by thermal diffusion was investigated. Al2Cu phase was the dominant crystalline phase formed as determined by XPS. Force-strain curves of the Al-Cu alloys were obtained by subtracting the force-strain curve of the Kapton substrate from the force-strain curve of the Al-Cu/Kapton material system. The elastic modulus was obtained from the slope of the corresponding stress-strain curves. Elastic modulus of the Al-Cu alloys decreased as the film thickness increased, and their values were determined to be in the range of 106.1 to 77.8 GPa for 50 to 250 nm thick alloys, respectively. The elastic modulus of the studied Al-Cu alloys was found to lie between the corresponding bulk values of the Al and Cu films. The elastic modulus measured for 50 nm thick Al was higher than its corresponding bulk value, while the elastic modulus of 50 nm thick Cu was smaller than its bulk value. The highest values of the mean grain size and rms-roughness were found for the 150 nm thick Al-Cu alloy. The methodology used to obtain the elastic modulus does not yield alloy microfractures because of the small strains (<1%) applied during tensile testing. In their paper, M. Tavoosi and coworkers studied “Consolidation of amorphous Al80Fe10Ti5Ni5 powders by hot pressing.” The purpose of their study was to investigate the feasibility of fabricating amorphous Al80Fe10Ti5Ni5 powders by mechanical alloying and consolidation into bulk samples by a hot-pressing technique. The crystallization process of this amorphous alloy is a one-stage mode of the Al13(Fe,Ti)4 and Al3Ti intermetallic compounds. The results showed that the as-milled amorphous Al80Fe10Ti5Ni5 powders were consolidated successfully into bulk metallic glasses by a hot-pressing technique. The temperature and pressure for successful condensation of amorphous powders in the hot-pressing method were 550°C and 600 MPa, respectively. During the consolidation, the amorphous phase does not remain, and an AlTi intermetallic phase precipitates in the amorphous matrix. In their paper, K. S. Lin et al. investigated “Synthesis and characterization of metal hydride/carbon aerogel composites for hydrogen storage.” The synthesis, characterization, and H2 adsorption capacity of carbon aerogels (CAs)/metallic hydride nanocomposites as a catalyst were studied. Experimentally, The H2 storage capacity of metallic samples was measured by a TGA microbalance method. In addition, fine structure and crystallinity of metallic hydride was identified by BET nitrogen adsorption isotherms, HR-TEM, FE-SEM/EDS, XRD, and XANES/EXAFS. The carbon aerogels were very effective in improving the hydrogen storage capacity of the Fe-, Ti-doped MgH2 samples with the “hydrogen spillover” route. Additionally, metallic dispersion of Pd nanoparticles onto the CAs might improve the hydrogen adsorption abilities. Higher surface area from CAs and the defect criteria of the MgH2 surface due to the doping of the metallic particle cause improvement in the hydrogen adsorption capacities. Conversely, Ti-doping onto the sodium aluminum hydride only improves slightly the hydrogen storage capabilities. Hamed Bahmanpour Amir Kajbafvala Mohammad H. Maneshian Hamid Reza Zargar Khaled Youssef	v0
2024-06-03T18:26:15.484Z	2013-12-06T05:42:40.000Z	b7t526p4s3gptcsmi42cksmnfosero7k	{ "content_type": "application/xhtml+xml", "provenance": "cccc-CC-MAIN-2013-48-0004.json.gz:14085", "uncompressed_offset": 376427982, "url": "www.hindawi.com/journals/jre/2013/106063/", "warc_date": "2014-01-03T03:19:48.000Z", "warc_filename": "<urn:uuid:d58b4257-7314-48e4-89f2-7302a38b160a>", "warc_url": "http://www.hindawi.com/journals/jre/2013/106063/" }	cccc_CC-MAIN-2013-48	About this Journal Submit a Manuscript Table of Contents Journal of Renewable Energy Volume 2013 (2013), Article ID 106063, 8 pages http://dx.doi.org/10.1155/2013/106063 Research Article Evaluation of Potential Geographic Distribution for Large-Scale Photovoltaic System in Suburbs of China Department of Risk Engineering, University of Tsukuba, Tsukuba 3058573, Japan Received 19 February 2013; Accepted 24 June 2013 Academic Editor: Zuhal Oktay Copyright © 2013 Masashi Kawase et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Abstract Since China is the largest CO2 emitting country in the world, photovoltaic (PV) systems are expected to be widely installed to reduce CO2 emission. In general, available area for PV installation depends on urban area due to differences in land use and slope. Amount of electricity generated by a PV system also depends on urban area because of differences in solar irradiation and ambient temperature. The aim of this study is to evaluate the installation of large-scale PV systems in suburbs of China, taking these differences into consideration. We have used a geographic information system (GIS) to evaluate amounts of installation capacity of large-scale PV systems, electricity generated, and CO2 emission reduction by the installation capacity of large-scale PV systems in suburbs of Liaoning, Shanghai, Anhui, and Guangdong. In Liaoning, the amount of CO2 emission reduction by the installation capacity of large-scale PV systems was estimated to be the largest, 3,058 kt-CO2/yr, due to its larger amount of the installation capacity, 2439.4 MW, than the amount of the installation capacity in other regions. 1. Introduction According to the World Energy Outlook of IEA, the demand of annual primary energy in China is expected to be 3,737 Mtoe by 2035, about 1.8 times the energy consumption of China in 2008 [1]. In addition, China exhausts the most amount of CO2 and has emitted 6877.2 Mt-CO2 in 2009 [2]. Therefore, China has a large potential to reduce CO2 emission in the Asian region, and the CO2 emission reduction in China has an impact on the global warming. The Chinese government currently focuses on renewable energy to reduce CO2 emission. In the 12th Five Year Plan for Renewable Energy Development (2011–2015), the share of renewable forms of energy such as hydropower, wind, solar, and biomass is to be increased. Although the installed photovoltaic (PV) capacity was around 700 MW at the year-end 2010, and the State Council, China’s national cabinet, has now raised the target for solar energy to an unprecedented level of 9 GW of PV installations by 2015 [3]. Thus, it is expected that large-scale PV systems will be widely installed in order to achieve this target. There are few studies regarding installation of PV systems in China. Zhang et al. estimated cumulative installation of PV cells for large-scale PV power in China considering subsidy on PV installation and the electricity supply mix [4]. Ito et al. designed a very large-scale PV of 100 MW system in Gobi desert [5]. Byrne et al. assessed the economics and livelihoods impacts of stand-alone, small-scale PV system installation [6]. However, those studies give no explanation about potential of large-scale PV system based on the geographic feasibility analysis. In general, available area for a large-scale PV system depends on the specific urban area because of regional differences in land use, land slope, and the distance to the power-consuming area. The amount of electricity generated by a PV system also depends on the regional differences in solar irradiation and ambient temperature. Thus, the installation of large-scale PV systems should be evaluated for a specific region to account for these regional differences. This study aims to estimate the geographical distribution of the available area for large-scale PV systems in China using the geographic information system (GIS). The GIS is an effective tool for the regional evaluation of the feasibility of the installation of large-scale PV systems and takes the regional differences into consideration. In this study, the available area for large-scale PV systems has been estimated. Thereafter, the installation capacity of the large-scale PV system, the electricity generated, and the CO2 emission reduction is also evaluated. Finally, we have analyzed key-factors of the regional differences in CO2 emission reduction. 2. Study Areas First of all, distribution of tilt solar irradiation in China was clarified by using GIS data of Solar and Wind Energy Resource Assessment (SWERA) [7]. Figure 1 shows that the solar irradiation of coastal area in northeastern China is larger than that in southern or southeastern China. Four regions, Liaoning, Shanghai, Anhui, and Guangdong are considered as a subject area for study, because these regions are located on coastal area which is assumed to have a large number of urban area with strong demand for electrical power. Figure 1: Distribution of tilt solar irradiation. 3. Methods 3.1. Estimation of Available Area for a Large-Scale PV System For the installation of a large-scale PV system, an important factor is the proximity to the power-consuming area. Land slope is also an important factor because it may drive up the construction costs of a large-scale PV system. Land use is a fundamentally important factor. Therefore, we defined the available area for a large-scale PV system as area that meets the following three requirements.(1)A circular area situated at a distance and width of 4 km from the outer limits of area with population densities greater than 5,000 people per km2 to the circumference of the circle (circular area) [8].(2)Land sites with slopes less than 1%.(3)Grassland and unused land. Figure 2 shows steps of estimation of available area for a large-scale PV system. Using GIS, we first subdivided the study area into a 1 km mesh. Second, we extracted meshes with population densities above 5,000 people per km2. Thereafter, we defined a circular area situated at a distance and width of 4 km from the outer limits of area with population densities greater than 5,000 people per km2 to the circumference of the circle. We eliminated all meshes with slopes greater than 1%. Finally, we selected the meshes that have grassland or unused land. The population data for the meshes were obtained from population statistics data (2003) [9]. Land slope was obtained by analyzing a digital elevation model (DEM) data [10], using the GIS. The area of the grassland and unused land was obtained from the land use statistics data (2003) [9]. Figure 2: Steps of estimation of available area. 3.2. Estimation of Installation Capacity Capacity larger than 20 MW PV systems is the subject of this study. Installation capacity for each region is estimated for each 1 km mesh. To estimate the installation capacity, we defined a PV capacity density of 44 MW/km2 [11]. Multiplying this density by the available area on each 1 km mesh yields the installation capacity. Additionally, we defined availability rates from 10% to 100% for the available area, and we assumed that available area at each availability rate is continuous area that a large-scale PV system needs. We also estimated the installation capacity for each availability rate. Figure 3 shows samples of available area (0.80 km2) at availability rate 100% and 70%. A shaded area on the left in Figure 3 shows an example of the available area at availability rate 100%, and the installation capacity in the mesh is estimated to be 35 MW because 100% of the available area (0.80 km2) is assumed to be all continuous area. While a shaded area on the right in Figure 3 has also available area (0.80 km2) in total, the installation capacity in the mesh is estimated to be 24 MW because 70% of the available area is assumed to be continuous area (0.56 km2) at availability rate 70%. Figure 3: Samples of available area at availability rate (100%, 70%). 3.3. Calculation of Electricity Generated by the PV System The electricity generated annually by a PV system, (kWh), for each 1 km mesh is estimated from (1) [12] as where [kWh] is the monthly energy generation for each 1 km mesh and is estimated from (2) [13] as where is the performance ratio of the PV system, which is obtained from (3) [13]; (kW) is the nominal power of the PV array under standard test conditions; (kWh/m2 · month) is the monthly total solar irradiation tilted at latitude on each 1 km mesh; is the total irradiance under standard test conditions, which is 1.0 kW/m2 [12]. is obtained from the GIS data on Solar and Wind Energy Resource Assessment (SWERA) [7] as where is the parameter for losses on the PV array surface; for time-dependent losses by the module function; for losses by the array load; for losses by the array circuit. is the module temperature coefficient, which is obtained from (4). is the effective energy efficiency of the inverter. We use the JIS recommended values of 0.97 for , 0.95 for , 0.94 for , 0.97 for , 0.90 and for [13] as where is the maximum power temperature coefficient, which is −0.41°C−1 for c-Si PV modules; (°C) is the temperature of the PV module, which is obtained from (5) [13] as where (°C) is the daily ambient temperature profile averaged over month; (°C) is the weighted average of the annual increase of module temperature. We obtained for that region from the World Surface Data (2009) [14]. We used a value of 18.4°C for for PV systems mounted on racks [13]. 3.4. Calculation of CO2 Emission Reduction Annual CO2 emission reduction, [t-CO2/yr], by the PV system is obtained from following equation: where (t-CO2/MWh) is the CO2 emission reduction factor. EG (MWh/yr) is the electricity generated annually by the PV system. We used the baseline emission factor, EF, from the Clean Development Mechanism (CDM) for PV installation projects as the value for . The values of differ depending on power grid and are listed in Table 1. The EF for each region is obtained using the “Consolidate methodology for grid-connected electricity generation from renewable sources” [16] and using the following equation with values of operating margin CO2 emission factor, , Build Margin CO2 emission factor, , weighting of operating margin emission factor, , weighting of build margin emission factor, [17, 18]: Table 1: Value of for each region. 4. Results and Discussion In this chapter, detailed results for Liaoning are shown and discussed first. Next, results for Shanghai, Anhui, and Guangdong are shown and we finally discuss the regional differences by comparing each result. 4.1. Results for Liaoning 4.1.1. Available Area for Large-Scale PV Systems Figure 4 shows the circular area situated at a distance and width of 4 km from the outer limits of area with population densities greater than 5,000 people per km2 to the circumference of the circle in Liaoning. It is shown that the large number of circular area is located in the central district of Liaoning. Figures 5 and 6 show the distribution of slope angle and grassland, unused land in Liaoning, respectively. From Figure 5, it is found that most of central district of Liaoning has the land with slope angle less than 1%. It is shown from Figure 6 that the large amount of area with grassland or unused land is located in the western districts of Liaoning. Figure 4: Distribution of the circular area in Liaoning. Figure 5: Distribution of slope angle in Liaoning. Figure 6: Distribution of grassland or unused land in Liaoning. Figure 7 shows the available area for large-scale PV systems in each district of Liaoning. Jinzhou has the largest available area, 36.6 km2, because it has a large amount of grassland or unused land with slopes less than 1%. Shenyang, Huludao, and Chaoyang also have larger available area as compared to the other districts, because there are large areas of grassland and unused land. On the other hand, Benxi and Fushun have very little available area because of their small amount of the circular area with slope less than 1% and with grassland or unused land. Panjin has no available area despite all land in its circular area with slope less than 1%. The total available area for installation is estimated to be 144.74 km2 in Liaoning. Figure 7: Available area for large-scale PV systems. 4.1.2. Installation Capacity of a Large-Scale PV System Figure 8 shows the installation capacity of a large-scale PV system at availability rate 100% in each district of Liaoning. The districts with the largest available area have the largest amount of installation capacity. Jinzhou is estimated to have the largest installation capacity of 749 MW at availability rate 100%. A PV system larger than 20 MW cannot be installed in Benxi, Fushun, Tieling, Dandong, and Panjin. Figure 8: Installation capacity at availability rate 100% in each district in Liaoning. Figure 9 shows the total installation capacity in Liaoning at availability rates from 50% to 100%. Installation capacity has not been derived for availability rates from 10% to 40%, because a PV system larger than 20 MW needs more than 0.46 km2 for installation. The total installation capacity in Liaoning is estimated to be 2,439.4 MW. This value is equivalent to 10.4% of the maximum power demand of 23,940 MW [19]. At lower availability rates of 70% and 50%, the installation capacity in Liaoning is estimated to be 1,021.0 MW, and 171.8 MW respectively. The installation capacity at lower rates is more likely installed, because the area margin is more sufficiently accounted for. Figure 9: Installation capacity at each availability rate in Liaoning. 4.1.3. Electricity Generated and CO2 Emission Reduction Figure 10 shows the total amounts of electricity generated and CO2 emission reduction by installation capacity at availability rate 100% in each district of Liaoning. Jinzhou has the largest amount of electricity generated, 913.5 GWh/yr, and CO2 emission reduction, 880.2 kt-CO2/yr. Figure 10: Total amounts of electricity generated and CO2 emission reduction in each district of Liaoning. Benxi, Fushun, Panjin, Dangdong, and Teiling are estimated to have no electricity generated and CO2 emission reduction. These values mainly depend on the difference in installation capacity because there is little difference in solar irradiation and ambient temperature between districts and also the reduction emission factor, , is a constant value with regard to each district. 4.2. Comparison of the Results Between Different Regions 4.2.1. Comparison of the Available Area and Installation Capacity Figure 11 shows the circular area situated at a distance and width of 4 km from the outer limits of area with population densities greater than 5,000 people per km2 to the circumference of the circle in each region. The total amount of circular area and the available area for large-scale PV systems in each region are shown in Table 2. Liaoning has the largest amount of the available area because it has a lot of the circular area that have a large amount of grasslands or unused lands with slopes less than 1%. While Anhui and Guangdong have larger amount of the circular area than that of Liaoning, the available area of Anhui and Guangdong is smaller than that of Liaoning. The reason is that Anhui and Guangdong has smaller grassland or unused land in a lot of circular area. Shanghai has no available area, since it has smaller amount of circular area and there are no grassland or unused land in its circular area. Table 2: Total circular area and available area. Figure 11: Distribution of the circular area in each region. Figure 12 shows the installation capacity of a large-scale PV system at availability rates (50%, 70%, and 100%) in each region. For each availability rate, a PV system lager than 20 MW cannot be installed in Shanghai and Anhui. At availability rate of 100%, Liaoning is estimated to have a capacity of 2,439.4 MW, which is the largest installation capacity. The installation capacity in Guangdong is estimated to be 1,131.2 MW. At lower availability rates 70% and 50%, the installation capacity in Liaoning is estimated to be 1,021.0 MW and 171.82 MW, respectively. In Guangdong, the installation capacity is estimated to be 321.6 MW and 40.7 MW, respectively. Figure 12: Installation capacity at each availability rate (50%, 70%, and 100%) in each region. Table 3 lists the ratio between installation capacity at availability rates of 100% and peak demand for electricity in each region. The installation capacity in Liaoning, 2,439.4 MW, is equivalent to 10.4% of the peak demand 23,470 MW [19]. The installation capacity in Guangdong is equivalent to 1.5% of its peak demand 74,540 MW [20]. The ratio between installation capacity and peak demand of Shanghai and Anhui is equivalent to 0% since each region has no installation capacity. Table 3: Ratio between installation capacity at availability rate 100% and peak demand in each region. Figure 13 shows the amount of installation capacity for each scale (larger than 20 MW or 30 MW or 40 MW) at availability rate of 100% in Liaoning and Guangdong. In Liaoning, the installation capacity in case of larger than 30 MW amounts to 52.6% of its total capacity, which is higher than Guangdong. Liaoning has much continuous available area. Thus, it is supposed that large scale PV system is able to be installed in Liaoning. Figure 13: Scale of installation capacity at availability rate 100%. 4.2.2. Comparison of the Electricity Generated and CO2 Emission Reduction Table 4 lists annual electricity generated in 2010 and by installation capacity of large-scale PV system in each region. In Liaoning, the total electricity generated by the installation capacity of large-scale PV system at availability rate 100% is estimated to be 3,174 GWh/yr which is equivalent to 2.4% of its total electricity generated in 2010 [15]. In Guangdong, the total electricity generated by installation capacity of large-scale PV system at availability rate 100% is estimated to be 1,162 GWh/yr which is equivalent to 0.4% of its total electricity generated in Guangdong in 2010 [15]. Table 4: Comparison of electricity generated in each region (GWh/yr). Figure 14 shows the total CO2 emission reductions by the total electricity generated by installation capacity of large-scale PV system at availability rate 100%. The amount of total CO2 emission reduction is estimated to be 3,058 kt-CO2/yr in Liaoning and 919 kt-CO2/yr in Guangdong. Figure 14: Total CO2 emission reduction in each region. 4.2.3. Key-Factor Analysis Figure 15 shows a comparison of the CO2 emission reduction in each region on a common normalized scale ranging from 0 to 1 on the basis of the following factors, namely, the installation capacity at availability rate of 100%, the solar irradiation, the module-temperature coefficient, and the . This method makes it simpler to compare the results of this study, since 1 represents the best and 0 represents the worst for each factor. From the figure, the difference in the total CO2 emission reduction is affected significantly by the difference in the installation capacity. The difference in the module-temperature coefficient has little effect on the differences in CO2 emission reduction. Figure 15: Overall comparisons on a normalized scale. Differences in mainly affect the CO2 emission reduction from a 20 MW PV system, since differences in the total installation capacity are unrelated. In this case, has more influence on CO2 emission reduction than solar irradiation between Liaoning and the other regions. Figure 16 shows the key-factor analysis with normalization and the following are the details of the differences in the total amount of CO2 emission reduction between Liaoning and the other regions. Between Liaoning and Shanghai or Anhui, the installation capacity occupies 73.8%, and the difference in the solar irradiation including the module-temperature coefficient and the is 13.1%. Between Liaoning and Guangdong, the installation capacity occupies 60.2%, and the difference in the solar irradiation including the module-temperature coefficient and the is 19.6% and 20.2%, respectively. Figure 16: Details of the differences in the total amount of CO2 emission reduction in each region. 5. Conclusions The present study shows the installation capacity of large-scale PV systems, electricity generated, and CO2 emission reduction by the installation capacity of PV system in Liaoning, Shanghai, Anhui, and Guangdong considering regional differences. The installation capacity of large-scale PV systems in Liaoning is estimated to be largest because its available area, namely, the grassland and unused land, for large-scale PV systems is larger than the other regions. The amount of total electricity generated and CO2 emission reduction by the installation capacity in Liaoning is more 2.7 times larger than the other regions. From the results obtained by key-factor analysis, the total CO2 emission reduction is affected by three factors, significantly by the difference in the installation capacity. The difference in the installation capacity is more than 3 times larger than that in solar irradiation and . The difference in the CO2 emission reduction factor is not negligible between Liaoning and Guangdong because it is 20.2%. Based on the results of the evaluations performed in this study, it is expected that CO2 emission reduction by installing large-scale PV system will be larger in the region that has larger installation capacity. Acknowledgment This research was supported by the Environment Research and Technology Development Fund (E-1001) of the Ministry of the Environment, Japan. References 1. IEA, World Energy Outlook 2010, The International Energy Agency, 2010. 2. IEA, CO2 Emissions from Fuel Combustion Highlights, The International Energy Agency, 2011. 3. M. Hart, China Goes Solar as America Stumbles New Five-Year Plan Boasts Big Ambitions, Center for American Progress, 2011. 4. D. Zhang, Q. Chai, X. Zhang et al., “Economical assessment of large-scale photovoltaic power development in China,” Energy, vol. 40, no. 1, pp. 370–375, 2012. View at Publisher · View at Google Scholar · View at Scopus 5. M. Ito, K. Kato, H. Sugihara, T. Kichimi, J. Song, and K. Kurokawa, “A preliminary study on potential for very large-scale photovoltaic power generation (VLS-PV) system in the Gobi desert from economic and environmental viewpoints,” Solar Energy Materials and Solar Cells, vol. 75, no. 3-4, pp. 507–517, 2003. View at Publisher · View at Google Scholar · View at Scopus 6. J. Byrne, A. Zhou, B. Shen, and K. Hughes, “Evaluating the potential of small-scale renewable energy options to meet rural livelihoods needs: a GIS- and lifecycle cost-based assessment of Western China's options,” Energy Policy, vol. 35, no. 8, pp. 4391–4401, 2007. View at Publisher · View at Google Scholar · View at Scopus 7. SWERA, “Solar: monthly and annual average latitude tilt GIS data at 40 km resolution for China from NREL,” 2005, http://en.openei.org/apps/SWERA. 8. J. A. Carrión, A. E. Estrella, F. A. Dols, and A. R. Ridao, “The electricity production capacity of photovoltaic power plants and the selection of solar energy sites in Andalusia (Spain),” Renewable Energy, vol. 33, no. 4, pp. 545–552, 2008. View at Publisher · View at Google Scholar · View at Scopus 9. Beijing GeoTechway, “China resources and environment 1 km resolution grid data sets,” 2003. 10. China Historical GIS, “DEM raster dataset,” 2013, http://www.fas.harvard.edu/~chgis/. 11. NREL, Potential for Development of Solar and Wind Resource in Bhutan, National Renewable Energy Laboratory, 2009. 12. K. Kawajiri, T. Oozeki, and Y. Genchi, “Effect of temperature on PV potential in the world,” Environmental Science and Technology, vol. 45, no. 20, pp. 9030–9035, 2011. View at Publisher · View at Google Scholar · View at Scopus 13. NEDO, For Effective Performance of Photovoltaic System, New Energy and Industrial Technology Development Organization, 2010. 14. Japan Meteorological Agency, The World Surface Data, Japan Metrological Business Support Center, 2009. 15. Editorial committee of China Electric Power Yearbook, China Electric Power Yearbook 2011, China Electric Power Press, 2011. 16. United Nations Framework Convention on Climate Change-Executive Board, “ACM0002: consolidated baseline methodology for grid connected electricity generation from renewable sources—version 12.2.0,” 2011. 17. United Nations Framework Convention on Climate Change-Executive Board, “Methodological tool “Tool to calculate the emission factor for an electricity system” (version 02.2.1),” 2012, http://cdm .unfccc.int/methodologies/PAmethodologies/tools/am-tool-07-v2.2.1.pdf. 18. National Development and Reform Commission, “2011 baseline emission factors for regional power grids in China,” 2011, http://cdm.ccchina.g ov.cn/WebSite/CDM/UpFile/File2720.pdf. 19. State Grid Corporation of China, “The new record of the peak power demand in Liaoning,” 2010, http://www.indaa.com.cn/zt/hlgc/dbdw/201011/t20101117_450261.html. 20. Guangdong Grid Corporation of China, “The power demand in Guangdong exceeded ten billion,” 2011, http://news.sohu.com/20111221/n329794116.shtml.	v0
2024-06-03T18:26:15.484Z	2013-12-06T05:38:47.000Z	awrhzxa437uq2k32uqtim4ijfmn2cy67	{ "content_type": "text/html", "provenance": "cccc-CC-MAIN-2013-48-0004.json.gz:14096", "uncompressed_offset": 421417376, "url": "www.libreoffice.org/download/?lang=he&type=rpm-x86&version=3.6.5", "warc_date": "2014-01-03T03:19:48.000Z", "warc_filename": "<urn:uuid:d58b4257-7314-48e4-89f2-7302a38b160a>", "warc_url": "http://www.libreoffice.org/download/?type=rpm-x86&lang=he&version=3.6.5" }	cccc_CC-MAIN-2013-48	The free office suite Download LibreOffice For commercial support around LibreOffice see our list of certified partners. Selected: LibreOffice Linux - rpm (x86), version 3.6.5, Hebrew No regular installation files are available. Please change your selection or pick one from the additional downloads below. If you're looking for old versions, please visit our download archive. • Source code LibreOffice is an open source project and you can therefore download the source code to build your own installer.	v0
2024-06-03T18:26:15.484Z	2013-12-06T05:50:48.000Z	4gdk7dic7utjvoekhdemwsnyfgg3a36f	{ "content_type": "text/html", "provenance": "cccc-CC-MAIN-2013-48-0004.json.gz:14097", "uncompressed_offset": 421423070, "url": "www.libreoffice.org/download/?lang=ml&type=win-x86&version=3.5.7", "warc_date": "2014-01-03T03:19:48.000Z", "warc_filename": "<urn:uuid:d58b4257-7314-48e4-89f2-7302a38b160a>", "warc_url": "http://www.libreoffice.org/download/?type=win-x86&lang=ml&version=3.5.7" }	cccc_CC-MAIN-2013-48	The free office suite Download LibreOffice For commercial support around LibreOffice see our list of certified partners. Selected: LibreOffice Windows, version 3.5.7, Malayalam No regular installation files are available. Please change your selection or pick one from the additional downloads below. If you're looking for old versions, please visit our download archive. • Source code LibreOffice is an open source project and you can therefore download the source code to build your own installer.	v0
2024-06-03T18:26:15.484Z	2013-12-06T05:50:11.000Z	l2eai3h4yqcnb6aas54e2ibogdgas3s3	{ "content_type": "text/html", "provenance": "cccc-CC-MAIN-2013-48-0004.json.gz:14100", "uncompressed_offset": 432707496, "url": "www.mariowiki.com/Lily_%28Super_Paper_Mario%29", "warc_date": "2014-01-03T03:19:48.000Z", "warc_filename": "<urn:uuid:d58b4257-7314-48e4-89f2-7302a38b160a>", "warc_url": "http://www.mariowiki.com/Lily_(Super_Paper_Mario)" }	cccc_CC-MAIN-2013-48	Lily (Super Paper Mario) From the Super Mario Wiki Jump to: navigation, search This article is about the character appearing in Super Paper Mario. For information about the character with the same name appearing in Paper Mario, see here. Lily with her father Bleu. Lily is Bleu's daughter, living in a spacious blue home on Flopside's first floor in Super Paper Mario. Her parents are presumably divorced, as they do not live together, and her mother tells her that she must look after her father. She behaves similarly to Ellie of Flipside. According to Tippi, Lily secretly wants to become an actress and stays up at night practicing lines.	v0
2024-06-03T18:26:15.484Z	2013-12-06T05:39:00.000Z	hd6lxohwcvpaamqpjp2yqadyfg4olduw	{ "content_type": "text/html", "provenance": "cccc-CC-MAIN-2013-48-0004.json.gz:14101", "uncompressed_offset": 436840421, "url": "www.mdpi.com/1420-3049/16/6/4728", "warc_date": "2014-01-03T03:19:48.000Z", "warc_filename": "<urn:uuid:d58b4257-7314-48e4-89f2-7302a38b160a>", "warc_url": "http://www.mdpi.com/1420-3049/16/6/4728" }	cccc_CC-MAIN-2013-48	Molecules 2011, 16(6), 4728-4739; doi:10.3390/molecules16064728 Article Antioxidant Capacity and Phenolic Content of Caesalpinia pyramidalis Tul. and Sapium glandulosum (L.) Morong from Northeastern Brazil 1 ASCES College, Caruaruense Association of Higher Education, 55016-400, Caruaru-PE, Brazil 2 Department of Pharmaceutical Sciences, Health Sciences Center, Federal University of Pernambuco, 50740-521, Recife-PE, Brazil * Author to whom correspondence should be addressed. Received: 24 March 2011; in revised form: 30 April 2011 / Accepted: 24 May 2011 / Published: 7 June 2011 Download PDF Full-Text [176 KB, uploaded 7 June 2011 13:49 CEST] Abstract: The aims of this study were to quantify the phenolic content and evaluate the antioxidant potential of extracts from the bark and leaves of C. pyramidalis and S. glandulosum. The total phenolic content (TPC) and total tannin content (TTC) were determined using the Folin-Ciocalteu method, and the total flavonoids content (TFC) was measured via complexation with aluminum chloride. The antioxidant activity was evaluated with DPPH (2.2-diphenyl-1-picrylhydrazyl) and FIC (ferrous ion chelating) assays. The TPC ranged between 135.55 ± 9.85 and 459.79 ± 11.65 tannic acid equivalents (TAE) in mg/g material (mg TAE/g). The leaves of both species contained high levels of tannins and flavonoids. The crude ethanol extracts (CEE) from the bark of C. pyramidalis showed high antioxidant activity when compared to ascorbic acid and rutin, whereas the CEE from the leaves was more efficient in chelating ferrous ions. C. pyramidalis had very high phenolic content and anti-radical activity, which indicates a need for further studies aimed at the purification and identification of compounds responsible for the antioxidant activity. Keywords: Caesalpinia pyramidalis; DPPH assay; FIC assay; Phenolic compounds; Sapium glandulosum Article Statistics Click here to load and display the download statistics. Cite This Article MDPI and ACS Style Silva, C.H.T.P.; Sobrinho, T.J.S.P.; Castro, V.T.N.A.; Lima, D.C.A.; Amorim, E.L.C. Antioxidant Capacity and Phenolic Content of Caesalpinia pyramidalis Tul. and Sapium glandulosum (L.) Morong from Northeastern Brazil. Molecules 2011, 16, 4728-4739. AMA Style Silva CHTP, Sobrinho TJSP, Castro VTNA, Lima DCA, Amorim ELC. Antioxidant Capacity and Phenolic Content of Caesalpinia pyramidalis Tul. and Sapium glandulosum (L.) Morong from Northeastern Brazil. Molecules. 2011; 16(6):4728-4739. Chicago/Turabian Style Silva, Carlos Henrique Tabosa Pereira da; Sobrinho, Tadeu José da Silva Peixoto; Castro, Valérium Thijan Nobre de Almeida e; Lima, Danielle da Cunha Amaral; Amorim, Elba Lúcia Cavalcanti de. 2011. "Antioxidant Capacity and Phenolic Content of Caesalpinia pyramidalis Tul. and Sapium glandulosum (L.) Morong from Northeastern Brazil." Molecules 16, no. 6: 4728-4739. Molecules EISSN 1420-3049 Published by MDPI AG, Basel, Switzerland RSS E-Mail Table of Contents Alert	v0
2024-06-03T18:26:15.484Z	2013-12-06T05:40:13.000Z	el6qzzsrmxbexot4owdboycqhpmoc35g	{ "content_type": "text/html", "provenance": "cccc-CC-MAIN-2013-48-0004.json.gz:14102", "uncompressed_offset": 438956253, "url": "www.mediawiki.org/wiki/Onboarding_new_Wikipedians", "warc_date": "2014-01-03T03:19:48.000Z", "warc_filename": "<urn:uuid:d58b4257-7314-48e4-89f2-7302a38b160a>", "warc_url": "http://www.mediawiki.org/wiki/Onboarding_new_Wikipedians" }	cccc_CC-MAIN-2013-48	Onboarding new Wikipedians From MediaWiki.org Jump to: navigation, search Work by the Growth team at Wikimedia Foundation engineering and product development to get new registered Wikipedians to quickly become productive members of the community. Getting people up to speed in an organization or community is often called "onboarding". It is a term borrowed from human resources departments, but is now a common piece of the user experience design parlance. Rationale[edit \| edit source] As a follow-up to our work improving the account creation user experience, we have decided to focus on increasing the number of registered accounts that contribute and reach their fifth edit. There is more on that at our prioritization notes and Quarterly Product Plan. User experience[edit \| edit source] Our two goals for onboarding are: 1. Help editors accomplish their immediate objective, if they have one. 2. For users without a task in mind, get them to contribute something useful right away. We've created four personas to help understand the most common types of user registering, their experience level, and what task they might have in mind. Other onboarding tactics might involve helping users develop social connections or find help, or alternatively, get users to complete tasks such as profile completion prior to making any kind of substantive contribution to the encyclopedia. While it is standard for other applications to encourage people to fill out things like profiles or complete a checklist of tasks before using their product,[1] the Wikipedia way is to encourage people to focus on contributing content. The current behavior pattern of successful new Wikipedians matches this; of registered users who do complete an edit, the majority do so within an hour of registration.[2] Legacy/default experience[edit \| edit source] In the MediaWiki default, there is little to no direction given to new registered users immediately after they join. For the people who already know what they want to accomplish as editors, at least in the immediate future, this lack of onboarding is not necessarily an obstacle. However, we know that the majority of accounts registered –around 70%– never even attempt an edit.[3] With the redesign of our cross-wiki authentication architecture, users are redirected automatically back to their internal referrer (stored in a URL parameter) after signup and login. If they do not have an internal referrer, they will be directed back to the Main Page. Previously, the default onboarding experience was to present users with a landing page post-registration that confirmed their account creation, among other minor details (screenshot). New experience[edit \| edit source] After registration, users are sent back to the page they were viewing before signing up (the "returnto" URL parameter). If there is no known return destination, they are sent to the Main Page. On that page, a call to action appears, which invites them to either • Contribute to the page they are on right now (if it is editable). • Try editing a suggested article. These articles are derived from our recommender system, and if no category is set for a wiki to derive tasks from, only the first call to action will be provided to users. Only users who return to Special pages will be completely excluded from seeing any calls to action, since we cannot guarantee correct behavior on Special pages. If the user is on a non-article page (i.e. not namespace zero) they are given the same call to action as on non-editable articles, which is just the call to try editing a suggested page. Next, If the user elects to edit the page they are on, they are given a simple guided tour. (See specification.) If the user elects to try a suggested task, they are taken to a recommended article from the set tagged for copyediting. The article appears with a toolbar which describes the task, allows them to jump to another recommended article, and has a "Show me how" button to reactivate a guided tour (See specification) that walks them through making simple spelling and grammar improvements. Technical documentation[edit \| edit source] We will deliver this new onboarding experience through a combination of: GettingStarted presents the call to action pop-up on the returnto page after signup (and continues to implement the task tool bar and tasks) GuidedTour provides the guides for first editing and to how to complete a task More details on /Engineering sub-page. Experimental data and user testing[edit \| edit source] We arrived at this version after six major iterations. Previous A/B test and further analysis data can be found at Research:Onboarding and associated subpages. We also conducted several rounds of remote usability testing to date. See our conclusions and videos. See also[edit \| edit source] Notes[edit \| edit source] 1. Checklists and profile-related steps are present both in social networks, like Twitter and Facebook, but also content creation and sharing communities, like Flickr, Quora, Wikia etc. 2. Research:Lag between registration and first edit (2011) 3. Current rates hover around 30-35% without onboarding. Data: 1, 2, 3	v0
2024-06-03T18:26:15.484Z	2013-12-06T05:42:49.000Z	juqeiihdfcecro5o6niwe5ndi2gks2th	{ "content_type": "text/html", "provenance": "cccc-CC-MAIN-2013-48-0004.json.gz:14113", "uncompressed_offset": 480036611, "url": "www.openwetware.org/index.php?oldid=210179&title=Hanson%3APeople", "warc_date": "2014-01-03T03:19:48.000Z", "warc_filename": "<urn:uuid:d58b4257-7314-48e4-89f2-7302a38b160a>", "warc_url": "http://www.openwetware.org/index.php?title=Hanson:People&oldid=210179" }	cccc_CC-MAIN-2013-48	Hanson:People From OpenWetWare Jump to: navigation, search [Home] People Protocols P.I. • Thomas Hanson [1] or [2] [Hanson Web Page] Current Students Graduates Undergraduates • Amanda Barnard (Biological Sciences and Animal Sciences) • Yun-Fei Lou (Biological Sciences) Former researchers Post-docs • Rachael Morgan-Kiss, Assistant Professor, Department of Microbiology, Miami University [Morgan-Kiss Web Page] • Lisa Waidner, Postdoctoral Researcher, Animal and Food Sciences and DBI, University of Delaware Undergraduates • Joy Lawani, Validation Specialist, Bio-Pharm Division, BE&K Inc • Steve Fatula, B.A. in Environmental Studies, Wesley College, Law student (environmental law), Rutgers University-Camden • Nolberto Figueroa Matias, B.S. in Industrial Biotechnology, University of Mayaguez (Puerto Rico), technician at Amgen, Inc. • Talisha Cox, B.A. in Biology, Lincoln University, currently applying for graduate school • Glenn Christman, B.S. in Biochemistry, Ph.D student in Dave Kirchman's group • Tim Weber, B.S. in Mechanical Engineering, Mechanical Engineer at Inteprod LLC • Michelle Madorma, B.S. in Animal Science, M.A. student in Ag & Tech Education at UD	v0
2024-06-03T18:26:15.484Z	2013-12-06T05:51:19.000Z	4vyqnecr3giaze7thhyiah6hvg5xbmhr	{ "content_type": "text/html", "provenance": "cccc-CC-MAIN-2013-48-0004.json.gz:14114", "uncompressed_offset": 480054767, "url": "www.openwetware.org/index.php?diff=249307&oldid=239980&title=Physics307L%3AInteractions", "warc_date": "2014-01-03T03:19:48.000Z", "warc_filename": "<urn:uuid:d58b4257-7314-48e4-89f2-7302a38b160a>", "warc_url": "http://www.openwetware.org/index.php?title=Physics307L:Interactions&diff=249307&oldid=239980" }	cccc_CC-MAIN-2013-48	Physics307L:Interactions From OpenWetWare (Difference between revisions) Jump to: navigation, search (Interactions) Line 2: Line 2: <div style="padding: 10px; width: 720px; border: 5px solid #008;"> <div style="padding: 10px; width: 720px; border: 5px solid #008;"> This page may serve as a sort of Q&A or message board for students and instructors. This page may serve as a sort of Q&A or message board for students and instructors. + ==A couple example programs== + [[User:Steven J. Koch\|Steve Koch]] 00:16, 7 October 2008 (EDT):Here are the Excel and LabVIEW files that I showed in class today. + [[Image:Speed of light calibration.vi ]] + [[Image:Speed of light Chad calibration.xls]] ==Welcome to Junior Lab!== ==Welcome to Junior Lab!== Revision as of 23:16, 6 October 2008 Physics 307L, Fall 2010 Home Schedule People Interactions Labs Assignments Grading Safety Help Winter Break Lab Fest This page may serve as a sort of Q&A or message board for students and instructors. Contents A couple example programs Steve Koch 00:16, 7 October 2008 (EDT):Here are the Excel and LabVIEW files that I showed in class today. Welcome to Junior Lab! Steve Koch says: It's nearing the end of the first week of Fall 08 classes, and I hope you're all enjoying things so far. I enjoyed meeting you this week and I'm excited about working and learning with you this semester. As I mentioned during lecture and lab this week, there is an assignment due before Monday September 8. See this page for the assignment: Physics307L:Assignments/Wiki assignment 1 Also as a reminder, we will not have class on Monday or Wednesday because of Labor Day. The TA, Aram, and I will be in lab on Wednesday from 2-5, and you are welcome to come by for help with wiki editing, or to start playing around with the oscilloscope lab. Additionally, you can contact me to setup another time to meet during the week if you'd like help with the wiki editing or to discuss anything. In addition to the above wiki assignment, you should click around on the other parts of the wiki. It would be good if you take a look at the course goals. If you have opinions about the goals, post a message about it on the talk page! Or on this "interactions" page. Have a great three day weekend and see you a week from Monday! Monday / Wednesday labs Steve Koch 15:34, 25 August 2008 (EDT): Dan Young said he can possibly switch to Wednesday if someone needs Monday desparately. Welcome to Physics 307L! Steve Koch 12:50, 25 August 2008 (EDT): If you want to ask a question or post a link that is relevant to everyone, please use this page! Add the page to your watch list by clicking the "watch" tab above. Link to previous year Old posts from Fall 2007 Interactions • Justin Roth Muehlmeyer 18:54, 30 August 2008 (EDT):This is Justin Making a comment. If any one has anything to say say it here I suppose. • Jason O Archer 15:08, 2 September 2008 (EDT): • Chad A McCoy 20:12, 3 September 2008 (EDT): Since we are apparently supposed to make a post here or something, greetings! • Paul V Klimov 23:43, 5 September 2008 (EDT):What's up everyone? • Arianna Pregenzer-Wenzler 00:56, 6 September 2008 (EDT):Check it out, I managed to replace the picture of me that was taken the first day of class with one a client e-mailed me taken on my birthday back in May. It would have been taken sometime over the course of the 13 hour day I worked prior to the phys 330 final. • Boleszek 1:50 am, 8 Sept 2008 (EDT):Well, I've managed to be an excellent procrastinator. It's almost 2 am on the Monday this was due and I am only now posting this comment. No, I'm not proud of myself. • Manuel 2:21 pm, 8 Sept 2008 (EDT):Yeah, i'm a little late too, but I didn't know what the hw was until like 2 min. ago. So what's UP! • Garrett 2:25 pm, 8 Sept 2008 (EDT):Like Manuel I too found out about the hw just now Personal tools	v0
2024-06-03T18:26:15.484Z	2013-12-06T05:38:59.000Z	mvb5awfdcg4x2srtfqbzpvhp5pbj5keb	{ "content_type": "text/html", "provenance": "cccc-CC-MAIN-2013-48-0004.json.gz:14115", "uncompressed_offset": 480063897, "url": "www.openwetware.org/index.php?diff=663355&oldid=662491&title=Sack", "warc_date": "2014-01-03T03:19:48.000Z", "warc_filename": "<urn:uuid:d58b4257-7314-48e4-89f2-7302a38b160a>", "warc_url": "http://www.openwetware.org/index.php?title=Sack&diff=663355&oldid=662491" }	cccc_CC-MAIN-2013-48	Error From OpenWetWare Jump to: navigation, search The database did not find the text of a page that it should have found, named "Sack" (Diff: 662491, 663355). This is usually caused by following an outdated diff or history link to a page that has been deleted. If this is not the case, you may have found a bug in the software. Please report this to an administrator, making note of the URL. Views Personal tools	v0
2024-06-03T18:26:15.484Z	2013-12-06T05:38:20.000Z	jfza3gisiot6jwpeyfugvia4jdd37sah	{ "content_type": "text/html", "provenance": "cccc-CC-MAIN-2013-48-0004.json.gz:14118", "uncompressed_offset": 528454350, "url": "www.seroundtable.com/archives/001201.html", "warc_date": "2014-01-03T03:19:48.000Z", "warc_filename": "<urn:uuid:d58b4257-7314-48e4-89f2-7302a38b160a>", "warc_url": "http://www.seroundtable.com/archives/001201.html" }	cccc_CC-MAIN-2013-48	When will MSN Search Beta Go Live Nov 29, 2004 • 10:27 am \| (0) by \| Filed Under Bing Search Many search engine optimizers are anticipating the day MSN Search will be replacing its current co-branded search by Yahoo! with its own search technology found at http://beta.search.msn.com/. A thread at Search Engine Watch discusses when the members feel that MSN will go live with its beta search. For some reason, I heard January recently. Danny Sullivan, who has been around this industry more then most, says in the thread: Bill Gates said earlier this year that the new tech would go live on MSN Search by the end of this year. That's why the Dec. 2004 date is out there. I think MSN Search may have recently backtracked and put out the Jan. 2005 date to have more time to work with. Either case, not long now. Previous story: MSN Search Slider Bug? blog comments powered by Disqus	v0
2024-06-03T18:26:15.484Z	2013-12-06T05:55:03.000Z	ppouqhmntouwrp2hoxjlosmw35vsrhim	{ "content_type": "text/html", "provenance": "cccc-CC-MAIN-2013-48-0004.json.gz:14126", "uncompressed_offset": 618562289, "url": "www.werelate.org/wiki/Family:Joseph_Chatt_and_Hannah_Coulson_%281%29", "warc_date": "2014-01-03T03:19:48.000Z", "warc_filename": "<urn:uuid:d58b4257-7314-48e4-89f2-7302a38b160a>", "warc_url": "http://www.werelate.org/wiki/Family:Joseph_Chatt_and_Hannah_Coulson_(1)" }	cccc_CC-MAIN-2013-48	Family:Joseph Chatt and Hannah Coulson (1) Watchers Facts and Events Marriage? 14 Dec 1816 Allenheads, Northumberland Children BirthDeath 1. 4 Sept 1817 Northumberland 2. 16 Nov 1819 Northumberland 2 Mar 1881 3. 3 Mar 1822 Northumberland 9 Jun 1889 4. 10 Mar 1824 Northumberland 13 Oct 1850 5. 21 Apr 1826 Northumberland 30 May 1826 6. 14 Apr 1827 Northumberland 20 Apr 1843 7. 4 Aug 1829 Northumberland 8 Aug 1855 8. 3 Feb 1832 Northumberland 9. 29 Oct 1834 Northumberland 28 Dec 1859 10. 17 Apr 1837 Northumberland Emigrant Children Three of Joseph and Maria's children emigrated to America. Around 1843, eldest son Thomas went with his wife Maria Ritson to Jo Daviess Co, Illinois, then to Iowa Co, Wisconsin, and ultimately to Bert Co, Nebraska; they had many descendants. Sometime between 1865 and 1873, youngest son James, a single man, settled in Fountain Co, Indiana, where he married Susan Rich, and had many descendants. Around the same time, eldest daughter Elizabeth Rowell, a widow, also moved to Fountain Co, Indiana, and was followed by her son and his family. Issues to Resolve Many of us in the Chatt family had believed that Joseph Chatt's wife was Hannah Maria Coulson. (This is in the records of Mark W. Chatt, and was believed to be true among the children of Thomas J. Chatt, perhaps due to her name appearing as Hannah Maria Coulson on a letter sent to her son James.) However, this appears to be a mistake. The IGI extract of the 1816 marriage of Joseph and Maria indicates the wife as Maria Marshall, not Maria Coulson. Moreover, an 1851 IGI marriage record extract shows in 1851 Maria Chatt married Thomas Coulson. The 1851 census shows this family with enough confirming factors to be sure that this is the same Maria. (We do not know when Joseph Chatt died, so presumably he died before 1851, and she remarried.) Thus, Coulson was not Maria's maiden name, but rather a surname from a second marriage. A further curiosity: the 1851 marriage extract lists her as "Maria Chatt or Robson", suggesting that her maiden name was Robson. So, was it Maria Marshall or Maria Robson? I have ordered films of the original parish registers, and hope they will provide more clues. --TomChatt 01:33, 29 August 2007 (EDT)	v0
2024-06-03T18:26:15.484Z	2013-12-06T05:50:36.000Z	x4tzzauu2wymtujx6awnb2i75a2r4fyw	{ "content_type": "text/html", "provenance": "cccc-CC-MAIN-2013-48-0004.json.gz:14140", "uncompressed_offset": 10546911, "url": "archive.mises.org/010290/", "warc_date": "2014-01-03T03:19:24.000Z", "warc_filename": "<urn:uuid:f32beab7-dcfa-47cc-a4b3-1e1ffbf00474>", "warc_url": "http://archive.mises.org/010290/" }	cccc_CC-MAIN-2013-48	1. Skip to navigation 2. Skip to content 3. Skip to sidebar Source link: http://archive.mises.org/10290/the-jobs-problem/ The Jobs Problem July 16, 2009 by Mandating benefits for employees imposes costs on employment. The would-be worker bears the cost. It makes the worker more expensive to hire. The employer has to pay not only a salary but also a benefit. If you make it more expensive to hire people, fewer people will be hired. It is no different from eggs at the supermarket. If they are $2 each, you will purchase fewer of them — you will economize. This is nothing but the law of demand: consumers will demand less of a good at a higher price than of a good at a lower price. A salary plus benefits amounts to a price that the employer must pay to purchase the work of a laborer. At a higher price, less work will be purchased by the employer. FULL ARTICLE Previous post: Next post:	v0
2024-06-03T18:26:15.484Z	2013-12-06T05:44:45.000Z	ndwmlpvtpcagh265ijqa3arhks4y2ris	{ "content_type": "text/html", "provenance": "cccc-CC-MAIN-2013-48-0004.json.gz:14169", "uncompressed_offset": 53363289, "url": "dot.kde.org/2006/03/14/people-behind-kde-alexander-neundorf", "warc_date": "2014-01-03T03:19:24.000Z", "warc_filename": "<urn:uuid:f32beab7-dcfa-47cc-a4b3-1e1ffbf00474>", "warc_url": "http://dot.kde.org/2006/03/14/people-behind-kde-alexander-neundorf" }	cccc_CC-MAIN-2013-48	MAR 14 2006 People Behind KDE: Alexander Neundorf People Behind KDE is our fortnightly exposé of the celebrities of KDE. Tonight we bring you the man who made the first Samba io-slave, an NFS io-slave and from those pre-zeroconf days the Lisa lan-browsing io-slave. This same man is single handedly porting KDE to a whole new build system, but get back in your seats ladies, he's not up for adoption. Find out all the gossip in our interview with Alexander Neundorf.	v0
2024-06-03T18:26:15.484Z	2013-12-06T05:43:17.000Z	3jjmzmopwtl7id25ojgz4y5eam5kvfyi	{ "content_type": "text/html", "provenance": "cccc-CC-MAIN-2013-48-0004.json.gz:14177", "uncompressed_offset": 65601501, "url": "familysearch.org/learn/wiki/en/index.php?oldid=985268&title=England_Research_Guidance%3A_Death%2C_1837-Present", "warc_date": "2014-01-03T03:19:24.000Z", "warc_filename": "<urn:uuid:f32beab7-dcfa-47cc-a4b3-1e1ffbf00474>", "warc_url": "http://familysearch.org/learn/wiki/en/index.php?title=England_Research_Guidance:_Death,_1837-Present&oldid=985268" }	cccc_CC-MAIN-2013-48	England Research Guidance: Death, 1837-PresentEdit This Page From FamilySearch Wiki Revision as of 12:19, 5 May 2012 by Cottrells (Talk \| contribs) (diff) ← Older revision \| Latest revision (diff) \| Newer revision → (diff) England English Burial or Death Dates Contents England \| Death \| 1837-Present Search Strategy Search the following records in the order listed. 1. Death Certificate: Civil registration Civil registration is the government registration of births, marriages, and deaths, beginning 1 July 1837. In these records you may find the name of the deceased, death date and place, age at death (which you can use to determine the year of birth), occupation (or in the case of a child, a parent's name), cause of death, and the name, address, and sometimes relationship of a person present at the death. Civil registration death records cover most of the population and are indexed countrywide. Use the national index to identify and obtain a copy of a death certificate. For further information, go to England Civil Registration. 2. Church Records: Church records Church records are parish, chapel, or congregation registers created by church authorities. They contain baptisms or christenings, marriages, and burials. In these records you may find names and dates and places of births or christenings, marriages, and burials. In the absence of a birth date, use a christening or baptism date. For further information, go to England Church Records. Also go to the Wiki pages for a county and for a parish of interest and the topic of Church Records. 3. Census: Census A census is a count and description of the population. Government census records are especially valuable because they list the majority of the population and are readily available at many repositories. In these records you may find names of the members of a household, gender, marital status, relationship to the head of the household, age, address, occupation, and birthplace. For further information, go to England Census. 4. Cemetery Records: Cemeteries Cemetery records are kept by sextons, administrators, or trustees of a private or municipal cemetery. In these records you may find the name and age of the deceased and dates and places of death and burial. Types of cemetery records include burial and cremation registers, monumental inscriptions, and burial plot maps. These records may help you identify family members buried nearby. They may provide clues to lead you to other records. Verify information found in cemetery records. For further information, go to England Cemeteries. 5. Monumental Inscriptions/Church Monuments: Cemeteries Monumental inscriptions and church monuments are memorials to persons who have died. Monumental inscriptions are engraved on stones placed at the graves of deceased persons. They are commonly found on headstones, tombstones, gravestones or plaques, depending on the area. Inscriptions may include the deceased's name and age, dates, and names of relatives. Church monuments are memorials to wealthy, noble, royal, or other distinguished people. They are often a brass plaque or stone statue or effigy placed inside the church or on church grounds. Information on church monuments may include only names and dates. You can access the information on monumental inscriptions and church monuments through printed transcriptions or by visiting the church. Verify the information from monumental inscriptions and church monuments. For further information, go to England Cemeteries. 6. Probate Records, Pre-1858: Probate records Probate records are court records dealing with the distribution of a person's estate after death. Before January 1858, Church of England courts had the responsibility to prove wills and other probate records. In these records you may find names and relationships. Probate records include wills, testaments, administrations (admons), inventories, codicils, act books, and bonds. For more information, go to England Probate Records. Also go to the Wiki page for a county of interest and the topic of Probate Records. 7. Probate Records, 1858 to Present: Probate records Probate records are court records dealing with the distribution of a person's estate after death. Beginning in January 1858, government courts had the responsibility to prove wills and other probate records. In these records you may find names and relationships. Probate records include wills, administrations (admons), and inventories. For more information, go to England Probate Records. Also go to the Wiki page for the Principal Probate Registry. 8. Newspapers: Newspapers Newspapers are published accounts of current events in a given area. Newspaper articles, notices, and community news items may provide information about births, marriages, and deaths. In these records you may find ages; dates and places of births, marriages, or deaths; and names of relatives. Large public or university libraries or libraries specializing in newspapers may help you locate the newspaper from your ancestor's area. For more information, go to England Newspapers. 9. Military Records: Military records Military records identify individuals who served in the army and navy. Other branches of the armed forces, which include militia, coast guard, and royal marines, also kept records. In these records you may find a name, age, regiment name or number, name of ship, date and place of birth, names of parents, and marriage information. The records may provide information not found in any other source. Military records include description books, soldiers' documents, regimental registers, returns of service, muster rolls and pay lists, continuous service engagement books, and chaplains' returns. You must know the regiment that your ancestor belonged to or the ship on which he served to find most military records. For more information, go to England Military Records. 10. Occupational Records: Occupations Occupational records provide information on a person's employment or training for a craft, trade, or profession. Knowing a person's occupation can distinguish him or her from other individuals with the same name. Occupational records may include name, age, residence, sometimes father's or widow's name, and other information about a person's life and family. Some types of occupational records are apprenticeship and freemen records; trade, guild, or livery records; and histories of occupations. For more information, go to England Occupations. 11. Family History: Genealogy The term family history describes a variety of records containing personal and family information gathered by researchers, societies, or archives. These records can include published family histories, pedigree charts, family group records, research notes on families, correspondence, ancestor lists, research exchange files, record abstracts, and collections of original or copied documents. Family histories can be excellent sources of information that can save you valuable research time. Because these records are compiled from a variety of sources, the information must be carefully evaluated and verified for accuracy. Internet genealogy sites can be helpful in researching a specific family name. If your ancestor emigrated from another country, look for more information in his or her country of birth. For more information, go to England Genealogy. 12. Biography: Biography A biography is a history of a person's life. A biography may provide an individual's date and place of death or burial, as well as other details. Look for biographies in biographical dictionaries and encyclopedias, society journals, periodicals, and in local histories. Some information in biographical sources may be inaccurate. For more information, go to England Biography. 13. Voters Lists: Voting registers Voting registers are lists of people who were qualified to vote. In these records you will find names and residences. Knowing where a person or family was at a certain time can give clues to death information. For more information, go to England Voting Registers. 14. City and Regional Directories: Directories Directories are alphabetical lists of names and addresses. Annual directories are published by large cities, businesses, professional associations, churches, and organizations. They usually list only the head of a household and may give his occupation. A person being listed in directories in successive years can show when he or she came to or left a city, or died. Knowing an individual's address can help you search the census and other records of a large city. Some directories begin in the mid-1700's. City and countywide directories begin in the early to mid-1800's. For more information, go to England Directories. 15. Tax Records: Taxation Tax records are accounts of taxes levied by the government. In these records you may find names and residences. Tax records do not give birth dates or parentage but identify an individual's residence in a certain place and time. Knowing where a person or family was at a certain time can give clues to birth, marriage, and death information. These records include lay subsidies, apprenticeship taxes, land tax assessments, valuations, hearth taxes, poll taxes, window taxes, and others. For more information, go to England Taxation. 16. Poor Law Records: Poorhouses, poor law, etc. Poor law records deal with the care of the poor. In these records you may find names, birth dates and places, marriage information, name of spouse, parents' names, death or burial information, and the parish where the family lived. Poor law records include churchwarden accounts, rate books, settlement certificates, removal orders, examinations, bastardy bonds, guardianship, and apprenticeship records. These records were created on a parish level before 1834 and on county and poor law union levels beginning in 1834. For more information, go to England Poorhouses, Poor Law, etc. 17. Court Records: Court records Court records are government documents concerning civil matters. Most court records name people who were defendants, plaintiffs, jurors, or witnesses. In these records you may find a person's residence, occupation, physical description, family relationships, name of spouse, and some death and marriage information. Court records seldom provide birth information but may give ages. Use court records after you have searched other records. Court records tend to be difficult to use because the handwriting is hard to read and they include unfamiliar legal terms. For more information, go to England Court Records. 18. School and Alumni Records: Schools School and alumni records are lists of individuals attending a school, college, or university. In these records you may find name, age, date and place of birth, residence, father's name and occupation, marriage information, and other biographical details. School records list teachers, students, and graduates. For more information, go to England Schools. 19. Marriage Certificate: Civil registration Civil registration is the government registration of births, marriages, and deaths, beginning 1 July 1837. In these records you may find names, ages (which you can use to determine a year of birth), marital status, fathers' names and occupations, the occupations and residences of the bride and groom, and names of witnesses. You must purchase a copy of a marriage certificate to see the information in the original record. Civil registration marriage records cover most of the population and are indexed countrywide. Use the national index to identify and obtain a copy of a marriage certificate. For more information, go to England Civil Registration. 20. Quarter Sessions: Court records Quarter sessions are records of a county criminal court held quarterly and presided over by a justice of the peace. In these records you may find names and ages, dates and places of death, names of spouses, residences, and more. Records of the quarter sessions may include: apprenticeship indentures, settlement examinations, removal orders, and criminal proceedings. For further information, go to England Court Records. Also go to the Wiki page for a county of interest and the topic of Court Records. Need additional research help? Contact our research help specialists. Need wiki, indexing, or website help? Contact our product teams. Did you find this article helpful? You're invited to explain your rating on the discussion page (you must be signed in).	v0
2024-06-03T18:26:15.484Z	2013-12-06T05:50:38.000Z	zi6gqsffoe6sfm5rlsbiii5l6nbakm5a	{ "content_type": "text/html", "provenance": "cccc-CC-MAIN-2013-48-0004.json.gz:14179", "uncompressed_offset": 67227567, "url": "figshare.com/articles/Aggressive_fibromatosis_%28desmoid_tumor%29_is_a_monoclonal_disorder/97677", "warc_date": "2014-01-03T03:19:24.000Z", "warc_filename": "<urn:uuid:f32beab7-dcfa-47cc-a4b3-1e1ffbf00474>", "warc_url": "http://figshare.com/articles/Aggressive_fibromatosis_(desmoid_tumor)_is_a_monoclonal_disorder/97677" }	cccc_CC-MAIN-2013-48	Aggressive fibromatosis (desmoid tumor) is a monoclonal disorder • DMP 1997 - Aggressive fibrom-Clon-199704000-00005.pdf download Share this: Embed* Cite this: Diaz-Cano, Salvador J.; A Alman, B; J Wolfe, H; E Pajerski, M; Corboy, K (2012): Aggressive fibromatosis (desmoid tumor) is a monoclonal disorder. figshare. http://dx.doi.org/10.6084/m9.figshare.97677 Description Aggressive fibromatosis (also called deep fibromatosis or desmoid tumor) is a proliferation of cytologically benign-appearing fibrocytes, often resulting in significant functional loss. The nature of the lesion is controversial: some evidence suggests that it is a reactive process, whereas other evidence supports a neoplastic etiology. The pattern of X chromosome inactivation, using a technique based on polymerase chain reaction (PCR) amplification of a hypervariable CAG repeat region flanking Hhal restriction sites of the human androgen receptor gene, was determined in four cases in which cryopreserved tumor and adjacent normal tissue were available. All four tumors demonstrated a monoclonal pattern, while the adjacent normal tissues demonstrated a polyclonal pattern. This demonstrates that aggressive fibromatosis is proliferation of cells derived from a single clone with a growth advantage, and thus is likely a neoplastic process. Links Comments (0) You must be logged in to post comments. 69 views 0 shares Published on 17 Nov 2012 - 19:48 (GMT) Filesize is 313.53 KB Categories Authors Tags Export Cite "Filename" Place your mouse over the citation text to select it Embed "Aggressive fibromatosis (desmoid tumor) is a monoclonal disorder" Place your mouse over the embed code to select and copy it Claim article You claim request was sent. I will be handled in the next 24 hours. Close window Feedback We appreciate all your comments, questions, suggestions or gratitude. Login The username or password entered are wrong. Reset password Your password will be sent to your registered e-mail address. Create account	v0
2024-06-03T18:26:15.484Z	2013-12-06T05:52:37.000Z	y7mfuamkmh5lbrnnjcfcob4y4kwrofqt	{ "content_type": "text/html", "provenance": "cccc-CC-MAIN-2013-48-0004.json.gz:14198", "uncompressed_offset": 96035880, "url": "ipkitten.blogspot.co.uk/2008/02/varec-ruling-values-confidentiality.html", "warc_date": "2014-01-03T03:19:24.000Z", "warc_filename": "<urn:uuid:f32beab7-dcfa-47cc-a4b3-1e1ffbf00474>", "warc_url": "http://ipkitten.blogspot.co.uk/2008/02/varec-ruling-values-confidentiality.html" }	cccc_CC-MAIN-2013-48	For the half-year to 31 December 2013, the IPKat's regular team is supplemented by contributions from guest bloggers Miri Frankel, Laetitia Lagarde and Bertrand Sautier Two of our regular Kats are currently on blogging sabbaticals. They are David Brophy and Catherine Lee. Tuesday, 19 February 2008 Varec ruling values confidentiality ahead of transparency in tendering The conflict between maintaining the confidentiality of industrial data and facilitating open competition for public contracts lay at the heart of last week's European Court of Justice ruling in Case C-450/06 Varec SA v Belgium, Diehl Remschied GmbH & Co intervening (click here for the IPKat's note on the Advocate General's Opinion in this case). Right: for the not-so-tender -- real leopard tracks To summarise the issue: back in December 2001 the Belgian government invited tenders for the supply of track links for Leopard tanks for which Varec and Diehl both submitted bids. Belgium didn't think Varec's bid met its technical selection criteria and also thought it unlawful. Diehl's bid, however, was unobjectionable, well priced and fitted all the criteria. Unsurprisingly the contract went to Diehl. In Belgian proceedings to annul the award of the contract, Varec wanted to see the details of Diehl's submission and was told it couldn't because that information was confidential. The trial court stayed the proceedings and asked the European Court of Justice a question for a preliminary ruling on whether the provisions of EU law relating to public tenders required the relevant authority to ensure confidentiality and observance of the business secrets contained in the files communicated to it by the parties to the case, including the contracting authority, while being entitled to appraise itself of such information and take it into account. The European Court of Justice ruled as follows: "[The law] must be interpreted as meaning that the body responsible ... must ensure that confidentiality and business secrecy are safeguarded in respect of information contained in files communicated to that body by the parties to an action, particularly by the contracting authority, although it may apprise itself of such information and take it into consideration. Right: another Belgian phenomenon -- Leopold tracks It is for that body to decide to what extent and by what process it is appropriate to safeguard the confidentiality and secrecy of that information, having regard to the requirements of effective legal protection and the rights of defence of the parties to the dispute and, in the case of judicial review or a review by another body which is a court or tribunal within the meaning of Article 234 EC, so as to ensure that the proceedings as a whole accord with the right to a fair trial". The IPKat notes that the European Court of Justice appears to value the confidentiality of information ahead of the entitlement to disclosure in the interests of open competition and fair play, whereas Advocate General Sharpston, while recognising the need for confidentiality, appeared to give it a more subservient role as against the entitlement of bidders for a contract to see that competing offers are fairly evaluated. Merpel says, yes but where does this leave the unsuccessful bidder who has been rejected on technical grounds that it may believe are open to challenge? How the leopard got his spots here The IPKat's favourite Belgian tank here Subscribe to the IPKat's posts by email here Just pop your email address into the box and click 'Subscribe':	v0
2024-06-03T18:26:15.484Z	2013-12-06T05:37:57.000Z	zzrlk7i5uyvlswesge27uhbclssjapl6	{ "content_type": "text/html", "provenance": "cccc-CC-MAIN-2013-48-0004.json.gz:14201", "uncompressed_offset": 99926076, "url": "journals.tdl.org/icce/index.php/icce/article/view/6826", "warc_date": "2014-01-03T03:19:24.000Z", "warc_filename": "<urn:uuid:f32beab7-dcfa-47cc-a4b3-1e1ffbf00474>", "warc_url": "http://journals.tdl.org/icce/index.php/icce/article/view/6826" }	cccc_CC-MAIN-2013-48	OVERTOPPING FLOW PROPERTIES CHARACTERIZATION IN LABORATORY AND PROTOTYPE THROUGH THE COMBINATION OF NON INTRUSIVE INSTRUMENTAL TECHNIQUES Alberto Llana, Rafael Molina, Alberto Camarero, Alvaro Campos, Ana Francisca Alises, José Damián López Abstract Overtopping events may cause different failure modes depending on overtopped flow characteristics. Most of the studies about overtopping hazard analysis link the damages caused by the overtopping event to its mean overtopping discharge (q), which provides no information about overtopped flow characteristics or its spatial distribution. In this paper it is presented a non intrusive measurement system based on video imagery techniques and optical level sensors (OLS), which aim is to obtain overtopped highly aerated flows´ principal characteristics: velocity, volume, and density, in order to deep in the knowledge of this phenomenon, and minimizing the damages that it may cause to port´s infrastructures and exploitation Keywords overtopping; aerated flows; instrumental techniques References Alises, A., Molina M., Gómez R., Pery P. (2012) Overtopping Hazards to port activities. Application of a new methodology to risk management (POrt RIsk MAnagement Tool). In press. Allsop, N.W.H., (2005). Report on hazard analysis, CLASH WP6 report, HR Wallingford, United Kingdom. Besley, P., (1999). Overtopping of seawalls - design and assessment manual, R & D Technical Report W178, Environment Agency, Bristol, United Kingdom, ISBN 1 85705 069 X. Bouma, J.J., Schram, A., François, D., (2004). Report on socio-economic impacts, CLASH WP6 report, Ghent University, Belgium. Briganti R., Bellotti G., Franco L., De Rouck J., Geeraerts J., (2005) "Field measurements of wave overtopping at the rubble mound breakwater of Rome - Ostia yacht harbor". Elsevier Science BV, Coastal Engineering. Cabrerizo et al. 2010 "Control of porosity, reflection and transmisión coefficients using polymeric porous media and their application in testing physical models" Coastlab 2010. Barcelona. Campos, A., Molina, R., Llana, A., Alises, A., Gomez, R., Castillo, C. (2012). Overtopping characterization for the elaboration of vulnerability maps in ports facilities. International Conference on Coastal Engineering. 1-7 July Santander, Spain. (in press). EurOtop Overtopping Manual (2007). Wave Overtopping of Sea Defences and Relates Structures Assessment Manual. Eds.Pullen, T., N.W.H Allsop, T. Bruce, A. Kortenhaus, H. Schüttrumpf & J.W. van der Meer. www.overtopping-manual.com. Gómez, R., Molina, R., (2012) Guía para el cálculo de la Fiabilidad y determinación del Riesgo en las Obras Marítimas e Instalaciones Portuarias mediante la aplicación de técnicas probabilistas. Puertos del Estado. Universidad Politécnica de Madrid.-in press. A.Llana et al (2011), "Técnicas de video imagen y sensores ópticos, las acciones del rebase" Proceedings of the 11th Jornadas de Puertos y Costas. Las Palmas de Gran Canaria, Spain Mansard E.P.D., Funke E.R. (1981) "The measurement of incident and reflected spectra using a least squares method". Coast. Eng. 1980, ASCE, New York, 154-172. Molina, R., Ortega, M., Moyano, J., Losada, M. (2008) "Analysis of the wave interaction with rubblemound breakwaters using video imagery techniques". Mediterranean Days PIANC, Palermo Molina, R. (2006) Resolución del problema geométrico en video imagen. Centro Andaluz de Medio Ambiente, Universidad de Granada. Pullen, T., Allsop, W., Bruce, T., Geeraerts, J., 2003. "Violent wave overtopping – CLASH field measurements at Samphire Hoe". Proc. Conf. Coastal Structures, Portland, Oregon, USA, pp. 469- 480. Pullen T., Allsop W., Tom Bruce, Jonathan Pearson. 2009 "Field and laboratory measurements of mean overtopping discharges and spatial distributions at vertical seawalls" Coastal Engineering 56 page 121–140http://dx.doi.org/10.1016/j.coastaleng.2008.03.011 Julien De Rouck, Björn Van de Walle, Peter Troch, Jentsje van der Meer, Luc Van Damme, Josep R. Medina, Marc Willems, and Peter Frigaard (2007) Wave Run-Up on the Zeebrugge Rubble Mound Breakwater: Full-Scale Measurement Results. Journal of Coastal Research: Volume 23, Issue 3: pp. 577 – 583.http://dx.doi.org/10.2112/04-0157.1 Ryu Y, Chang K-A, (2007a) Green water void fraction due to breaking wave impinging and overtopping. Exp Fluids 45:883–898http://dx.doi.org/10.1007/s00348-008-0507-3 Schüttrumpf H., Möller J., Oumeraci H. 2002 "Overtopping flow parameters on the inner slope of seadikes". 28 th Int. Conf. On Coastal Engineering. Cardiff, UK. PMid:12239326 PMCid:136579 Troch P., Geeraerts J., Van de Walle B., De Rouck J., Van Damme L., Allsop N.W.H., Franco L., (2004), Full scale wave overtopping measurements on the Zeebrugge rubble mound breakwater, Coastal Engineering. Volume 51, Issue 7, Pages 609–628.http://dx.doi.org/10.1016/j.coastaleng.2004.06.004 Verhaeghe H., van der Meer J., Steendam G.J., Besley P., Franco L. (2003); Wave overtopping database and a first neural network prediction method. Proceedings Coastal Structures 2003, Portland, Oregon, USA. Verhaeghe H (2004) "Neural Network Prediction of Wave Overtopping at Coastal Structures" Doctoral Dissertation, Gent University. Full Text: PDF This work is licensed under a Creative Commons Attribution 3.0 License.	v0
2024-06-03T18:26:15.484Z	2013-12-06T05:56:24.000Z	qth2pzje2xjcfx2vpyntimru35svs56x	{ "content_type": "text/html", "provenance": "cccc-CC-MAIN-2013-48-0004.json.gz:14222", "uncompressed_offset": 136752033, "url": "openwetware.org/index.php?oldid=613231&title=Swartz%3APeople", "warc_date": "2014-01-03T03:19:24.000Z", "warc_filename": "<urn:uuid:f32beab7-dcfa-47cc-a4b3-1e1ffbf00474>", "warc_url": "http://openwetware.org/index.php?title=Swartz:People&oldid=613231" }	cccc_CC-MAIN-2013-48	Swartz:People From OpenWetWare Revision as of 20:45, 9 July 2012 by Franklin J Lu (Talk \| contribs) Jump to: navigation, search Research Papers People Contact Contents James R Swartz Postdoctoral Researchers and Visiting Scholars with doctoral/home institution Yuan Lu, Ph.D. Postdoctoral Researcher Tsinghua University, Beijing, China Cem Albayrak, Ph.D. Postdoctoral Researcher Stanford University Graduate students with department and undergraduate institution Alyssa Bingham Department of Chemical Engineering University of California, Berkeley Wei Chan Department of Chemical Engineering Massachusetts Institute of Technology Benjamin Ko Department of Chemical Engineering Stanford University Ying Lei Department of Bioengineering Harvard University Sylvie Liong Department of Bioengineering University of Washington Kunal Mehta Department of Bioengineering University of California, Los Angeles Stacey Shiigi Department of Bioengineering University of California, Los Angeles Chris VanLang Department of Chemical Engineering Yale University Jamin Koo Department of Chemical Engineering Korea Advanced Institute of Science and Technology Franklin Lu Department of Chemical Engineering Cornell University Liliana De La Paz Department of Chemical Engineering University of California, Berkeley Justin Huang (Masters) Department of Chemical Engineering University of California, Berkeley Undergraduate students enrolled in Stanford University departments of: Niklaus Evitt Department of Chemical Engineering Tim Schnabel Department of Chemical Engineering Alumni with current affiliation Phillip Smith Bristol-Myers Squibb Isoken Airen Jon Kuchenreuther Postdoctoral researcher, University of California, Berkeley John Welsh Merck William Yang Biogen IDEC Bertrand Lui McKinsey and Company Kedar Patel Amyris Jim Stapleton Postdoc, Rutgers University Brad Bundy Assistant Professor, Brigham Young University Jeanne Bonomo (Postdoc) Codexis Junhao Yang (Postdoc) Sutro Biopharmaceuticals Norman Hovijitra Wilson Sonsini Goodrich & Rosati Aaron Goerke Merck & Co. Jessica Wuu Facet Biotech Corporation Dennis Yancey Coastal Waters Biotechnology Group Sean Kendall (Masters) LS9 Inc Chia-Wei Wang (Postdoc) Amunix Gang Yin (Postdoc) Sutro Biopharmaceuticals Marcus Boyer Merck & Co. Kelly Underwood ZS Associates Alexei Voloshin Theranos Kurt Knapp Algenetix Kara Calhoun Genentech Jennifer Schulte Environ Kim Woodrow Assistant Professor, University of Washington Michael Jewett Assistant Professor, Northwestern University James Zawada Sutro Biopharmaceuticals Nathalie Michel-Reydellet (Postdoc) Dong-Myung Kim (Postdoc) Professor, Chungnam National University, Daejeon, South Korea Personal tools	v0
2024-06-03T18:26:15.484Z	2013-12-06T05:51:46.000Z	2722kaou2yvq62xk526zenh4atqrpd6a	{ "content_type": "text/html", "provenance": "cccc-CC-MAIN-2013-48-0004.json.gz:14239", "uncompressed_offset": 149881713, "url": "quotationsbook.com/quote/15412/", "warc_date": "2014-01-03T03:19:24.000Z", "warc_filename": "<urn:uuid:f32beab7-dcfa-47cc-a4b3-1e1ffbf00474>", "warc_url": "http://quotationsbook.com/quote/15412/" }	cccc_CC-MAIN-2013-48	Added by staff If fifty million people say a foolish thing, it is still a foolish thing. • 5 This quote is about fools-and-foolishness. Search on Google Books to find all references and sources for this quotation. A bit about Russell, Bertrand ... We don't have a biography. These people bookmarked this quote: Hugo amorous, adventurous, advantageous Paddy I'm male, say nothing randomdaydream I'm male, say nothing shaunoffshotgun I'm male, taken natekar Atheist blended with humanism This quote around the web Loading...	v0
2024-06-03T18:26:15.484Z	2013-12-06T05:56:38.000Z	gut7bonzlxo26773vg2m5zbnu3epyim4	{ "content_type": "text/html", "provenance": "cccc-CC-MAIN-2013-48-0004.json.gz:14274", "uncompressed_offset": 201146508, "url": "wikitravel.org/wiki/en/index.php?days=3&target=Veg-friendly_air_travel&title=Special%3ARecentChangesLinked", "warc_date": "2014-01-03T03:19:24.000Z", "warc_filename": "<urn:uuid:f32beab7-dcfa-47cc-a4b3-1e1ffbf00474>", "warc_url": "http://wikitravel.org/wiki/en/index.php?title=Special:RecentChangesLinked&days=3&target=Veg-friendly_air_travel" }	cccc_CC-MAIN-2013-48	Help Wikitravel grow by contributing to an article! Learn how. Changes related to "Veg-friendly air travel" Jump to: navigation, search This is a list of changes made recently to pages linked from a specified page (or to members of a specified category). Pages on your watchlist are bold. Recent changes options Show last 50 \| 100 \| 250 \| 500 changes in last 1 \| 3 \| 7 \| 14 \| 30 days Hide minor edits \| Show bots \| Hide anonymous users \| Hide logged-in users \| Hide my edits Show new changes starting from 06:00, 6 December 2013 Page name: No changes on linked pages during the given period. Personal tools Namespaces Variants Views Actions Navigation Feeds Toolbox In other languages	v0
2024-06-03T18:26:15.484Z	2013-12-06T05:55:48.000Z	frc7yuzrwdqn7h2bbeunrqy26fltffwt	{ "content_type": "text/html", "provenance": "cccc-CC-MAIN-2013-48-0004.json.gz:14276", "uncompressed_offset": 201168208, "url": "wikitravel.org/wiki/en/index.php?oldid=1160256&title=Talk%3ARavello", "warc_date": "2014-01-03T03:19:24.000Z", "warc_filename": "<urn:uuid:f32beab7-dcfa-47cc-a4b3-1e1ffbf00474>", "warc_url": "http://wikitravel.org/wiki/en/index.php?title=Talk:Ravello&oldid=1160256" }	cccc_CC-MAIN-2013-48	Help Wikitravel grow by contributing to an article! Learn how. Talk:Ravello From Wikitravel Revision as of 20:20, 2 June 2009 by KayDiLee (Talk \| contribs) (diff) ← Older revision \| Latest revision (diff) \| Newer revision → (diff) Jump to: navigation, search I've been working on this, and I just reopened the page to find everything had merged from "See" down... does anyone know what might have happened or how to fix it? Thanks! Personal tools Namespaces Variants Actions Navigation Feeds Destination Docents Toolbox In other languages	v0
2024-06-03T18:26:15.484Z	2013-12-06T05:53:50.000Z	pdxi4n6zdjkzttgycgakfubksvnipfwi	{ "content_type": "text/html", "provenance": "cccc-CC-MAIN-2013-48-0004.json.gz:14281", "uncompressed_offset": 210903584, "url": "www.abs.gov.au/AUSSTATS/abs%40.nsf/Lookup/4102.0Main%2BFeatures10Mar%2B2010", "warc_date": "2014-01-03T03:19:24.000Z", "warc_filename": "<urn:uuid:f32beab7-dcfa-47cc-a4b3-1e1ffbf00474>", "warc_url": "http://www.abs.gov.au/AUSSTATS/[email protected]/Lookup/4102.0Main+Features10Mar+2010" }	cccc_CC-MAIN-2013-48	Australian Bureau of Statistics Celebrating the International Year of Statistics 2013 ABS Home > Statistics > By Release Date 4102.0 - Australian Social Trends, Mar 2010 Previous ISSUE Released at 11:30 AM (CANBERRA TIME) 16/03/2010 Page tools: Print Page Print All RSS Search this Product REPEAT IMPRISONMENT This article is also available as a PDF - Download the PDF here Have your say below INTRODUCTION Imprisonment aims to prevent crime and enhance community safety by removing offenders from the public arena and acting as a deterrent to potential offenders, as well as meeting society's need for reparation or retribution for crimes committed. (Endnote 1) However, while a period of imprisonment may deter some people from re-offending, in others it may foster further criminal behaviour. (Endnote 2) Measuring repeat imprisonment is one way of gauging recidivism (repeated or habitual participation in crime). Studying the characteristics of people who have been imprisoned more than once, and understanding trends in criminal career development can provide valuable evidence for designing crime prevention strategies. At 30 June 2009, there were 29,300 prisoners in Australia. This is equivalent to an imprisonment rate of 175 prisoners per 100,000 adults in Australia. Since 1989, the imprisonment rate has increased by around two-thirds. IMPRISONMENT RATE (a) Prisoners per 100,000 people aged 18 years and over. From 1989 to 1993 rate is for people aged 17 years and over. Source: Australian Prisoners: results of the National Prison Census, 30 June, Australian Institute of Criminology; Prisoners in Australia, 2004 and 2009 (ABS cat. no. 4517.0) DATA SOURCE AND DEFINITIONS This article is based on a forthcoming research paper An Analysis of Repeat Imprisonment Trends in Australia using Prisoner Census Data from 1994 to 2007. The analysis is based on a longitudinal dataset built from the annual National Prisoner Census collected by the ABS. The analytical model used is explained later in this article (see the box: Analysis of the repeat imprisonment dataset). The Prisoner Census provides a snapshot of the adult prisoner population at 30 June each year, and is collected from administrative data sources maintained by corrective services agencies in each state and territory. Within each state or territory, every prisoner is assigned a unique prisoner identification number. This number allows the presence or absence of individual prisoners to be followed over time at each Prisoner Census, and enabled the construction of a 14 year (1994-2007) longitudinal dataset. This dataset is used to identify prisoners with multiple imprisonment episodes. Prisoner refers to a person held in custody. The imprisoned population includes remandees, some of whom may be found not guilty by the court. In all states and territories people remanded or sentenced to adult custody are aged 18 years and over, except Queensland where 'adult' refers to people aged 17 years and over. Release refers to a proxy measure derived from the absence of a prisoner's record in a subsequent Prisoner Census. Information on the release of prisoners is not collected by the census, so people's 'disappearance' from the Prisoner Census is used as a proxy of their release from prison, and their 'reappearance' as a proxy of their reimprisonment. The interval between the year of release and the subsequent reimprisonment is approximated by the number of years between the release year and the first census year of the reimprisonment. The Prisoner Census does not capture all prison episodes, that is it does not capture the entire inflow and outflow of prisoners during the year. Short prison episodes can be missed if they do not span 30 June, which may result in both an underestimate of the number of prisoners serving multiple spells of imprisonment and an underestimate of the number of prison spells for prisoners identified as serving multiple terms. It is also not possible to link prison episodes that occurred in different states and territories. HOW COMMON IS REIMPRISONMENT? Over half (56%) of the people in prison in 2009 had been imprisoned before. However, this does not necessarily indicate the rate of reimprisonment, as it does not account for the people who are released from prison, but not reimprisoned. It is also influenced by the number of first time prisoners entering the system, and the length of sentences. A more valid measure of reimprisonment can be made by following over time a group of people who have been released from prison, and taking the proportion of that group who re-enter the prison system at a later date. Over the four years from 1994 to 1997, 28,600 prisoners were released from Australian prisons (the 1994-1997 release cohort). The analysis in this article is based on this group of people. Within 10 years of their release, two in five people in the 1994-1997 release cohort had been reimprisoned. The rate of reimprisonment increased relatively rapidly in the early years following release, then levelled out over time. WHO GETS REIMPRISONED? As the characteristics associated with reimprisonment are often aligned with other characteristics, a regression model was used to isolate the most important factors (see the box: Analysis of the repeat imprisonment dataset). Results of the modelling showed that reimprisonment was strongly associated with already being a recidivist prisoner, as opposed to being in prison for the first time. Also strongly associated with reimprisonment were the characteristics of being young, of Aboriginal or Torres Strait Islander descent, or, to a lesser extent, being male. During the 10 years after being released, men were more likely than women to return to prison. Although this gap was quite small at the beginning it increased with the passage of time. By the tenth year, 40% of released men had been reimprisoned at least once, compared with 31% of released women. PRISONERS RELEASED IN 1994-1997, CUMULATIVE REIMPRISONMENT RATE, BY TIME TO FIRST REIMPRISONMENT Source: ABS data available on request Younger prisoners were more likely than older prisoners to be reimprisoned following release. Within 10 years of being released, the reimprisonment rate for the teenager group (those aged 17-19 years when released) was 61%, compared with 23% for those aged 35 years and over. PRISONERS RELEASED IN 1994-1997, CUMULATIVE REIMPRISONMENT RATE, BY AGE AT RELEASE AND TIME TO FIRST REIMPRISONMENT Source: ABS data available on request The reimprisonment rate of Aboriginal and Torres Strait Islander people within 10 years of release was around 1.7 times that of non-Indigenous people. PRISONERS RELEASED IN 1994-1997, CUMULATIVE REIMPRISONMENT RATE, BY INDIGENOUS STATUS AND TIME TO FIRST REIMPRISONMENT Source: ABS data available on request PRISONERS RELEASED IN 1994-1997, SELECTED CHARACTERISTICS OF OFFENDERS Reimprisonment rate within 10 years of release Selected characteristic % Men 39.7 Women 31.3 Age at release 17-19 years 60.7 20-24 years 49.3 25-29 years 44.4 30-34 years 37.0 35 years + 22.6 Indigenous 57.9 Non-Indigenous 35.0 Has prior imprisonment 49.9 No prior imprisonment 25.1 Australia 39.2 Source: ABS data available on request ANALYSIS OF THE REPEAT IMPRISONMENT DATASET The 1994-1997 release cohort is the group of prisoners who were released at least once between 1 July 1994 and 30 June 1997. In the release cohort and the total prisoner population, around nine in ten prisoners were male, and about one-fifth were Indigenous. Among first-time prisoners, the median age when imprisoned was 28 years. A small proportion (less than 10%) of prisoners were aged 17-19 years when released from prison, while around one-third were aged 35 years and over. Around 40% of the prisoners were in New South Wales prisons. Logistic regression is a type of multivariate analysis. This technique is used to show the effect that each individual factor has on the likelihood of a person being reimprisoned, when all other factors are held constant. For example, characteristics like state or territory of imprisonment and age may be associated with each other so that the association between jurisdiction and reimprisonment is a reflection of the age profiles of different states and territories, rather than a result of that jurisdiction itself. The multivariate analysis disentangles the effects of the following characteristics: sex; age at release; Indigenous status; prior imprisonment; state and territory of imprisonment; previous offence; and the length of the previous prison episode. This statistical technique is applied to the 1994-1997 group 10 years after release. States and territories Within 10 years of their release, 48% of prisoners in the Northern Territory had been reimprisoned, compared with the national average of 39%. However, this high reimprisonment rate reflects the demographic characteristics of its prisoner population (such as Indigenous status and age) which are associated with high rates of reimprisonment. After adjusting for these and other factors using logistic regression, Northern Territory prisoners showed an average level of reimprisonment propensity (that is, it was not significantly different from the average across all jurisdictions). PRISONERS RELEASED IN 1994-1997, STATES AND TERRITORIES Reimprisonment rate within 10 years of release State or Territory % NSW/ACT 39.3 Vic. 37.8 Qld 42.1 SA 35.5 WA 38.3 Tas. 32.8 NT 48.2 Australia 39.2 Source: ABS data available on request CRIMINAL CAREER DEVELOPMENT Developing an understanding of the frequency of offending, and the types of crimes committed by chronic offenders, may assist in crime prevention. In the Prisoner Census, information is collected on only the most serious offence of sentenced prisoners, and the most serious charge for unsentenced prisoners. Analysis of criminal career development is based on the most serious offence/charge, referred to as the 'offence'. People in the 1994-1997 release cohort were most likely to have been in prison for assault and acts intended to cause injury, and burglary. Illicit drug offences and theft were also common offence types for which prisoners were originally imprisoned. PRISONERS RELEASED IN 1994-1997, distribution of previous offence type(a) Proportion Previous offence(a) % Homicide 3.1 Assault(b) 15.9 Sexual assault 8.8 Robbery 9.3 Burglary 14.9 Theft 11.1 Deception 5.7 Illicit drug offences 10.7 Weapons offences 0.3 Property damage 1.7 Public order offences 0.6 Road traffic offences 8.6 Offences against justice 8.2 Miscellaneous 1.0 Total prisoners 100.0 no. Total prisoners 28,600 (a) Previous offence refers to the offence related to the episode of imprisonment from which the prisoner was released during 1994-1997. (b) Includes acts intended to cause injury. Source: ABS data available on request How frequently were people reimprisoned? Almost one-fifth (19%) of the 1994-1997 release cohort had been reimprisoned only once by June 30, 2007. One in ten were reimprisoned twice, 6% were reimprisoned three times, and a further 6% were reimprisoned four or more times. Reimprisonment by offence type The following analysis looks at patterns of specialisation in offence types and movements from one type of offence to another using descriptive methods. The reimprisonment rate varied according to the offence type for which the prisoner was originally imprisoned. Members of the 1994-1997 release cohort who had been in prison for burglary or theft had the highest reimprisonment rates (58% and 53% respectively). At the other end of the spectrum, people whose previous offence was illicit drugs or sexual assault and related offences had the lowest reimprisonment rates (24% and 21% respectively). PRISONERS RELEASED IN 1994-1997, REIMPRISONMENT RATES BY 30 JUNE 2007, BY PREVIOUS OFFENCE TYPE(a) (a) Previous offence refers to the offence related to the episode of imprisonment from which the prisoner was released during 1994-1997. (b) Includes acts intended to cause injury. Source: ABS data available on request Specialisation Offence specialisation was measured by taking the proportion of repeat prisoners whose reimprisonment was for the same offence as that for which they were originally imprisoned. Burglary had the highest rate of specialisation. Just over half (54%) of those previously imprisoned for burglary were reimprisoned for this same offence by June 30, 2007. Other offence types with a high degree of specialisation (around 50%) included acts intended to cause injury, road traffic offences, illicit drugs and sexual assault and related offences. SPECIALISATION(a) BY PREVIOUS OFFENCE TYPE(b), PRISONERS RELEASED IN 1994-1997 WHO WERE REIMPRISONED BY 30 JUNE 2007(c) (a) The ratio of reimprisonment for the same offence to total reimprisonment. (b) Previous offence refers to the offence related to the episode of imprisonment from which the prisoner was released during 1994-1997. (c) Data for weapons offences and public order offences are not published due to small numbers involved in the calculation. (d) Includes acts intended to cause injury. Source: ABS data available on request Offence type changes by repeat offenders The probability of reimprisonment chart shows previous offence types along the vertical axis and subsequent offence types along the horizontal axis. The size of the circles are proportional to the probability that a person previously imprisoned for an offence was, at some later date, reimprisoned for the same or a different type of offence. In other words, the pattern along the diagonal indicates the probability of repeat imprisonment for the same offence, while vertical patterns in the matrix indicate progression into particular offence types. There was a relatively high probability that people previously imprisoned for acts intended to cause injury, robbery, burglary or theft would later be reimprisoned for those same offences. In addition, these offences also attracted a high proportion of prisoners who were previously imprisoned for other offences. Many offenders also tend to be reimprisoned for offences against justice at some stage. This can be reasonably assumed as attributable to breaches of justice orders. For example, prisoners may be paroled, seriously breach the parole conditions, and then are returned to prison. Unless offenders started their criminal careers with sexual assault and related offences, deception, or illicit drug offences, they did not tend to commit this sort of crime later. PRISONERS RELEASED IN 1994-1997, PROBABILITY OF BEING REIMPRISONED FOR A CERTAIN OFFENCE TYPE BY 30 JUNE 2007, BY PREVIOUS OFFENCE TYPE 1 Homicides 2 Acts intended to cause injury 3 Sexual assault and related offences 4 Dangerous or negligent acts 5 Abduction 6 Robbery 7 Burglary 8 Theft 9 Deception 10 Illicit drug 11 Weapon offences 12 Property damage 13 Public order 14 Traffic offences 15 Offences against justice 16 Misc. Source: ABS data available on request ENDNOTES 1. Roche, D., 1999, 'Mandatory Sentencing' in Trends & issues in crime and criminal justice Paper No. 138, Australian Institute of Criminology, <www.aic.gov.au>.2. Rawnsley, T., 2003, 'Working Paper No. 2003/02: Dynamics in Repeat Imprisonment: Utilising Prison Census data', cat. no. 1351.0, ABS, Canberra, <www.abs.gov.au>. HAVE YOUR SAY Please direct all statistical enquiries to the National Information and Referral Services (NIRS) by emailing [email protected] Articles in Australian Social Trends are designed to provide an overview of a current social issue. We aim to present an interesting and easy-to-read story, balanced with appropriate statistics. The articles are written as a starting point or summary of the issues, for a wide audience including policy makers, researchers, journalists and people who just want to have a better understanding of a topic. For people who need further information, we provide references to other useful and more detailed sources. Tell us if we are achieving this aim by emailing [email protected] © Commonwealth of Australia 2013 Unless otherwise noted, content on this website is licensed under a Creative Commons Attribution 2.5 Australia Licence together with any terms, conditions and exclusions as set out in the website Copyright notice. For permission to do anything beyond the scope of this licence and copyright terms contact us.	v0
2024-06-03T18:26:15.484Z	2013-12-06T05:42:15.000Z	b3kgdvtzgcpnl6qctbjnsfdxd32xmyy4	{ "content_type": "text/html", "provenance": "cccc-CC-MAIN-2013-48-0004.json.gz:14283", "uncompressed_offset": 210938420, "url": "www.abs.gov.au/AUSSTATS/abs%40.nsf/Previousproducts/8731.0Main%20Features9999Mar%202009?issue=Mar+2009&prodno=8731.0&tabname=Summary", "warc_date": "2014-01-03T03:19:24.000Z", "warc_filename": "<urn:uuid:f32beab7-dcfa-47cc-a4b3-1e1ffbf00474>", "warc_url": "http://www.abs.gov.au/AUSSTATS/[email protected]/Previousproducts/8731.0Main%20Features9999Mar%202009?opendocument&tabname=Summary&prodno=8731.0&issue=Mar%202009&num=&view=" }	cccc_CC-MAIN-2013-48	Australian Bureau of Statistics Celebrating the International Year of Statistics 2013 ABS Home > Statistics > By Release Date 8731.0 - Building Approvals, Australia, Mar 2009 Quality Declaration Previous ISSUE Released at 11:30 AM (CANBERRA TIME) 05/05/2009 Page tools: Print Page Print All RSS Search this Product Provides the number and value of dwelling units approved by sector (public/private) and by state, number and value of new other residential dwelling units approved by type of building, and the number and value of non-residential building jobs approved by type of building (i.e. by function such as 'retail and wholesale trade', 'offices') and value ranges. State data includes the number of private sector houses approved; number and value of new other residential dwellings by type of building such as flats, units or apartments in a building of one or two storeys; number and value of non-residential building jobs by type of building and sector; and for Capital City Statistical Divisions, the total number of dwelling units approved broken down by Houses, Other Dwellings and Total Dwelling Units. Seasonally adjusted and trend estimates by state are included for the number of dwelling units and value of building approved. The quarterly value of building approved is shown in chain volume measure terms. © Commonwealth of Australia 2013 Unless otherwise noted, content on this website is licensed under a Creative Commons Attribution 2.5 Australia Licence together with any terms, conditions and exclusions as set out in the website Copyright notice. For permission to do anything beyond the scope of this licence and copyright terms contact us.	v0
2024-06-03T18:26:15.484Z	2013-12-06T05:51:40.000Z	zdvumvddpmb7gedzwkktxcz6rob4jqs7	{ "content_type": "text/html", "provenance": "cccc-CC-MAIN-2013-48-0004.json.gz:14284", "uncompressed_offset": 210945685, "url": "www.abs.gov.au/AUSSTATS/abs%40.nsf/ProductsbyReleaseDate/9A5AF32598CC6615CA2570AB00835B29", "warc_date": "2014-01-03T03:19:24.000Z", "warc_filename": "<urn:uuid:f32beab7-dcfa-47cc-a4b3-1e1ffbf00474>", "warc_url": "http://www.abs.gov.au/AUSSTATS/[email protected]/ProductsbyReleaseDate/9A5AF32598CC6615CA2570AB00835B29?OpenDocument" }	cccc_CC-MAIN-2013-48	Australian Bureau of Statistics Celebrating the International Year of Statistics 2013 ABS Home > Statistics > By Release Date 6291.0.40.001 - Labour Force, Selected Summary Tables, Australia, Sep 2000 Previous ISSUE Released at 11:30 AM (CANBERRA TIME) 19/10/2000 Page tools: Print Page Print All RSS Search this Product • About this Release ABOUT THIS RELEASE Contains selected final labour force tables -- labour force status for regions; duration of unemployment for Australia, States and Territories (every month); and industry of employment for Australia (in February, May, August and November). © Commonwealth of Australia 2013 Unless otherwise noted, content on this website is licensed under a Creative Commons Attribution 2.5 Australia Licence together with any terms, conditions and exclusions as set out in the website Copyright notice. For permission to do anything beyond the scope of this licence and copyright terms contact us.	v0
2024-06-03T18:26:15.484Z	2013-12-06T05:43:49.000Z	rzs2pogynf325ceati7br7gl7tkvqbib	{ "content_type": "text/html", "provenance": "cccc-CC-MAIN-2013-48-0004.json.gz:14285", "uncompressed_offset": 210979117, "url": "www.abs.gov.au/AUSSTATS/abs%40.nsf/second%2Blevel%2Bview?issue=Dec+2012&prodno=3401.0&prodno=3401.0&tabname=Past+Future+Issues&viewtitle=Overseas+Arrivals+and+Departures%2C+Australia~Dec+2012~Latest~06%2F02%2F2013", "warc_date": "2014-01-03T03:19:24.000Z", "warc_filename": "<urn:uuid:f32beab7-dcfa-47cc-a4b3-1e1ffbf00474>", "warc_url": "http://www.abs.gov.au/AUSSTATS/[email protected]/second+level+view?ReadForm&prodno=3401.0&viewtitle=Overseas%20Arrivals%20and%20Departures,%20Australia~Dec%202012~Latest~06/02/2013&tabname=Past%20Future%20Issues&prodno=3401.0&issue=Dec%202012&num=&view=" }	cccc_CC-MAIN-2013-48	Australian Bureau of Statistics Celebrating the International Year of Statistics 2013 ABS Home > Statistics > By Catalogue Number 3401.0 - Overseas Arrivals and Departures, Australia, Dec 2012 Quality Declaration Latest ISSUE Released at 11:30 AM (CANBERRA TIME) 02/06/2013 Future Releases • Next Issue: Nov 2013 expected for release on 13/01/2014 Past Releases © Commonwealth of Australia 2013 Unless otherwise noted, content on this website is licensed under a Creative Commons Attribution 2.5 Australia Licence together with any terms, conditions and exclusions as set out in the website Copyright notice. For permission to do anything beyond the scope of this licence and copyright terms contact us.	v0
2024-06-03T18:26:15.484Z	2013-12-06T05:54:05.000Z	qlak46fc55dk2m6zymredao47xmpk5kf	{ "content_type": "text/html", "provenance": "cccc-CC-MAIN-2013-48-0004.json.gz:14300", "uncompressed_offset": 348237437, "url": "www.ga.gov.au/minerals/mineral-resources/rare-earth-elements.html", "warc_date": "2014-01-03T03:19:24.000Z", "warc_filename": "<urn:uuid:f32beab7-dcfa-47cc-a4b3-1e1ffbf00474>", "warc_url": "http://www.ga.gov.au/minerals/mineral-resources/rare-earth-elements.html" }	cccc_CC-MAIN-2013-48	Rare Earth Elements The largest Rare Earth Elements (REE) deposit in the world is the Bayan Obo deposit in China, which has resources totalling at least 48 million tonnes of rare earth oxides (REO) out of a world total of 95.27 million tonnes. Australia’s share of the world’s economic resources of REO is modest at 1.65 million tonnes. Until 1995, Australia was a major producer of REO from monazite, a by-product of heavy mineral sand mining for ilmenite, rutile and zircon. There is no current production of rare earths in Australia, but with one REO project under construction in Western Australia and feasibility studies underway in the Northern Territory and New South Wales, Australia could become a producer once again. Rare Earth Properties and Uses Rare earth properties and uses table © Geoscience Australia Rare earths are a group of 15 elements with atomic numbers ranging from 57 to 71. In order of their respective atomic numbers the elements are lanthanum, cerium, praseodymium, neodymium, promethium, samarium, europium, gadolinium, terbium, dysprosium, holmium, erbium, thulium, ytterbium and lutetium. Two other elements, scandium and yttrium, are commonly classed as rare earths because of their natural association with rare earths. The rare earths are a relatively abundant group of elements which range in crustal abundance from cerium at 60 parts per million (ppm) to lutetium at 0.5 ppm. The most significant increases in demand for REO is attributed to a predicted expansion in hybrid cars, followed by petroleum catalyst, glass manufacturing and polishing and multi-level electronic components. The smallest sector by volume, but largest by value, is europium and terbium, which are used in the production of phosphors for televisions and energy efficient light globes. Rare Earth Production and Exports Although there is no current production of rare earths in Australia, mining begun in 2007 at the Mount Weld deposit in Western Australia, which led to around 98,000 cubic metres of ore being stockpiled awaiting the completion of a concentration plant at the mine site. The concentrates will be exported to an advanced materials plant being built in Malaysia. In other projects, the Nolans Bore rare earth-phosphate-uranium-thorium deposit in the Northern Territory and the Dubbo Zirconia Project Toongi zirconium-hafnium-niobium-tantalum-REO deposit in New South Wales are each undergoing a feasibility study. Globally, the production and resources of rare earths is dominated by China, which accounts for about 97 per cent of the production followed by India with about two per cent. These figures are only approximate because the production for the Commonwealth of Independent States, which is made up of former members of the Soviet Union, is not available. REO Resources and World Ranking China holds 36 million tonne or 37.8 per cent of the world’s economic resourses for REO, followed by the Commonwealth of Independent States with 19 million tonne or almost 20 per cent and the USA with 13 million tonnes or 13.7 per cent. Australia accounts for 1.73 per cent of world Economic Demonstrated Resources (EDR) at 1.65 million tonne. The only production of REO from a carbonatite has been from the Mountain Pass deposit in California, which has total resources of 1.8 million tonne REO at an average grade of about 9 per cent REO. Exploration and Discovery Small-scale production of rare earths began in Australia at Byron Bay in New South Wales in the 1950s with a small quantity of monazite being processed to produce cerium oxide for glass polishing. In 1969, cerium, lanthanum, yttrium and thorium compounds were produced at Port Pirie in South Australia from locally produced monazite. However, the plant ceased operations in 1972. Historically, Australia has exported large quantities of monazite from heavy mineral sands mined for the extraction of both rare earths and thorium in Western Australia, New South Wales and Queensland resulting in the export of 265 kilotonne between 1952 and 1995. During the past decade there has been strong growth in demand for rare earths as a result of emerging technology applications in catalysts, glass, polishing, metal alloys and magnets, which accounts for about 80 per cent of the current total annual demand of around 124,000 tonne of REO. Highlights of mineral exploration, including rare earth oxides, are reviewed annually in Australian Mineral Exploration Review and Australia’s Identified Mineral Resources. Geoscience Australia Programs The rare earth deposits associated with thorium are described in A Review of the Geochemical Processes Controlling the Distribution of Thorium in the Earth's Crust and Australia's Thorium Resources. Geoscience Australia Record 2008/5. Topic contact: [email protected] Last updated: October 4, 2013	v0
2024-06-03T18:26:15.484Z	2013-12-06T06:03:29.000Z	hq6vdl7477wmw3qpmvgyguzafhis3oye	{ "content_type": "text/html", "provenance": "cccc-CC-MAIN-2013-48-0004.json.gz:14303", "uncompressed_offset": 358513701, "url": "www.go4expert.com/forums/cloud-computing-t26982/", "warc_date": "2014-01-03T03:19:24.000Z", "warc_filename": "<urn:uuid:f32beab7-dcfa-47cc-a4b3-1e1ffbf00474>", "warc_url": "http://www.go4expert.com/forums/cloud-computing-t26982/" }	cccc_CC-MAIN-2013-48	what is cloud computing?? Banned what is cloud computing? Go4Expert Founder See http://lmgtfy.com/?q=what+is+cloud+computing Banned it is a service which is sold on demand, its not like an traditional hosting, this service give freedom to the Companies to used the different server of hosting companies. this reduces the hardware up-gradation cost of the company and give them the freedom to access data form any where, any time if they have internet access. Last edited by icecube_media; 20Oct2011 at 16:42..	v0
2024-06-03T18:26:15.484Z	2013-12-06T05:58:17.000Z	i6oiqjsecxgcujcvu6u76mwmunrwnqob	{ "content_type": "text/html", "provenance": "cccc-CC-MAIN-2013-48-0004.json.gz:14304", "uncompressed_offset": 364318682, "url": "www.grandtheftwiki.com/index.php?oldid=184641&title=Michael_Graves", "warc_date": "2014-01-03T03:19:24.000Z", "warc_filename": "<urn:uuid:f32beab7-dcfa-47cc-a4b3-1e1ffbf00474>", "warc_url": "http://www.grandtheftwiki.com/index.php?title=Michael_Graves&oldid=184641" }	cccc_CC-MAIN-2013-48	Michael Graves From Grand Theft Wiki Revision as of 13:55, 25 May 2009 by JustPhil (Talk) (diff) ← Older revision \| Latest revision (diff) \| Newer revision → (diff) Jump to: navigation, search Michael Graves is a candidate for governor of Liberty in Grand Theft Auto IV. His opponent is John Hunter.	v0
2024-06-03T18:26:15.484Z	2013-12-06T05:38:49.000Z	ormunllxmxxx2nd624ouvyco36n3ozec	{ "content_type": "text/html", "provenance": "cccc-CC-MAIN-2013-48-0004.json.gz:14314", "uncompressed_offset": 434557342, "url": "www.mdpi.com/1424-8247/5/3/279", "warc_date": "2014-01-03T03:19:24.000Z", "warc_filename": "<urn:uuid:f32beab7-dcfa-47cc-a4b3-1e1ffbf00474>", "warc_url": "http://www.mdpi.com/1424-8247/5/3/279" }	cccc_CC-MAIN-2013-48	Pharmaceuticals 2012, 5(3), 279-296; doi:10.3390/ph5030279 Article Effect of Co-Administration of Rivaroxaban and Clopidogrel on Bleeding Time, Pharmacodynamics and Pharmacokinetics: A Phase I Study Clinical Pharmacology, Bayer Pharma AG, D-42096 Wuppertal, Germany * Author to whom correspondence should be addressed. Received: 20 December 2011; in revised form: 18 January 2012 / Accepted: 20 February 2012 / Published: 24 February 2012 (This article belongs to the Special Issue Anticoagulants) Download PDF Full-Text [823 KB, uploaded 24 February 2012 10:00 CET] Abstract: Dual antiplatelet therapy with acetylsalicylic acid and a thienopyridine, such as clopidogrel, is effective for the secondary prevention of cardiovascular events in patients with acute coronary syndrome, but there is still a substantial residual risk of recurrence. Although anticoagulant therapy with a vitamin K antagonist (e.g. warfarin) in conjunction with antiplatelet therapy has been shown to reduce the risk of cardiovascular events, the rates of bleeding were increased with these combination therapies; hence, triple therapy with warfarin is currently only recommended in patients at low risk of bleeding. In addition, there are other limitations associated with vitamin K antagonist therapy, including the need for routine coagulation monitoring and dose adjustment to maintain the treatment within the therapeutic range. Rivaroxaban is an oral, direct Factor Xa inhibitor; in clinical practice, it is likely that rivaroxaban will be given to patients who also receive antiplatelet therapy, such as clopidogrel. This randomized, non-blinded, three-way crossover study investigated the effect of rivaroxaban on bleeding time when coadministered with clopidogrel. In addition, the influence of clopidogrel on the safety, tolerability, pharmacodynamics and pharmacokinetics of rivaroxaban was investigated. Of 27 healthy male subjects who received a single 300 mg dose of clopidogrel, 14 were identified as clopidogrel responders and were then randomized to the following three treatments: (A) two doses of clopidogrel on two consecutive days (300 mg on day 1; 75 mg on day 2); (B) one dose of rivaroxaban (15 mg); or (C) a combination of treatments A and B (rivaroxaban given on day 2). All treatments were well tolerated. Bleeding time with coadministration of rivaroxaban and clopidogrel was significantly prolonged in four subjects, compared with either drug alone: combination treatment increased the overall least squares-means to 3.77 times baseline (90% confidence interval [CI] 2.82–4.73), compared with 1.13 times baseline (90% CI 0.17–2.09) with rivaroxaban and 1.96 times baseline (90% CI 0.10–2.91) with clopidogrel. Co-administration of clopidogrel had no significant effect on the pharmacokinetics of rivaroxaban and, when compared with rivaroxaban alone, had no further effects on Factor Xa activity or prothrombin time. Inhibition of ADP-stimulated platelet aggregation by clopidogrel was not affected by rivaroxaban. As expected, owing to the mode of action of each study drug, the results of this study demonstrated that coadministration of the Factor Xa inhibitor rivaroxaban and the antiplatelet clopidogrel increased the bleeding time in healthy subjects without affecting other pharmacokinetic or pharmacodynamic parameters of each drug. Keywords: bleeding time; clopidogrel; pharmacodynamics; pharmacokinetics; rivaroxaban Article Statistics Click here to load and display the download statistics. Cite This Article MDPI and ACS Style Kubitza, D.; Becka, M.; Mück, W.; Schwers, S. Effect of Co-Administration of Rivaroxaban and Clopidogrel on Bleeding Time, Pharmacodynamics and Pharmacokinetics: A Phase I Study. Pharmaceuticals 2012, 5, 279-296. AMA Style Kubitza D, Becka M, Mück W, Schwers S. Effect of Co-Administration of Rivaroxaban and Clopidogrel on Bleeding Time, Pharmacodynamics and Pharmacokinetics: A Phase I Study. Pharmaceuticals. 2012; 5(3):279-296. Chicago/Turabian Style Kubitza, Dagmar; Becka, Michael; Mück, Wolfgang; Schwers, Stephan. 2012. "Effect of Co-Administration of Rivaroxaban and Clopidogrel on Bleeding Time, Pharmacodynamics and Pharmacokinetics: A Phase I Study." Pharmaceuticals 5, no. 3: 279-296. Pharmaceuticals EISSN 1424-8247 Published by MDPI AG, Basel, Switzerland RSS E-Mail Table of Contents Alert	v0
2024-06-03T18:26:15.484Z	2013-12-06T05:39:35.000Z	xathe3yksjsrmtfzlcny2tvflrndbpib	{ "content_type": "text/html", "provenance": "cccc-CC-MAIN-2013-48-0004.json.gz:14325", "uncompressed_offset": 477707570, "url": "www.openwetware.org/index.php?oldid=670303&title=Payne_Lab%3ANews", "warc_date": "2014-01-03T03:19:24.000Z", "warc_filename": "<urn:uuid:f32beab7-dcfa-47cc-a4b3-1e1ffbf00474>", "warc_url": "http://www.openwetware.org/index.php?title=Payne_Lab:News&oldid=670303" }	cccc_CC-MAIN-2013-48	Payne Lab:News From OpenWetWare Revision as of 17:32, 24 January 2013 by Emilie Warren (Talk \| contribs) Jump to: navigation, search Research People Publications Funding News Seminars Positions Available Outreach Contact Contents 2013 February --Deb, Candace and Saheli will be traveling up to Philadelphia for the 57th annual meeting of the Biophysical Society Meeting from February 2nd - 6th. Saheli will be presenting her poster Downregulation of NRF2 in HeLa Cells by Self-Conditioned Media [board number 39] in the Protein Dynamics II Poster Session there, held on February 4th at 1:45 pm. January --We took Molly out to lunch on her last day in the lab and wished her well as she starts her first semester in the Nursing program at Georgia State University. Goodbye, Molly! 2012 November --We celebrated Joesph's graduation and wished him well as he begins his first "real" job at Medical Neurogenetics. Goodbye, Joseph! --Candace was awarded the Women in Chemistry travel award for the Biophysical Society's Annual Meeting in Philadelphia next February. Congratulations! October --To celebrate National Chemistry Week, Christine was interviewed by Meg A. Mole (no relation to Whac A. Mole) for the ACS kids newsletter. --Christine was part of a multidisciplinary panel on science, ethics, and medicine. The panel, HeLa @ Tech: Faculty Panel on Science, Ethics, and Medicine, explored a variety of topics related to the ethical responsibilities of researchers. September --Congratulations to Candace who was named a Molecular Biophysics senior trainee for 2012-2013! August --The Payne Lab competed in the Brown-Curtis-Payne Potluck Olympics. Deb and Deepali took the gold in the 'Best Substitution' and 'Best Overall' categories! --Learn about Georgia Tech's BioEngineering Graduate Program! --We celebrated Jairo's graduation and wished him well as he leaves the lab and moves to Austin. Goodbye, Jairo! --Quachel gave her final NNIN talk at Georgia Tech. Her official talk will be webcast from Washington D.C. Her talk is Tuesday Minnesota Session 1 (8:35 AM). --Welcome to Molly Flanagan, our new Lab Technician! --Midtown Book Club visits the lab as part of their discussion of "The Immortal Life of Henrietta Lacks." To see more, check out our outreach page! June --Welcome to Ryan Lannan and Quachel Bazile, our new REU students! May --Rachel Candace Law will be doing summer research in the Payne and Potter (Biomedical Engineering) labs as a LINCR Fellow. Congratulations to Candace on her acceptance into the LINCR program! February --Candace and Jairo will be presenting posters at the Biophysical Society Annual Meeting in San Diego, Feb. 25-29. Candace's poster: "Cellular Binding and Transport of Protein-Nanoparticle Complexes"; Sunday, Feb. 26; Poster # B775, Hall FGH Jairo's poster: "Intracellular Dynamics of Lysosomes following the destruction of LAMP"; Sunday, Feb. 26; Poster #B843, Hall FGH --Candace has advanced to candidacy! --Steve will be part of a discussion panel on Nanomedicine on February 28th at the Georgia Institute of Technology Library. Link to Video January --Two new undergrads have joined the Payne Lab. Welcome to Patrick and Kelsey! 2011 December --Jairo graduates! --Umesh Kumar has joined the Payne Lab as a postdoc. Welcome Umesh! October --After successfully defending his thesis, Chip Humphries becomes Dr. Chip Humphries. --Eddy Shin, a biochemistry graduate of the University of Georgia, joined the lab as our first Lab Technician. Welcome Eddy! August --Joseph Kim, a GT undergraduate biochemistry major joined the Payne Lab. Welcome Joseph! --Christine's DARPA award and the Payne Lab are featured in a GT Sciences Video. --Steve Hira has joined the Payne Lab as a postdoc. Welcome Steve! --The Payne Lab's research on single particle tracking of vesicles is featured in the Emerging Investigator issue of the Analyst. -- The Payne lab will be attending and presenting at the ACS National Meeting in Denver, Colorado from August 28th - September 1st. - Christine will be presenting "Overview of the Advances in Microscopy Symposium for Undergrads" on Sunday (time TBD). She will also present "Imaging chemical reactions inside living cells: Two-color single particle tracking of the enzymatic degradation of low-density lipoprotein (LDL)" (Paper ID 10953) on Monday, August 29th in the session beginning at 8:20 am (Colorado Convention Center, Room 1B, Talk time: 11:40-12:10pm). - Ger will be giving a talk on Tuesday, August 30th in the 8:20 am session (Convention Center, Room 4B, Talk time: 9:40-10:00 am); "Cellular binding and internalization of nanoparticles in the presence of serum proteins." - Candace will be presenting her poster, "Imaging cellular internalization of nanoparticles with serum proteins using two-color fluorescence microscopy," on Monday, August 29th from 12-1 pm (Convention Center, Rooms 406/407) and on Wednesday, August 31st from 6-9 pm (Convention Center, Hall D, Poster #12038). - Khalilah Reddie, our colaborator from the Murthy lab at Georgia Tech, will also be presenting her poster on Monday, August 29th from 12-1pm, "Aromatic Thiols: A New Family of Probes for Reversible Ratiometric Imaging of Thiols and Disulfides in Living Cells" (Convention Center, Rooms 406/407). -Congratulations to Candace on her GAANN Fellowship for 2011-2012! -Syeda presented her research at the REU poster session July -Christine received a DARPA Young Faculty Award. -Congratulations to Hursh on his President's Undergraduate Research Award (PURA) for Fall 2011! June -Congratulations to Chip who now has a "real job" at B&B Microscopes in Pittsburgh! -Joseph Bell, a physics major at Morehouse College, will be doing research in the Payne Lab this summer. Welcome Joseph! May -Syeda Anum, a biochemistry major from Northeastern University, has joined the Payne Lab as an NSF-REU student. Welcome Syeda! April -Saheli Sarkar joined the Payne and Kemp Labs! March -The Payne Lab will attend the Biophysical Society Annual Meeting in Baltimore, MD March 5-9, 2011. Following are details for our presentations. Ger's poster, #1719, will be presented as part of the Imaging and Optical Microscopy II poster session March 7th at 1:45 in position B629. It is titled "Cellular Binding of Nanoparticles in the Presence of Serum Proteins". Craig will present "Dynamic Behavior of Intracellular Vesicles Probed with Two-Color Single Particle Tracking" as part of the Intracellular Cargo Transport poster session on March 9th at 10:30. His poster, #3251, can be found at board B356. Chip's poster, "Investigation of Lysosomes as Enzyme Storage Vesicles using Single Particle Tracking Fluorescence Microscopy", will be presented as part of the Imaging and Optical Microscopy III poster session on March 9th at 10:30. His poster, #3339, will be on board B444. He will also be presenting as part of the Student Research Achievement Award Poster Competition on Sunday night at 6pm, board #S164. February -Jairo passed his Naturalization Examination to become an American citizen! Jairo downs his very American burger. January -Two new undergraduates, Jessica and Hursh, join the Payne Lab. -Christine was featured as an "Emerging Investigator" in Chemical Communications. 2010 December -The annual Payne-Brown-Curtis Lab Christmas Party was a great success. Candace opens a grab bag gift. November -Chip presented a poster at the Second Academia/Industry Forum at Kennesaw State University. This was sponsored by the Georgia Section of the American Chemical Society and Kennesaw State University. August -Congratulations to Candace on being named a Molecular Biophysics trainee! July -Candace joins the Payne Lab. April -Congrats to Jairo and Heather on winning PURA fellowships for Summer 2010! -Dr. Gerard Doorley joins the Payne Lab. -Update on Past Members: Solaire will be attending the University of Minnesota to pursue a Ph.D. in Chemistry. Nicole, now at UC Berkeley, received an NSF Graduate Fellowship. Congratulations! Jenna has joined the O'Brien Lab at the University of Michigan. March -The Payne Lab hosted a number of visitors from local high schools. Please see our Outreach page for photos. February -Chip presented a poster at the Biophysical Society Annual Meeting in San Francisco. His poster was titled Late Endosomal Degradation of Low-Density Lipoprotein Probed with Multi-Color Single Particle Tracking Fluorescence Microscopy. -Chip won a student travel grant from the Georgia Tech Research and Innovation Conference. Congrats to Chip!. January -Heather joined the Payne Lab. 2009 December -At the Georgia Tech Holiday Party, Chip won a Chemmy for the "Best Actor Portraying Chip"! The Payne Lab submitted this video as part of the holiday activities. November -Jairo received a President’s Undergraduate Research Award for Spring 2010. Great job Jairo! -Don won a Young Investigator Award for his poster presentation at the Society for Free Radical Biology and Medicine annual meeting in San Francisco! -Chip was awarded a 2010 Student Travel Award from the Biophysical Society to attend the 54th Annual Meeting in San Francisco, CA. October -As part of National Chemistry Week, the Payne Lab was featured on Georgia Tech's radio station, WREK, as part of Inside the Black Box's program "Chemistry - It's Elemental". -Chip earned third place in the School of Chemistry and Biochemistry's Graduate Research Symposium with his oral presentation, “Late Endosomal Degradation of Low-Density Lipoprotein Probed with Two-Color Fluorescence Microscopy”. September -Congratulations to CKP for being named a recipient of the 2009 NIH Director’s Young Innovator award. -Jairo and Chip's proposal to the Georgia Tech Undergraduate Research Opportunities Program was funded! This will provide funding for Jairo's automation of Chip's image analysis. -Craig joined the group as a post-doc after completing his Ph.D. with Prof. Jason McNeill at Clemson. -Amy was named a Georgia Tech Molecular Biophysics Trainee for 2009-2010. This award includes a salary supplement and a chance to give a Molecular Biophysics seminar. Only two awards were made this year. Congrats Amy! -The Brown, Curtis, and Payne labs hosted first-year students from Physics, Chemistry, and Computational Science & Engineering for an open house. Open House Flyer -Jairo, Josh and Paul joined the Payne Lab. July -Solaire participated in the REU poster session and research symposium before returning to Minnesota for her senior year of college. We wish her luck! June -The Payne Lab went to Chip's Wedding May -Solaire joined the Payne Lab as a summer REU student. -Kevin and Mindi gradutate! Mindi has completed her Masters and is looking forward to becoming a high school teacher. Kevin earned his B.S. in Chemistry and is looking to continue his education in a MD/PhD program. Kevin and Mindi enjoy the celebration. April -Kevin was awarded Best Oral Presentation in the College of Sciences at the 2009 Undergraduate Research Spring Symposium! Kevin and Georgia Tech President Bud Peterson. March -Amy and Chip presented posters at the Biophysical Society Meeting in Boston, MA. Amy's poster was number B50 and is titled Non-Invasive Pyrenebutyrate-mediated Delivery of Quantum Dots to the Cytosol of Living Cells. Chip's poster was number B57 and is titled Probing the Intracellular Degradation of Low Density Lipoprotein Using Single Particle Tracking Fluorescence Microscopy. January -Amy's paper "Pyrenebutyrate-Mediated Delivery of Quantum Dots across the Plasma Membrane of Living Cells" was published in the 113th volume of The Journal of Physical Chemistry B. -Ashlee was awarded a Center for Integrated Nanotechnologies award to work on "Delivery of nanomaterials across the blood-brain barrier: Three-dimensional tracking of transcytosis" at Los Alamos National Laboratory. 2008 November -Aaron and Emily joined the Payne Lab -Kevin won a PURA fellowship! August -Kevin joined the Payne Lab July -Dr. Ashlee St John joined the Payne Lab as our first Post-Doc -Mindi was named a Georgia Tech Molecular Biophysics Trainee for 2008-2009 May -Jenna joined the lab as an REU student for the summer, Nicole heads off to the University of California at Berkeley for graduate school, the Payne lab went to dinner to welcome Jesse and Jenna and to say 'goodbye' to Nicole. -Nicole graduated with a B.S in Biology and a B.S. in Biochemistry with highest honors. -Amy was awarded a Center for Drug Design, Development and Delivery GAANN fellowship for the 2008-2009 academic year. April -Nicole was awarded the Williams-Walls Award. This is an award given to a graduating woman in the life sciences at Georgia Tech with an outstanding academic record and who has plans to continue her education at the graduate level. -Payne Lab research was highlight in Drug Discovery and Design Magazine[1] March -Nicole was named the College of Sciences Top Undergraduate Researcher! -Jesse won a PURA fellowship! -Christine traveled to Tunisia for the 1st North Africa-USA Regional Workshop on Nanostructured Materials and Nanotechnology.[2] February -Jesse joined the Payne Lab -Christine traveled to the 52nd Annual Biophysical Society Meeting in Long Beach, California.[3] January -Christine was awarded an ACS PROGRESS/Dreyfus Lectureship. 2007 November -Mindi and Amy joined the Payne Lab July -Christine won a NIH Research Scholar Development Award. -Chip was named a Georgia Tech Molecular Biophysics Trainee for 2007-2008. May -Nicole won PURA and Merck fellowships. -Payne Lab complete. Personal tools	v0
2024-06-03T18:26:15.484Z	2013-12-06T05:53:03.000Z	db573po4ukvecg4rjtzt3fly4yqxt34d	{ "content_type": "text/html", "provenance": "cccc-CC-MAIN-2013-48-0004.json.gz:14328", "uncompressed_offset": 518933605, "url": "www.scidev.net/global/genomics/news/genome-of-chagas-disease-vector-decoded-1.html", "warc_date": "2014-01-03T03:19:24.000Z", "warc_filename": "<urn:uuid:f32beab7-dcfa-47cc-a4b3-1e1ffbf00474>", "warc_url": "http://www.scidev.net/global/genomics/news/genome-of-chagas-disease-vector-decoded-1.html" }	cccc_CC-MAIN-2013-48	Bringing science and development together through news and analysis • Genome of Chagas disease vector decoded [MONTEVIDEO] An international team of scientists has decoded the genome of one of the main vectors of Chagas disease, paving the way for more targeted vector control and new ways to prevent disease transmission. Chagas disease is transmitted via a parasite that lives on different species of the blood-sucking triatomine bugs, also known as 'assassin' or 'kissing' bugs, that live in the crevices of poor-quality houses, particularly in rural areas. In Central America the most common species of the bug is Rhodnius prolixus. The first draft of its genome was announced at the 3rd International Workshop for Genomic and Triatomine Biology, held in La Plata, Argentina, last month (17 May). An estimated 11 million people are infected with Chagas disease in Latin America. It starts with fever and tiredness, and later leads to weakened heart and internal organs. Globally, it affects 14 million and kills about 15,000 per year. Until now, scientists had only decoded the genome of the Chagas parasite Trypanosoma cruzi, but lacked genome information about the insect vectors. "We chose R. prolixus because it has the smallest genome among all bugs from the triatomine family," said Pedro Oliveira, of the Federal University of Rio de Janeiro, Brazil, who led the research, which will be finalised and published within a year. Oliveira told SciDev.Net that the team plans to sequence several insects of this sub-family, if more funding can be secured. The work took almost a decade and involved 30 researchers from Argentina, Brazil, Canada, the United States and Uruguay, and was funded by the US National Institutes of Health. "The sequencing of this genome represents the start of the most interesting part of the research," said Rolando Rivera-Pomar, from the Regional Center for Genomic Studies at the National University of La Plata, who worked on the genome. "If we discover why the kissing bug — and not other insects — transmits the parasite we could study the mechanism to inhibit this transmission," he said. Ricardo Gürtler, of the University of Buenos Aires, Argentina, told SciDev.Net that knowing the insect vector genomes should, in theory, improve control strategies through the development of traps, inhibitors of the Chagas parasite growth, and detection of insecticide resistance, among others. Oliveira added that such control technologies are "well advanced both for malaria and dengue mosquitoes", whose genomes have already been decoded.	v0
2024-06-03T18:26:15.484Z	2013-12-06T05:38:10.000Z	2257h2rzvavymlcx3rsiuulmyremzpzt	{ "content_type": "text/html", "provenance": "cccc-CC-MAIN-2013-48-0004.json.gz:14329", "uncompressed_offset": 522811470, "url": "www.seroundtable.com/archives/003158.html", "warc_date": "2014-01-03T03:19:24.000Z", "warc_filename": "<urn:uuid:f32beab7-dcfa-47cc-a4b3-1e1ffbf00474>", "warc_url": "http://www.seroundtable.com/archives/003158.html" }	cccc_CC-MAIN-2013-48	Yahoo! Gives Up Search Race: Admits Defeat to Google Jan 24, 2006 • 9:02 am \| (7) by \| Filed Under Yahoo News Brett Tabke at WebmasterWorld posted a thread named Yahoo Captitulates - Gives Up Goal of Being #1 in Search quoting an article from Seattle Pi. "We don't think it's reasonable to assume we're going to gain a lot of share from Google," Chief Financial Officer Susan Decker said in an interview. "It's not our goal to be No. 1 in Internet search. We would be very happy to maintain our market share." Wow! So what are the forum folks saying about this? they don`t want to set expectations to high, that way they can`t fail! it is a win-win situation. Yahoo going for the underdog approach? I'm sure the shareholders will just eat that one up. Then they need to ditch their search engine, or sell it, and concentrate on being a portal and/or something else. Forum discussion at WebmasterWorld. Previous story: YPN Doubles Earnings of Publishers on 1099? blog comments powered by Disqus	v0
2024-06-03T18:26:15.484Z	2013-12-06T05:50:39.000Z	atvmrplmcbriurndexpl3illrulmmkrh	{ "content_type": "text/html", "provenance": "cccc-CC-MAIN-2013-48-0004.json.gz:14331", "uncompressed_offset": 535480968, "url": "www.sourcewatch.org/index.php?title=Linc_Energy", "warc_date": "2014-01-03T03:19:24.000Z", "warc_filename": "<urn:uuid:f32beab7-dcfa-47cc-a4b3-1e1ffbf00474>", "warc_url": "http://www.sourcewatch.org/index.php?title=Linc_Energy" }	cccc_CC-MAIN-2013-48	Help CMD keep an eye on ALEC. Support our ongoing investigations. Donate Today! Linc Energy From SourceWatch Jump to: navigation, search Learn more from the Center for Media and Democracy's research on climate change. This article is part of the Coal Issues portal on SourceWatch, a project of CoalSwarm and the Center for Media and Democracy. See here for help on adding material to CoalSwarm. Linc Energy is a Brisbane-headquartered company which has proposed to develop a "commercial Underground Coal Gasification (UCG) to Gas to Liquids (GTL) operation" in the Arckaringa Basin.[1] In January 2011, Linc Energy Ltd announced that it had been awarded the full 181,414 acres of underground coal gasification leases that it sought from the Alaska Mental Health Trust Authority, which granted the Alaska exploration licences for an undisclosed sum. Linc says the decision came after over six months of geological assessment and tender submissions, and that the company will "aggressively" conduct coal exploration for underground coal gasification over the next two years. Linc Energy posted a net loss of $16.26 million in the 2010 financial year.[2] Contents Contact Details Website: http://www.lincenergy.com.au/ Articles and Resources Sources 1. Linc Energy, "Linc Energy Ltd (ASX:LNC) Commits Underground Coal Gasification (UCG) Project To South Australia", Media Release, November 19, 2008. 2. "Linc acquires Alaskan exploration licences" Finance News Network, Jan. 27, 2011. Related SourceWatch Articles External Articles Linc Media Releases General Articles This article is a stub. You can help by expanding it. Personal tools Namespaces Variants Actions Navigation How To Other Info Other Policies Google AdSense Toolbox	v0
2024-06-03T18:26:15.484Z	2013-12-06T05:46:23.000Z	6sufrbsrphxjdfoy3nhw5b5ed4majol6	{ "content_type": "text/html", "provenance": "cccc-CC-MAIN-2013-48-0004.json.gz:14341", "uncompressed_offset": 613307471, "url": "www.werelate.org/wiki/Place:Vinland,_Winnebago,_Wisconsin,_United_States", "warc_date": "2014-01-03T03:19:24.000Z", "warc_filename": "<urn:uuid:f32beab7-dcfa-47cc-a4b3-1e1ffbf00474>", "warc_url": "http://www.werelate.org/wiki/Place:Vinland,_Winnebago,_Wisconsin,_United_States" }	cccc_CC-MAIN-2013-48	Place:Vinland, Winnebago, Wisconsin, United States Watchers NameVinland TypeTown Located inWinnebago, Wisconsin, United States the text in this section is copied from an article in Wikipedia Vinland is a town in Winnebago County, Wisconsin, United States. The population was 1,765 at the 2010 census. The unincorporated community of Allenville is located in the town. Research Tips This page uses content from the English Wikipedia. The original content was at Vinland, Wisconsin. The list of authors can be seen in the page history. As with WeRelate, the content of Wikipedia is available under the Creative Commons Attribution/Share-Alike License.	v0
2024-06-03T18:26:15.484Z	2013-12-06T05:51:00.000Z	2xoczy2dgduarhgorkrmr4l3sf7q4fbt	{ "content_type": "text/html", "provenance": "cccc-CC-MAIN-2013-48-0004.json.gz:14362", "uncompressed_offset": 20466224, "url": "blog.mozilla.org/faaborg/2007/07/05/the-graphical-keyboard-user-interface/", "warc_date": "2014-01-03T03:19:54.000Z", "warc_filename": "<urn:uuid:ce5400bf-2999-41a1-a6e5-1708c58d9358>", "warc_url": "http://blog.mozilla.org/faaborg/2007/07/05/the-graphical-keyboard-user-interface/" }	cccc_CC-MAIN-2013-48	The Graphical Keyboard User Interface WIMPy and the Terminal The history of user interfaces can be very briefly summarized into two distinct eras: the command line, followed by the graphical user interface. Interactions on the command line are very fast, but the set of possible commands is not discoverable. GUIs are essentially the opposite, on both issues. Interactions with graphical user interfaces are slower, but possible commands are given visual affordances, and icons attempt to convey possible commands through metaphors. The GUI is largely considered superior to command line interfaces that predated it, but that isn’t entirely true. For instance, while I was in college a majority of students preferred Pine (screenshot) over graphical email clients like Outlook. A group of students in a human computer interaction class I was in did an in-depth analysis of the usability of each application. They found that across a wide variety of metrics, like simplicity, system response time, and (most critically) overall time on task, Pine knocked Outlook’s toolbar-customizing-dialog-poping-drag-and-drop socks off. Tradeoffs Instead of trying to conclude which is superior, a GUI or a keyboard-based interface, it is important to note the specific tradeoffs each interface currently makes in terms of the bandwidth of output, and bandwidth of input. Modern graphical user interfaces are clearly higher bandwidth than text-based command line interfaces in terms of output, but consider the bandwidth of input: Standard GUIs, with their drop down menus, check buttons, and tree-lists just cannot compare to the range of options that a text interface gives effortlessly. In just five alphanumeric characters, you can choose one out of 100,000,000 possible sequences. And choosing any one sequence is just as fast as any other sequence (typing five characters takes roughly 1 second). I challenge you to come up with a non text-based interface that can do as well. (Command Line for the Common Man: The Command Line Comeback) Graphical user interfaces often provide keyboard shortcuts to serve as accelerators. But these keyboard shortcuts are not interfaces in themselves, but simply serve as hooks into various parts of the GUI. For instance, consider control-D in Firefox, it simply pops up the bookmark creation dialog box, and suddenly the user has to go back to using the mouse (or awkward tabbing) in order to complete their task. The Best of Both Worlds Over the last six months, I’ve been thinking a lot about the work of two designers: Nicholas Jitkoff (Blacktree, creators of Quicksilver) and Aza Raskin (Humanized, creators of Enso). Both have designed user interfaces that exist in the riven between command line interfaces and graphical user interfaces. And both of these applications are a joy to use. Unfortunately these types of hybrid keyboard/GUI user interfaces have gone largely unexplored by interaction designers. Aside from feed and label navigation in Google Reader, I don’t know of too many other applications that are currently leveraging these types of incredibly streamlined graphical interfaces, designed solely for keyboard input. How Firefox Could Potentially Leverage Graphical Keyboard User Interfaces Here are some ideas I’ve had about how several different Firefox features could be designed using a graphical keyboard user interface. Please note that these are all only conceptual mockups, and we currently have no official plans to implement these features for Firefox 3 (although, we may at some point release a prototype extension through Mozilla Labs). If you are an extension developer and are interested in contributing to a project like this, please email me or leave a note in the comments. All of these mockups show interfaces that are entirely keyboard driven. A keyboard shortcut launches the UI, and the UI is later dismissed by either selecting an item using the arrow keys and hitting enter, or by hitting escape. These interfaces are all modal, and when invoked they occupy large amounts of space on the screen. For each of these mockups you can click through for a larger version. Searching the Web (control+k, or alt-alt) Of all of these mockups, I think keyboard-based Web search would be the most useful. This mockup also features some favicon upscaling code I wrote for another Mozilla Labs project. In addition to Web search, the “Bookmarks and History” search will likely be more efficient than the current WIMPy ways of accessing bookmarks in Firefox: The move back to language started with web search engines in general, with Google placing the capstone when its name became the house-hold verb for “typing to find what you want”. In fact, Googling is almost always faster then wading through my bookmark menu (which says there is something wrong with using menus as a mechanism for accessing bookmarks). (Command Line for the Common Man: The Command Line Comeback) Switching Tabs (control+tab) Navigating Recent History Tagging Pages Acting on Microformatted Content Conclusion -Just because the command line predated the graphical user interface doesn’t mean interfaces based on windows, icons, menus and pointers are always superior to interfaces based around using the keyboard for input. -Designing interfaces based solely around the mouse and standard GUI widgets, and adding keyboard accelerators as an afterthought, does not always result in creating the most effective and streamlined user interfaces for advanced users. -Interaction designers should consider designing keyboard-based graphical user interfaces, to simultaneously take advantage of both high bandwidth input, and high bandwidth output. Technorati Tags:	v0
2024-06-03T18:26:15.484Z	2013-12-06T05:52:46.000Z	r3fdm7bsns55frasqtrm2mhi3b2ztel2	{ "content_type": "text/html", "provenance": "cccc-CC-MAIN-2013-48-0004.json.gz:14380", "uncompressed_offset": 48572677, "url": "daviswiki.org/194_Chemistry?action=show&redirect=Rock+Hall", "warc_date": "2014-01-03T03:19:54.000Z", "warc_filename": "<urn:uuid:ce5400bf-2999-41a1-a6e5-1708c58d9358>", "warc_url": "http://daviswiki.org/194_Chemistry?action=show&redirect=Rock+Hall" }	cccc_CC-MAIN-2013-48	194 Chemistry (Redirected from Rock Hall) Info Talk Search: The subject of this entry no longer exists in Davis or is a former version of something that came afterwards. All information here is for historical reference only. 194 Chemistry, also known as Chem 194 or 194 Chem is the former name of one of the lecture halls on the UC Davis campus. In 2012 it was renamed to Peter A. Rock Hall. Despite this name change many alumni, students, and community members still refer to this building by its former name. The old projector screen is being sold by the Bargain Barn in August 2013 "A 36' projector screen??? Yes, 36 FEET and REALLY HEAVY! Here's a chance to get a piece of UC Davis history. This is the original screen from Chem 194 (now known as Peter A. Rock Hall) from when it used to be a movie theater way back when. If you can use this projector screen contact me and make me an offer! Deal is YOU and a truck load of body builders have to pick it up from the on-campus location. We just don't have a truck that long to transport it (or a truck load of body builders readily available for that matter). I'm sorry, no pictures available." —Michelle M Borba This is a Wiki Spot wiki. Wiki Spot is a 501(c)3 non-profit organization that helps communities collaborate via wikis.	v0
2024-06-03T18:26:15.484Z	2013-12-06T05:50:20.000Z	bfahtiofzd3jagb6454aw57ru733lq35	{ "content_type": "text/html", "provenance": "cccc-CC-MAIN-2013-48-0004.json.gz:14381", "uncompressed_offset": 50289473, "url": "dendroica.blogspot.com/2009/09/charges-filed-in-syncrude-duck-deaths.html", "warc_date": "2014-01-03T03:19:54.000Z", "warc_filename": "<urn:uuid:ce5400bf-2999-41a1-a6e5-1708c58d9358>", "warc_url": "http://dendroica.blogspot.com/2009/09/charges-filed-in-syncrude-duck-deaths.html" }	cccc_CC-MAIN-2013-48	Thursday, September 17, 2009 Charges Filed in Syncrude Duck Deaths Case Here is a brief update on the Syncrude incident from May 2008. If you remember, 1,603 wild ducks landed in a retention pond holding the toxic oil tailings that result from Syncrude's oil sands operation. The company faces charges of violating both the federal Migratory Birds Convention Act and provincial environmental laws. It just pleaded not guilty and plans to fight the case. Robert White, Syncrude’s lawyer, later told reporters the oil company has already expressed “deep regret” and “spent a tremendous amount of money to ensure it didn’t happen again.” “To now charge us and bring us to court is not going to bring back 1,603 ducks,” he added. Mr. White rejected a reporter’s question about whether Syncrude thought it was above the law. “Of course not,” he said. “However, the law has recognized for a long time that when people do their best to avoid something, then that isn’t a matter for charges. That’s a matter for fix-up.” I am glad that the company has acknowledged the problem and apologized. The trouble for Syncrude is that this is not a single isolated incident. It has a long record of migratory bird deaths, with hundreds of bird dying in its tailings ponds annually. The company clearly needs to do more to prevent these deaths from happening, and it is right for the Canadian government to enforce its laws. Now if only the government had a good solution for the other environmental problems with the oil sands industry.	v0
2024-06-03T18:26:15.484Z	2013-12-06T05:52:04.000Z	v2ktdn3mss3a2umsewgzxdlw6d6cbccx	{ "content_type": "text/html", "provenance": "cccc-CC-MAIN-2013-48-0004.json.gz:14426", "uncompressed_offset": 136624797, "url": "openwetware.org/index.php?oldid=205587&title=OpenWetWare%3ASteering_committee", "warc_date": "2014-01-03T03:19:54.000Z", "warc_filename": "<urn:uuid:ce5400bf-2999-41a1-a6e5-1708c58d9358>", "warc_url": "http://openwetware.org/index.php?title=OpenWetWare:Steering_committee&oldid=205587" }	cccc_CC-MAIN-2013-48	OpenWetWare:Steering committee From OpenWetWare Revision as of 14:22, 15 May 2008 by Lorrie LeJeune (Talk \| contribs) Jump to: navigation, search The OpenWetWare Steering Committee is charged with leading the future direction of OpenWetWare. The steering committee is open to all OWW members, and we are actively seeking participants. You can add yourself to the discuss mailing list. Members Who's Involved? Action List Action items this month Next Meeting Suggested topics Meetings Agendas & Notes Spotlight SC Mailing List • This list has restricted membership and is unmoderated. If you would like to help, please participate in the OpenWetWare:Steering committee activities. You can sign up here. News . Personal tools	v0
2024-06-03T18:26:15.484Z	2013-12-06T05:45:48.000Z	rxmxzf2an4iy3qpmsowc4v5dyhimwogd	{ "content_type": "text/html", "provenance": "cccc-CC-MAIN-2013-48-0004.json.gz:14428", "uncompressed_offset": 136655162, "url": "openwetware.org/index.php?oldid=661985&title=User%3AMobeen_Ashraf%2FNotebook%2FChem-581%2F2012%2F11%2F20", "warc_date": "2014-01-03T03:19:54.000Z", "warc_filename": "<urn:uuid:ce5400bf-2999-41a1-a6e5-1708c58d9358>", "warc_url": "http://openwetware.org/index.php?title=User:Mobeen_Ashraf/Notebook/Chem-581/2012/11/20&oldid=661985" }	cccc_CC-MAIN-2013-48	User:Mobeen Ashraf/Notebook/Chem-581/2012/11/20 From OpenWetWare Jump to: navigation, search Experimental Chemistry Main project page Previous entry Next entry Objective Objective 1) Swelling Studies of PVOH Film with a molar mass of MW=22,000 g/mol. Objective 2) 5-(4,6-dichlorotriazinyl)aminofluoresceine (5-DTFA) Dye Attachment studies. Description • 3 PVOH films were prepared: 0.5 g MW of 22,000, 1 ml glutaraldehyde, and 1 ml of porphrine dihydrogen chloride. • AAS studies for all the Cu standards: NaMT- concentration of 1.25 g/500 ml, for 1min, 5 min and 10 mins standards, 50 % CEC exchange-concentration of 1.25 g/500 ml, for 1 min, 5 min and 10 mins standards, 100% CEC exchange, for 1 min, 5 min and 10 mins standards, and Fe3O4-concentration of 1.25 g/500 ml, for 1 min, 5 min and 10 mins standards. Data • Add data and results here... Notes This area is for any observations or conclusions that you would like to note. Use categories like tags. Change the "Course" category to the one corresponding to your course. The "Miscellaneous" tag can be used for particular experiments, as instructed by your professor. Please be sure to change or delete this tag as required so that the categories remain well organized. Personal tools	v0
2024-06-03T18:26:15.484Z	2013-12-06T05:46:26.000Z	eo2nto4hr56lwi7jrnq7cbamdtihfhuu	{ "content_type": "text/html", "provenance": "cccc-CC-MAIN-2013-48-0004.json.gz:14429", "uncompressed_offset": 136661744, "url": "openwetware.org/index.php?oldid=692553&title=User%3ASam_Kapp", "warc_date": "2014-01-03T03:19:54.000Z", "warc_filename": "<urn:uuid:ce5400bf-2999-41a1-a6e5-1708c58d9358>", "warc_url": "http://openwetware.org/index.php?title=User:Sam_Kapp&oldid=692553" }	cccc_CC-MAIN-2013-48	User:Sam Kapp From OpenWetWare Revision as of 02:01, 18 April 2013 by Sam Kapp (Talk \| contribs) Jump to: navigation, search I am a new member of OpenWetWare! Contents Contact Info Sam Kapp (an artistic interpretation) • Sam Kapp • Genome Compiler I learned about OpenWetWare from Google search, and I've joined because I am an intern for Genome Compiler, a small start-up that seeks to democratize the creation of new life forms by providing a simpler solution for genetic design to a larger community of biologists. Unlike existing genetic design tools, Genome Compiler is free and easy to use, allowing researchers to manipulate and design everything from single genes to entire genomes. I would like to add our software to http://syntheticbiology.org/Tools.html page so that the synthetic biology community can know about our powerful tool.. Education • Year, PhD, Institute • Year, MS, Institute • Year, BS, Institute Research interests 1. Interest 1 2. Interest 2 3. Interest 3 Useful links Personal tools	v0
2024-06-03T18:26:15.484Z	2013-12-06T05:52:45.000Z	n5tkr2fzz34vkr7w3ivvlvivs6laaybw	{ "content_type": "text/html", "provenance": "cccc-CC-MAIN-2013-48-0004.json.gz:14439", "uncompressed_offset": 148964850, "url": "quotationsbook.com/quote/44943/", "warc_date": "2014-01-03T03:19:54.000Z", "warc_filename": "<urn:uuid:ce5400bf-2999-41a1-a6e5-1708c58d9358>", "warc_url": "http://quotationsbook.com/quote/44943/" }	cccc_CC-MAIN-2013-48	Added by staff It manus in gyrum; paullatim singula viresDeperdunt proprias; color est E pluribus unus. Spins round the stirring hand; lose by degreesTheir separate powers the parts, and comes at lastFrom many several colors one that rules. This quote is about uncategorised. Search on Google Books to find all references and sources for this quotation. A bit about Virgil ... We don't have a biography. These people bookmarked this quote: Nobody has bookmarked this quote yet. This quote around the web Loading...	v0
2024-06-03T18:26:15.484Z	2013-12-06T05:51:14.000Z	g3mj67l6j6hxoj3pimah2p3jgxqjocma	{ "content_type": "text/html", "provenance": "cccc-CC-MAIN-2013-48-0004.json.gz:14440", "uncompressed_offset": 148975977, "url": "quotationsbook.com/quotes/author/698/", "warc_date": "2014-01-03T03:19:54.000Z", "warc_filename": "<urn:uuid:ce5400bf-2999-41a1-a6e5-1708c58d9358>", "warc_url": "http://quotationsbook.com/quotes/author/698/" }	cccc_CC-MAIN-2013-48	Quotes by Bernhardt, Sarah Sarah Bernhardt (October 22, 1844 March 26, 1923) was a French stage actress. more Get these quotes on a PDF For the theatre one needs long arms; it is better to have them too long than too short. An artiste with short arms can never, never make a fine gesture. • 1 The monster of advertisement... is a sort of octopus with innumerable tentacles. It throws out to right and left, in front and behind, its clammy arms, and gathers in, through its thousand little suckers, all the gossip and slander and praise afloat, to spit out again at the public. • 1 We must live for the few who know and appreciate us, who judge and absolve us, and for whom we have the same affection and indulgence. The rest I look upon as a mere crowd, lively or sad, loyal or corrupt, from whom there is nothing to be expected but fleeting emotions, either pleasant or unpleasant, which leave no trace behind them. I have, thanks to my travels, added to my stock all the superstitions of other countries. I know them all now, and in any critical moment of my life, they all rise up in armed legions for or against me.	v0
2024-06-03T18:26:15.484Z	2013-12-06T05:38:22.000Z	yf52purn3hcj6alduc5sctz3onvtuphn	{ "content_type": "text/html", "provenance": "cccc-CC-MAIN-2013-48-0004.json.gz:14441", "uncompressed_offset": 149620945, "url": "rationalwiki.org/wiki/The_Economic_Collapse_Blog", "warc_date": "2014-01-03T03:19:54.000Z", "warc_filename": "<urn:uuid:ce5400bf-2999-41a1-a6e5-1708c58d9358>", "warc_url": "http://rationalwiki.org/wiki/The_Economic_Collapse_Blog" }	cccc_CC-MAIN-2013-48	Michael T. Snyder From RationalWiki (Redirected from The Economic Collapse Blog) Jump to: navigation, search Someone is wrong on The Internet Log in: Michael T. Snyder is a fundamentalist Christian crank who has started numerous blogs as a testament to his raging insane belief that the world is about to end. He started with The Economic Collapse Blog in 2007, with constant articles stating how the world is going to hell every single day since the meltdown started in 2007. It seems as though Snyder blames the government for every ill in the world, because without it everything would be great. Like most doom-sayers, it doesn't seem to faze Snyder one bit that every one of his past predictions of economic collapse were dead wrong. This horrendous track record would cause most people to reevaluate their beliefs in the effort to one day be right. Yet, he simply refuses to even address or acknowledge that he has been wrong thousands of times, especially if you count each numbered item of his massive lists. He seems to have explosive diarrhea of the mind that no amount of logic can slow or stop. Contents [edit] Who is this nut? Michael T. Snyder states on his contact page that he is an undergraduate in Commerce from the University of Virginia, and possesses a law degree with an LLM (legal emphasis, not stated) from the University of Florida law school. He has supposedly worked in "numerous Washington DC lawfirms", but quit to live outside of Seattle and rage at the world through the internet. Or as Snyder puts it "now I mostly focus on trying to make a difference in the world." He also states very clearly "I am a Christian, but I believe that most of the churches in America have gotten way off track." Snyder has recently posted a statement of faith[1] in which he states that he believes that the Bible is literally true and that Jesus is coming down in person soon to start the end times to punish all the non-believers.[2] After which Jesus will start his thousand year reign over Earth. Otherwise Snyder is very tight lipped about himself, which makes it hard to find out what drove him mad. [edit] The Economic Collapse blog and clones The Economic Collapse Blog plays to the heart strings of every survivalist, tax protester, extreme libertarian, and rapture ready nut that can access the internet. The unfortunate part is many cranks post the articles far and wide to the groans of many people who have pointed out that time itself has proven all of the blogs posts over a year old (the longest time frame in Snyder's prediction range) dead wrong. Driving people insane with these unrelenting articles about global failure is very encouraged by the author as well..."please do not hesitate to spread these articles wherever you would like. I want as many people as possible to read them. Hopefully the things I write are helping a few more people to wake up." The only ones to survive are the ones believing in the mantra of 3 G's (Gold, Guns, and God). If you don't have enough of the products to survive the shit hitting the fan, you can always click any of the links at the top of the main page to buy it! Recently it seems apparent that Snyder has begun to realize his original blog has started to gain a long history of mocking reviews and refutations. He has created 2 clones of The Economic Collapse Blog called End of the American Dream and The Most Important News. These pages post the exact same pages and articles as The Economic Collapse Blog, just with different names and color schemes. The contact pages[3] have started to include Snyder's StumpleUpon account with a user name called Matthew517,[4] which strangely posts his resident state as Virgina. The StumpleUpon account posts the exact same articles as The Economic Collapse Blog series of websites. The interests area of this account is very amusing in that it links in very large and bold letters subjects like aliens, alternative news, banking, Christian, Conservative Politics (Snyder has stated numerous times that he is "non-partisan"), end times, Survivalism, and Swine Flu. [edit] Why is the economy going to collapse? Well, everything. Literally everything can be distorted in Snyder's mind to cause the economy to go into a death spiral. Each "article" is a long list of points, often times a paragraph in length, along the lines of a Gish Gallop with a number of PRATTs mixed in just for fun. Pay a tax? That will steal money away from your children and make the economy collapse.[5] Believe anything the government says? They are corrupt and will collapse the economy as well.[6] Think the Fed isn't a conspiracy? Silly sheeple.[7] The mainstream media is lying to everyone![8] The government needs to get their hands off of our light bulbs![9] Think you will have enough food to live on, even if you can grow your own? YOU FOOL![10] [edit] Christian blog Snyder has created a new blog recently where he attempts to interpret the Bible called What The Bible Says About... Considering his older signs of insanity claims to fame, this blog doesn't disappoint. It is filled with the same writing style and format, along with headers leading people to buy books by other fundamentalist cranks. Great topics include: Christians can drink, but if they feel any effects of alcohol it's a sin.[11] We are all lawbreakers of God's will. Including loving anything more than God at any time, done anything on the sabbath, not honored your mother/father completely, ever hated or anger towards anything/anyone, or lusted after a women (even thinking, including your own wife).[12] He equates anyone who hasn't accepted the word of God like he has equivalent to rapists, murderers and child molesters.[13] Snyder states divorce is only acceptable if there is adultery or if one's spouse is not Christian. This does not include abuse. He states it is "because God knows best".[14] Snyder is against homosexuality, and all sex outside of marriage. He does state first and foremost one thing that stands him out from the pack of fundamentalists, in that people should still love gays like every other one of Gods creations.[15] So, y'know, at least there's that. [edit] See also [edit] Footnotes 1. Synder's statement of beliefs 2. Not just everyone from other religions and atheists, but anyone who has not accepted Jesus as their Personal savior 3. End of the American Dream - Contact Page 4. Bible Quote is "Do not think that I have come to abolish the Law or the Prophets; I have not come to abolish them but to fulfill them." 5. 65 Ways that everything that you think that you own is being systematically taken away from you 6. Corrupted! 5 shocking examples of government corruption that will blow your mind 7. 19 reasons why the federal reserve is at the heart of our economic problems 8. 27 signs that the nuclear crisis in japan is much worse than either the mainstream media or the Japanese government have been telling us 9. Federal bureaucrats get your dirty hands off of our light bulbs 10. 20 signs that a horrific global food crisis is coming 11. What Does The Bible Say About Drinking? 12. What the Bible Says about Salvation 13. What the Bible says about Judgement 14. What Does the Bible say about Divorce 15. What does the Bible say about Homosexuality. Personal tools Namespaces Variants Actions Navigation Community Toolbox support	v0
2024-06-03T18:26:15.484Z	2013-12-06T05:38:33.000Z	zyegdsj2xnwc3yb3dbja2jtspbob4c54	{ "content_type": "text/html", "provenance": "cccc-CC-MAIN-2013-48-0004.json.gz:14442", "uncompressed_offset": 153363491, "url": "roughlydaily.com/tag/pork-glazed-donut/", "warc_date": "2014-01-03T03:19:54.000Z", "warc_filename": "<urn:uuid:ce5400bf-2999-41a1-a6e5-1708c58d9358>", "warc_url": "http://roughlydaily.com/tag/pork-glazed-donut/" }	cccc_CC-MAIN-2013-48	(Roughly) Daily Posts Tagged ‘pork-glazed donut Fresh from the oven… Quoth the ever-illuminating Laughing Squid: Reuters is reporting that savory shredded pork donuts will be introduced to Dunkin’ Donuts stores in China as part of a multi-year marketing campaign, with NBA star LeBron James as a “brand ambassador” for the campaign. CEO of Dunkin’ Brands Group Inc. Nigel Travis told Reuters, “Donuts are a very flexible product. You can do savory donuts, you can do donuts with shredded pork — that’s in China…We also have a range of other savory products that we have been testing and introducing country by country.” As we choose the savory over the sweet, we might recall that today– the Ides of March, the 15th– while best remembered for Julius Caesar’s bad luck in 44 BCE, is the date that Romans celebrated the festival of Anna Perenna, deity of the circle or “ring” of the year (as her name– c.f. per annum– suggests). source Written by LW March 15, 2012 at 1:01 am Follow Get every new post delivered to your Inbox. Join 697 other followers %d bloggers like this:	v0
2024-06-03T18:26:15.484Z	2013-12-06T05:56:48.000Z	257v45qvhncqd55ixcnr7nudsgba7gf4	{ "content_type": "text/html", "provenance": "cccc-CC-MAIN-2013-48-0004.json.gz:14502", "uncompressed_offset": 211695024, "url": "www.abs.gov.au/Ausstats/abs%40.nsf/0/1EB2722EF553B6D1CA2575CA001465CB", "warc_date": "2014-01-03T03:19:54.000Z", "warc_filename": "<urn:uuid:ce5400bf-2999-41a1-a6e5-1708c58d9358>", "warc_url": "http://www.abs.gov.au/Ausstats/[email protected]/0/1EB2722EF553B6D1CA2575CA001465CB?OpenDocument" }	cccc_CC-MAIN-2013-48	Australian Bureau of Statistics Celebrating the International Year of Statistics 2013 ABS Home > Statistics > By Release Date 4510.0 - Recorded Crime - Victims, Australia, 2007 Quality Declaration Previous ISSUE Released at 11:30 AM (CANBERRA TIME) 03/07/2008 Page tools: Print Page Print All RSS Search this Product QUALITY DECLARATION - SUMMARY INSTITUTIONAL ENVIRONMENT In November 1990 an Inter-Governmental Agreement (IGA) was made between the Commonwealth and the states and territories concerning the establishment of the NCSU as a National Common Police Service, with a role to initiate, coordinate and oversee the development and production of national uniform crime statistics. The statistics contained in this publication are derived from administrative systems maintained by the state and territory police. Although national standards and classifications are used, differences over time in the level of recorded crime may reflect factors other than a change in the incidence of crime. RELEVANCE Recorded Crime - Victims, Australia, 2007(cat. no. 4510.0) presents statistics on incidents of victimisation for a selected range of offences that come to the attention of police and are recorded by them. The scope of this collection includes victims of some attempted and completed offences classified to divisions and/or subdivisions of the Australian Standard Offence Classification (ASOC). Depending on the type of offence, a victim can be a person, a premises, an organisation or a motor vehicle. Selected offences include: · homicide and related offences (including murder, attempted murder and manslaughter) · assault · sexual assault · kidnapping/abduction · robbery · blackmail/extortion · unlawful entry with intent · motor vehicle theft · other theft. Outputs include: · victim counts for selected offences (for Australia and State/Territories) · victim details (age of victim, sex of victim) for offences where the victim is a person · type of location where the criminal incident occurred · use of weapon in the commission of the offence · victim counts for selected offences by outcome of investigation at 30 days Comparable statistics are provided for each of the states and territories. National data is available for all offences excluding assault and sexual assault; however national data for these offences are available from the National Crime and Safety Survey and the Personal Safety Survey. Assault and sexual assault are available for the states and territories, however, data should not be compared across jurisdictions as the data are not comparable. TIMELINESS The Recorded Crime collection is conducted annually for a selected range of offences recorded by police during the reference period of 1 January - 31 December. Information from the collection is released approximately within six months of the reference period. ACCURACY In order to ensure consistency in the data for each state and territory, recorded crime statistics are compiled according to national standards and classifications. However, over time significant changes in the business rules, procedures, systems, policies and recording practices of police agencies across Australia have resulted in some discrepancies in data between states and territories for some offence types. Short term effects on the level of crime recorded by police may also occur as a result of individual jurisdictional initiatives, such as special task forces formed to combat particular offences, or implementation of proactive policing campaigns to encourage reporting by the public. Findings from the Differences in Recorded Crime Statistics (DiRCS) project released in 2005 indicated that data for assault and sexual assault were not comparable across all states and territories. As a consequence of the lack of data comparability for assault and sexual assault, national data for these offence types are not available and the data provided in this publication for individual states and territories should not be used for cross-jurisdiction comparisons. Indexes are provided to assist in interpreting change over time within each jurisdiction. These indexes show movements in victimisation rates over time by comparing each offence group for each year with that offence group in a base year. Where offences reported in the reference year are not processed for inclusion in the national statistics until the following year, revised data are included in subsequent publications and noted accordingly. Revisions to historical data are made when new information about the comparability of data over time is identified. This may occur when errors or omissions are identified in the administrative data supplied to the ABS in prior years. COHERENCE A National Crime Recording Standard (NCRS) has been developed to address the lack of a uniform standard in the initial police recording processes. This standard will complement the already established classifications and counting rules for the Recorded Crime collection and improve the level of comparability of these statistics across jurisdictions. The date of implementing the NCRS will vary across Australia and will be based on operational capacity to implement. For the 2007 release four jurisdictions have implemented the standard; Western Australia, South Australia, the Northern Territory and Queensland. The collection uses the ASOC to classify victims to offences and applies a set of national counting rules to establish the number of victims. Due to differing scope and counting rules the data in the Recorded Crime publication may not be comparable to data published in other national and state/territory publications. A number of legislative and administrative system changes have occurred over time and the statistical impact of these changes is detailed in the Explanatory Notes. INTERPRETABILITY The Recorded Crime publication contains detailed Explanatory Notes, Appendices and Glossary that provide information on the data sources, counting rules, terminology, classifications and other technical aspects associated with these statistics. ACCESSIBILITY In addition to the information provided in the publication, a series of data cubes are also available providing detailed breakdowns by states and territories. If the information you require is not available from the publication or the data cubes, then the National Centre for Crime and Justice Statistics may be able to help you with a customised service to suit your needs. Email: <[email protected]> © Commonwealth of Australia 2013 Unless otherwise noted, content on this website is licensed under a Creative Commons Attribution 2.5 Australia Licence together with any terms, conditions and exclusions as set out in the website Copyright notice. For permission to do anything beyond the scope of this licence and copyright terms contact us.	v0
2024-06-03T18:26:15.484Z	2013-12-06T05:45:14.000Z	blivwv74f4zsae3mybssemoujh7k3vqj	{ "content_type": "text/html", "provenance": "cccc-CC-MAIN-2013-48-0004.json.gz:14505", "uncompressed_offset": 249258465, "url": "www.biomedcentral.com/1471-2288/9/1", "warc_date": "2014-01-03T03:19:54.000Z", "warc_filename": "<urn:uuid:ce5400bf-2999-41a1-a6e5-1708c58d9358>", "warc_url": "http://www.biomedcentral.com/1471-2288/9/1" }	cccc_CC-MAIN-2013-48	Email updates Keep up to date with the latest news and content from BMC Medical Research Methodology and BioMed Central. Research article Spontaneous improvement in randomised clinical trials: meta-analysis of three-armed trials comparing no treatment, placebo and active intervention Lasse Theis Krogsbøll, Asbjørn Hróbjartsson and Peter C Gøtzsche* Author Affiliations The Nordic Cochrane Centre, Rigshospitalet, Dept. 3343, Blegdamsvej 9, DK-2100 Copenhagen, Denmark For all author emails, please log on. BMC Medical Research Methodology 2009, 9:1 doi:10.1186/1471-2288-9-1 The electronic version of this article is the complete one and can be found online at: http://www.biomedcentral.com/1471-2288/9/1 Received:6 August 2008 Accepted:5 January 2009 Published:5 January 2009 © 2009 Krogsbøll et al; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Abstract Background It can be challenging for patients and clinicians to properly interpret a change in the clinical condition after a treatment has been given. It is not known to which extent spontaneous improvement, effect of placebo and effect of active interventions contribute to the observed change from baseline, and we aimed at quantifying these contributions. Methods Systematic review and meta-analysis, based on a Cochrane review of the effect of placebo interventions for all clinical conditions. We selected all trials that had randomised the patients to three arms: no treatment, placebo and active intervention, and that had used an outcome that was measured on a continuous scale or on a ranking scale. Clinical conditions that had been studied in less than three trials were excluded. Results We analysed 37 trials (2900 patients) that covered 8 clinical conditions. The active interventions were psychological in 17 trials, physical in 15 trials, and pharmacological in 5 trials. Overall, across all conditions and interventions, there was a statistically significant change from baseline in all three arms. The standardized mean difference (SMD) for change from baseline was -0.24 (95% confidence interval -0.36 to -0.12) for no treatment, -0.44 (-0.61 to -0.28) for placebo, and -1.01 (-1.16 to -0.86) for active treatment. Thus, on average, the relative contributions of spontaneous improvement and of placebo to that of the active interventions were 24% and 20%, respectively, but with some uncertainty, as indicated by the confidence intervals for the three SMDs. The conditions that had the most pronounced spontaneous improvement were nausea (45%), smoking (40%), depression (35%), phobia (34%) and acute pain (25%). Conclusion Spontaneous improvement and effect of placebo contributed importantly to the observed treatment effect in actively treated patients, but the relative importance of these factors differed according to clinical condition and intervention. Background It can be challenging for patients and clinicians to properly interpret a change in the clinical condition after a treatment has been given. An improvement will often be ascribed to the treatment, although at least two other factors often play a role. One factor is spontaneous improvement [1]. Many clinical conditions are self-limiting, e.g. headache, acute low back pain and the common cold, and most chronic disease symptoms fluctuate in intensity, e.g. rheumatoid arthritis, chronic low back pain and psoriasis. Patients will often seek medical attention when their symptoms are worst, and they are most likely to be included in randomised trials at this time. For the purpose of this paper, we regarded regression to the mean effects as being part of the spontaneous improvement. Regression to the mean occurs, for example, when a patient can only be included in a trial if the symptoms are worse than some threshold value; for statistical reasons, the value will then likely be lower at a later time [1,2]. The second factor is the effect of placebo. Patients may feel reassured, change their expectation, or re-interpret their symptoms once a treatment has been commenced. A Cochrane systematic review did not find large effects of placebo, but some effect in trials with patient-reported continuous outcomes, especially pain [3-5]. We have not found any previous reviews of the three main factors affecting the clinical course of patients included in randomised clinical trials: spontaneous improvement, effect of placebos and effect of active interventions (Fig. 1). We aimed at quantifying their relative contribution to change from baseline in randomised trials. Figure 1. Illustration of approximate contributions of spontaneous improvement and effect of placebo to the estimated effect of active interventions. Methods The Cochrane review of the effect of placebo interventions involved a thorough search for trials including a no-treatment arm and a placebo arm. We selected all trials from the updated Cochrane review of placebo interventions [5] that had randomised the patients to three arms: no treatment, placebo and active intervention, and that had used an outcome that was measured on a continuous scale or on a ranking scale. In order to permit analyses of separate clinical conditions, we excluded conditions studied in less than three trials. Potentially eligible trial reports were read in full by one author (LK), who made preliminary decisions on inclusion and choice of outcome, and extracted the data. The authors of the Cochrane review (AH and PCG) checked the selections and the extracted data. Disagreements were resolved by discussion. In the Cochrane review, patient-reported outcomes were preferred to observer-reported ones. For this study, we selected the outcome that we found most relevant, disregarding whether it was patient- or observer-reported. We made this decision by consensus; there was very little disagreement. In seven cases, the chosen outcome was different from that in the original review. An example is the selection of the well-known observer-reported Bech-Rafaelsen Melancholia Scale instead of the patient-reported Befindlichkeits-Skala. Data extraction was done using a pilot-tested chart. For each trial, pre- and post-treatment means, standard deviations and group sizes were extracted for the three arms. Additional information extracted was: clinical condition, acute or chronic problem, name and range of scale used, and type of intervention (physical, pharmacological or psychological). Meta-analysis was done using Comprehensive Meta Analysis [computer program] version 2.2.030, July 2006. Standardized mean differences (SMD) with 95% confidence intervals were calculated for each trial. SMD is the difference in means divided by the pooled standard deviation. SMD was calculated as Hedges' g, with adjustment for small sample bias. A negative SMD usually implies a positive effect of the intervention, e.g. a lower pain score means less pain. However, in four trials, a large clinical score meant a beneficial effect, and we therefore changed the sign of the SMD before the analysis in these cases. Thus, a negative SMD in our analyses always means a beneficial effect. When standard deviations were missing, we used those from similar trials. Due to the clinical diversity of the included patients, we did not investigate one treatment effect, but rather the mean of many different treatment effects. There was also substantial methodological heterogeneity, e.g. some trials did not have adequately concealed treatment allocation. We therefore used a random effects model for the analyses. The degree of heterogeneity was investigated with I2, which describes the percentage of the variability in effect estimates that is due to heterogeneity rather than sampling error [6]. It was not straightforward how to do the analyses, as we needed to compare the effects in the three groups with the condition at baseline. We analyzed the three treatment arms separately by comparing the post-treatment values with the values at baseline. These data were paired, but we analyzed them as if they were independent, as the presentation of data in the articles did not allow paired analyses. Thus, we accepted a moderate loss of statistical power by handling the paired data as unpaired and assumed that the effect of the ignored correlations between pre- and post-intervention measurements was the same in all situations. It should be noted that this approach leads to overestimation of the sampling error, and therefore to underestimation of the heterogeneity. It was not possible to determine group sizes both pre- and post-treatment for all trials. We therefore used post-treatment sizes in the analyses, which has the advantage that treatment arms with relatively more dropouts receive less weight. Ten trials had more than one active treatment. In the meta-analysis, these were entered as separate treatment arms and therefore contributed relatively more than trials with only one active treatment arm. However, the same would occur in trials with skewed randomisation ratios, and overall, the numbers of patients contributing to the results of the three treatment arms were not much different. Results In- and exclusion of trials There were 118 trials in the Cochrane review with continuous outcome data. We excluded 61 trials: seven were two-armed; in 27 trials, the clinical condition had been studied in less than 3 trials; and 27 trials did not have a baseline assessment. Almost all of the trials without a baseline addressed acute conditions, for example acute pain during a procedure. Though such trials often had pre-treatment assessments they did not involve an assessment of pain experienced during the procedure, or the treatment was given before the painful procedure was initiated. Thus, we identified 57 eligible trials. Data necessary for meta-analyses could not be obtained from 14 trials, so we initially included 43 trials [7-49] (Fig. 2). Figure 2. Selection of trials for the review. We found that the estimates for four hypertension trials [46-49] were unreliable for our purpose. Three of the four trials had run-in periods of 4 to 8 weeks before randomisation, which eliminates the regression to the mean effect, and the changes from baseline were therefore very small and unstable. We expected that the change from baseline in the no-treatment arm and the placebo arm would covary from trial to trial, so that when it was large in one arm, it also tended to be large in the other. We verified this, but with two clear outliers (Fig. 3, lower right corner). In one nausea trial [10], the placebo therapy consisted of talks about the child's daily life, which might have had a large reassuring effect. In the other trial [33], the smoking rate was monitored for one week before treatment in the placebo group, but not in the no-treatment group. Figure 3. Change from baseline in the no-treatment and the placebo arms of the 37 analysed trials. The results are shown as standardized mean differences. Our overall results were very similar, whether or not we excluded the four hypertension trials and the two outliers, but we feel the results for nausea and smoking are more reliable without the outliers. We report below the results for 37 trials (2900 patients), after these six trials were excluded. Characteristics of included trials The 37 trials covered eight different clinical conditions. Most active interventions were of a psychological (17 trials) or physical nature (15 trials); 5 trials were of drugs. Typical psychological treatments were cognitive behaviour therapy and hypnosis, and physical treatment was often acupuncture. Only 10 trials investigated conditions defined by us as acute: depression [7-9], nausea [11,12], and acute pain [13-17], while 27 trials investigated chronic conditions: chronic pain [18-28], phobia [29-31], smoking [32,34], obesity [35-39] and insomnia [40-45]. Duration of treatment was highly variable, ranging from a few days to several months. The outcome was patient-reported in 26 trials and observer-reported in 11 trials. Statistical analyses Overall, across all conditions and interventions, there was a statistically significant change from baseline in all three arms (Table 1). The SMD was -0.24 (95% confidence interval -0.36 to -0.12, I2 = 25%) for no treatment, -0.44 (-0.61 to -0.28, I2 = 57%) for placebo, and -1.01 (-1.16 to -0.86, I2 = 57%) for active treatment. Thus, on average, the relative contributions of spontaneous improvement and of placebo to the change from baseline in the active intervention groups were 24% (0.24/1.01) and 20% ((0.44-0.24)/1.01), respectively (shown approximately in Fig. 1), but with wide variation related to the studied clinical conditions and interventions (Fig. 4). The most pronounced spontaneous improvements, relative to the change from baseline in the actively treated groups, were seen in nausea 45%, smoking 40%, depression 35%, phobia 34% and acute pain 25% (Fig. 4). When combining the influence of spontaneous remission and placebo, the similar proportions were for nausea 73%, smoking 59%, depression 43%, phobia 74%, and acute pain 23% (Fig. 4). Table 1. Standardized mean differences (SMD) for changes from baseline in the three treatment arms separately. Figure 4. Relative contributions of the spontaneous improvement, effect of placebo, and effect of active treatment to the change from baseline seen in the actively treated group. The point estimates were very similar in trials with patient-reported and observer-reported outcomes (Table 2) whereas trials involving acute conditions tended to have larger improvements in all three arms compared with trials involving chronic conditions (Table 3), as expected. Table 2. Standardized mean differences (SMD) for changes from baseline grouped by patient- and observer-reported outcome. Table 3. Standardized mean differences (SMD) for changes from baseline grouped by acute or chronic condition. Discussion We found that both the spontaneous improvement and the effect of placebo contributed importantly to the observed treatment effect in actively treated patients. As noted above, we have not found other reviews that describe the relative contributions of spontaneous remission and placebo to the improvement clinicians note when they treat patients. Our findings have two implications. First, they underline that it is a fallacy when patients and clinicians interpret an improvement that occurs after a treatment has been instituted as being caused by that treatment. In fact, we found that, on average, only about half of that improvement could be ascribed to the treatment in the trials we analysed. Second, our findings show that it is wrong to describe the effect that is observed in a placebo arm of a randomised trial as the effect of placebo, as it includes the spontaneous improvement that would also have occurred without administration of a placebo [50]. This error is very common. We did a full-text search on "placebo effect" on the BMJ's website on 30 April 2008 and found the error in 90% of the articles, even in an obituary. It is a limitation of our study that a quarter of the eligible trials did not report the data necessary for our meta-analyses. Furthermore, we had to use an unconventional meta-analytic method but find it reassuring that the overall effect of placebo was -0.28, as this agrees closely with our previous estimate of -0.24 in the Cochrane review [5] where we used standard meta-analytic methods. We would not expect more elaborate methods to yield results that differ importantly from those we have reported here. We considered other approaches and also did more traditional meta-analyses, comparing treatment arms within each trial after treatment and calculating ratios between the three arms before these ratios were pooled, but as the denominators of the per trial ratios had a distribution that crossed zero, these ratios were very unstable because of "division almost by zero" effects. Furthermore, we could not use this standard approach for the spontaneous improvement, as this required comparison with baseline. We did not try to convert our unpaired analyses into paired ones, as this would have required estimations of correlations that were likely to vary between diseases and interventions. The relative contributions of spontaneous improvement, effects of placebo, and effects of active treatment to the observed change from baseline varied considerably. The eight clinical conditions we analysed were either psychiatric diseases (depression and phobia), involved a high degree of patient cooperation (smoking and obesity) or involved subjective outcomes (acute and chronic pain, nausea, and insomnia); and the interventions were mostly non-pharmacological. It seems likely that spontaneous improvement is more important in trials that include patients with high symptom scores and that do not implement a placebo run-in period, particularly as the regression to the mean is likely to be more pronounced in such settings. Our Cochrane review suggested that the effect of placebos is smaller when imitating pharmacological interventions and when outcomes are observer-reported [3-5]. It is therefore likely that the effect of placebo is comparatively less important in drug trials and in trials with observer-reported outcomes. The Cochrane review found a small effect of placebo on pain, which we reproduced in this review for chronic pain, but not for acute pain, possibly because we were unable to include many acute pain trials that provided no baseline data. The active interventions we included seemed to be quite effective, which is surprising, as most of them were unconventional, and as many trials involved acupuncture. We recently did a systematic review of three-armed acupuncture trials and found a small analgesic effect of acupuncture, compared to placebo acupuncture, that seems to lack clinical relevance and could not be clearly distinguished from bias [51]. The apparent effects we noted of active treatments may therefore to some degree reflect bias, e.g. related to unconcealed allocation of patients and unsuccessful blinding. A major problem related to the interpretation of the outcomes in no-treatment and placebo groups is the lack of blinding. Blinding is important to reduce reporting bias in experiments with subjective outcomes [52], but it is not possible to blind patients who receive no treatment. The lack of blinding favours placebo [52], as patients were often blinded with respect to placebo and active treatment. Patients in the placebo group may think they receive active treatment, or they may tend to please their doctors by exaggerating the improvement, and conversely, patients in the no-treatment group may tend to view their experiences more negatively, as they may feel deprived of treatment. Conclusion We conclude that both the spontaneous improvement and the effect of placebo contribute importantly to the observed treatment effect in actively treated patients, and that the relative importance of these factors differ according to clinical condition and intervention. Competing interests The authors declare that they have no competing interests. Authors' contributions PCG and AH coined the idea, initiated the project, and wrote the protocol with LK; LK extracted data that were checked by PCG and AH; LK and PCG did the analyses; LK wrote the first draft of the paper, PCG and AH the final version. Guarantors: PCG and AH. Funding No funding. Acknowledgements We thank the statistical peer reviewer, Jesse Berlin, and a statistician we consulted, Peter Dalgaard, for very valuable advice. References 1. Morton V, Torgerson DJ: Effect of regression to the mean on decision making in health care. BMJ 2003, 326:1083-4. PubMed Abstract \| Publisher Full Text \| PubMed Central Full Text 2. Gøtzsche PC: Rational Diagnosis and Treatment. Evidence-Based Clinical Decision-Making. 4th edition. Chichester, Wiley; 2007. 3. Hróbjartsson A, Gøtzsche PC: Is the placebo powerless? An analysis of clinical trials comparing placebo with no treatment. N Engl J Med 2001, 344:1594-1602. PubMed Abstract \| Publisher Full Text 4. Hrobjartsson A, Gøtzsche PC: Placebo treatment versus no treatment. Cochrane Database Syst Rev 2003, (1):CD003974. PubMed Abstract \| Publisher Full Text 5. Hróbjartsson A, Gøtzsche PC: Placebo interventions for all clinical conditions. Cochrane Database Syst Rev 2004, (3):CD003974. PubMed Abstract \| Publisher Full Text 6. Higgins JPT, Green S, editors: [http://www.cochrane-handbook.org] webcite Cochrane Handbook for Systematic Reviews of Interventions Version 5.0.0 [updated February 2008]. The Cochrane Collaboration. 2008. 7. Nandi DN, Ajmany S, Ganguli H, Banerjee G, Boral GC, Ghosh A, Sarkar S: A clinical evaluation of depressives found in a rural survey in India. Br J Psychiatry 1976, 128:523-7. PubMed Abstract \| Publisher Full Text 8. Röschke J, Wolf C, Müller MJ, Wagner P, Mann K, Grözinger M, Bech S: The benefit from whole body acupuncture in major depression. J Affect Disord 2000, 57:73-81. PubMed Abstract \| Publisher Full Text 9. Sumaya IC, Rienzi BM, Deegan JF, Moss DE: Bright light treatment decreases depression in institutionalized older adults: a placebo-controlled crossover study. J Gerontol A Biol Sci Med Sci 2001, 56(6):M356-M360. PubMed Abstract \| Publisher Full Text 10. Hawkins PJ, Liossi C, Ewart BW, Hatria P, Kosmidis VH, Varvutsi M: Hypnotherapy for control of anticipatory nausea and vomiting in children with cancer: preliminary findings. Psychooncology 1995, 4:101-6. Publisher Full Text 11. O'Brien B, Relyea MJ, Taerum T: Efficacy of P6 acupressure in the treatment of nausea and vomiting during pregnancy. Am J Obstet Gynecol 1996, 174:708-15. PubMed Abstract \| Publisher Full Text 12. Werntoft E, Dykes A: Effect of acupressure on nausea and vomiting during pregnancy. A randomized, placebo-controlled, pilot study. J Reprod Med 2001, 46:835-9. PubMed Abstract 13. Cupal DD, Brewer BW: Effects of relaxation and guided imagery on knee strength, reinjury anxiety, and pain following anterior cruciate ligament reconstruction. Rehabil Psychol 2001, 46:28-43. Publisher Full Text 14. Forster EL, Kramer JF, Lucy SD, Scudds RA, Novick RJ: Effects of TENS on pain, medications, and pulmonary function following coronary artery bypass graft surgery. Chest 1994, 106:1343-8. PubMed Abstract \| Publisher Full Text 15. Helms JM: Acupuncture for the management of primary dysmenorrhea. Obstet Gynecol 1987, 69:51-6. PubMed Abstract 16. Kober A, Scheck T, Greher M, Lieba F, Fleischhackl R, Fleischhackl S, Randunsky F, Hoerauf K: Prehospital analgesia with acupressure in victims of minor trauma: a prospective, randomized, double-blinded trial. Anesth Analg 2002, 95:723-7. PubMed Abstract \| Publisher Full Text 17. Sanders G, Tepe R, Maloney P, Reinert O: The effect of spinal manipulation on subjects with acute low back pain: a comparison of visual analog pain scores and serum beta endorphin levels. J Manipulative Physiol Ther 1990, 13:58. 18. Alfano AP, Taylor AG, Foresman PA, Dunkl PR, McConnell GG, Conaway MR, Gillies GT: Static magnetic fields for treatment of fibromyalgia: a randomised controlled trial. J Altern Complement Med 2001, 7:53-64. PubMed Abstract \| Publisher Full Text 19. Blanchard EB, Appelbaum KA, Radnitz CL, Michultka D, Morrill B, Kirsch C, Hillhouse J, Evans DD, Guarnieri P, Attanasio V, Andrasik F, Jaccard J, Dentinger MP: Placebo-controlled evaluation of abbreviated progressive muscle relaxation and of relaxation combined with cognitive therapy in the treatment of tension headache. J Consult Clin Psychol 1990, 58:210-5. PubMed Abstract \| Publisher Full Text 20. Blanchard EB, Appelbaum KA, Radnitz CL, Morrill B, Michultka D, Kirsch C, Guarnieri P, Hillhouse J, Evans DD, Jaccard J, Barron KD: A controlled evaluation of the thermal biofeedback and thermal biofeedback combined with cognitive therapy in the treatment of vascular headache. J Consult Clin Psychol 1990, 58:216-24. PubMed Abstract \| Publisher Full Text 21. Chenard JR, Marchand S, Charest J, Jinxue L, Lavignolle B: Evaluation of a behavioral intervention for chronic low-back pain: 'The interactional back school' [Évaluation d'un traitement comportmental de la lombalgie chronique: 'l école interactionelle du dos']. Science et Comportement 1991, 21:225-39. 22. Hong C, Chen Y, Pon CH, Yu J: Immediate effects of various physical medicine modalities on pain threshold of an active myofascial trigger point. J Musculoskeletal Pain 1993, 1:37-53. Publisher Full Text 23. Kotani N, Kushikata T, Suzuki A, Hashimoto H, Muraoka M, Matsuki A: Insertion of intradermal needles into painful points provides analgesia for intractable abdominal scar pain. Reg Anesth Pain Med 2001, 26:532-8. PubMed Abstract \| Publisher Full Text 24. Leibing E, Leonhardt U, Köster G, Goerlitz A, Rosenfeldt JA, Hilgers R, Ramadori G: Acupuncture treatment of chronic low-back pain: a randomized, blinded, placebo-controlled trial with 9-months followup. Pain 2002, 96:189-96. PubMed Abstract \| Publisher Full Text 25. Moffett JAK, Richardson PH, Frost H, Osborn A: A placebo controlled double blind trial to evaluate the effectiveness of pulsed short wave therapy for osteoarthritic hip and knee pain. Pain 1996, 67:121-7. PubMed Abstract \| Publisher Full Text 26. Parker JC, Smarr KL, Buckelew SP, Stucky-Ropp RC, Hewett JE, Johnson JC, Wright GE, Irvin WS, Walker SE: Effects of stress management on clinical outcomes in rheumatoid arthritis. Arthritis Rheum 1995, 38:1807-18. PubMed Abstract \| Publisher Full Text 27. Thomas VJ, Dixon AL, Milligan P: Cognitive-behaviour therapy for the management of sickle cell disease pain: an evaluation of a community based intervention. Br J Health Psychol 1999, 4:209-29. Publisher Full Text 28. Wojciechowski FL: Behavioral treatment of tension headache: a contribution to controlled outcome research methodology. Gedrag – Tijdschrift voor Psychologie 1984, 12:16-30. 29. Etringer BD, Cash TF, Rimm DC: Behavioral, affective and cognitive effects of participant modeling and an equally credible placebo. Behav Ther 1982, 13:476-85. Publisher Full Text 30. Lick J: Expectancy, false galvanic skin response feedback and systematic desensitization in the modification of phobic behavior. J Consult Clin Psychol 1975, 43:557-67. PubMed Abstract \| Publisher Full Text 31. Rosen GM, Glasgow RE, Barrera M: A controlled study to assess the clinical effcacy of totally self-administrated systematic desensitization. J Consult Clin Psychol 1976, 44:208-17. PubMed Abstract \| Publisher Full Text 32. Etter J, Lazlo E, Zellweger J, Perrot C, Perneger TV: Nicotine replacement to reduce cigarette consumption in smokers who are unwilling to quit: a randomized trial. J Clin Psychopharmacol 2002, 22:487-95. PubMed Abstract \| Publisher Full Text 33. Sipich JF, Russell RK, Tobias LL: A comparison of covert sensitization and 'nonspecific' treatment in the modification of smoking behavior. J Behav Ther Exp Psychiatry 1974, 5:201-3. Publisher Full Text 34. Spanos NP, Mondoux TJ, Burgess CA: Comparison of multi-component hypnotic and non-hypnotic treatments for smoking. Contemp Hypnosis 1995, 12:12-19. 35. Antonio J, Colker CM, Torina G, Shi Q, Brink W, Kalman D: Effects of standardised guggulsterone phosphate supplement on body composition in overweight adults: a pilot study. Curr Ther Res 1999, 60:220-7. Publisher Full Text 36. Block J: Effects of rational emotive therapy on overweight adults. Psychotherapy: Theory, Research and Practice 1980, 17:277-80. Publisher Full Text 37. Colker CM, Kalman DS, Torina GC, Perlis T, Street C: Effects of Citrus aurantium extract, caffeine, and St. John's wort on body fat loss, lipid levels, and mood states in overweight healthy adults. Curr Ther Res 1999, 60:145-53. Publisher Full Text 38. Roongpisuthipong C, Panpakdee O, Boontawee A, Kulapongse S, Tanphaichitr V: Possible thermogenesis with dexfenfluramine. J Med Assoc Thai 1999, 82(2):150-159. PubMed Abstract 39. Senediak C, Spence SH: Rapid versus gradual scheduling of therapeutic contact in a family based behavioural weight control programme for children. Behav Psychother 1985, 13:265-87. 40. Ascher LM, Turner RM: Paradoxical intention and insomnia: an experimental investigation. Behav Res Ther 1979, 17:408-11. PubMed Abstract \| Publisher Full Text 41. Espie CA, Lindsay WR, Brooks DN, Hood EM, Turvey T: A controlled comparative investigation of psychological treatments for chronic sleep-onset insomnia. Behav Res Ther 1989, 27:79-88. PubMed Abstract \| Publisher Full Text 42. Lick JR, Heffler D: Relaxation training and attention placebo in the treatment of severe insomnia. J Consult Clin Psychol 1977, 45:153-61. PubMed Abstract \| Publisher Full Text 43. Nicassio P, Bootzin R: A comparison of progressive relaxation and autogenic training as treatments for insomnia. J Abnorm Psychol 1974, 83(3):253-260. PubMed Abstract \| Publisher Full Text 44. Tsay SL, Chen ML: Acupressure and quality of sleep in patients with end-stage renal disease: a randomised controlled trial. Int J Nurs Stud 2003, 40:1-7. PubMed Abstract \| Publisher Full Text 45. Turner RM, Ascher LM: Controlled comparison of progressive relaxation, stimulus control, and paradoxical intention therapies for insomnia. J Consult Clin Psychol 1979, 47:500-8. PubMed Abstract \| Publisher Full Text 46. Canino E, Cardona R, Monsalve P, Acuna FP, López B, Fragachan F: A behavioral treatment program as a therapy in the control of primary hypertension. Acta Cient Venez 1994, 45:23-30. PubMed Abstract 47. Frankel BL, Patel DJ, Horwitz D, Friedewald WT, Gaarder KR: Treatment of hypertension with biofeedback and relaxation techniques. Psychosom Med 1978, 40:276-93. PubMed Abstract \| Publisher Full Text 48. Seer P, Raeburn JM: Meditation training and essential hypertension: a methodological study. J Behav Med 1980, 3:59-71. PubMed Abstract \| Publisher Full Text 49. Yates RG, Lamping DL, Abram NL, Wright C: Effects of chiropractic treatment on blood pressure and anxiety: a randomized, controlled trial. J Manipulative Physiol Ther 1988, 11:484-8. PubMed Abstract 50. Hróbjartsson A: What are the main methodological problems in the estimation of placebo effects? J Clin Epidemiol 2002, 55:430-5. PubMed Abstract \| Publisher Full Text 51. Madsen MV, Gøtzsche PC, Hróbjartsson A: Acupuncture treatment for pain. Systematic review of randomized clinical trials with acupuncture, placebo acupuncture and no-acupuncture groups. BMJ, in press. 52. Wood L, Egger M, Gluud LL, Schulz KF, Jüni P, Altman DG, Gluud C, Martin RM, Wood AJ, Sterne JA: Empirical evidence of bias in treatment effect estimates in controlled trials with different interventions and outcomes: meta-epidemiological study. BMJ 2008, 336:601-5. PubMed Abstract \| Publisher Full Text \| PubMed Central Full Text Pre-publication history The pre-publication history for this paper can be accessed here: http://www.biomedcentral.com/1471-2288/9/1/prepub	v0
2024-06-03T18:26:15.484Z	2013-12-06T05:53:13.000Z	2jpkdehhpywbfyywhrnfqtspcgycrnsy	{ "content_type": "text/html", "provenance": "cccc-CC-MAIN-2013-48-0004.json.gz:14511", "uncompressed_offset": 319249780, "url": "www.eea.europa.eu/publications/technical_report_2002_75/sendto_form", "warc_date": "2014-01-03T03:19:54.000Z", "warc_filename": "<urn:uuid:ce5400bf-2999-41a1-a6e5-1708c58d9358>", "warc_url": "http://www.eea.europa.eu/publications/technical_report_2002_75/sendto_form" }	cccc_CC-MAIN-2013-48	Personal tools Notifications Get notifications on new reports and products. Frequency: 3-4 emails / month. Subscriptions Sign up to receive our reports (print and/or electronic) and quarterly e-newsletter. Follow us Twitter Facebook YouTube channel RSS Feeds More Write to us For the public: For media and journalists: Contact EEA staff Contact the web team FAQ Call us Reception: Phone: (+45) 33 36 71 00 Fax: (+45) 33 36 71 99 next previous items Skip to content. \| Skip to navigation Sound and independent information on the environment You are here: Home / Publications / Annual European Community Greenhouse Gas Inventory 1990-2000 and Inventory Report 2002 Send this page to someone Fill in the email address of your friend, and we will send an email that contains a link to this page. Address info (Required) The e-mail address to send this link to. (Required) Your email address. A comment about this link. European Environment Agency (EEA) Kongens Nytorv 6 1050 Copenhagen K Denmark Phone: +45 3336 7100	v0
2024-06-03T18:26:15.484Z	2013-12-06T05:53:22.000Z	pyjgowarm4qeecdx3fi7pubj4wuhmz2j	{ "content_type": "text/html", "provenance": "cccc-CC-MAIN-2013-48-0004.json.gz:14517", "uncompressed_offset": 348815887, "url": "www.ga.gov.au/energy/province-sedimentary-basin-geology/petroleum/onshore-australia/sydney-basin.html", "warc_date": "2014-01-03T03:19:54.000Z", "warc_filename": "<urn:uuid:ce5400bf-2999-41a1-a6e5-1708c58d9358>", "warc_url": "http://www.ga.gov.au/energy/province-sedimentary-basin-geology/petroleum/onshore-australia/sydney-basin.html" }	cccc_CC-MAIN-2013-48	Sydney Basin Location Map Map showing the location of Sydney Basin in relation to Australia © Geoscience Australia Basin Details and Geological Overview The Permo-Triassic Sydney Basin straddles Australia's central eastern coast in New South Wales. The basin covers 64 000km2, 36 000km2 onshore and 28 000km2 offshore under water depths of up to 4 500 metres. The Sydney Basin is part of a major basin system that extends over 1 500km from the Bowen Basin in Queensland through to the Gunnedah Basin in NSW. Onshore, the basin contains 4 500 metres of Permo-Triassic clastic sediments, while the offshore basin contains 6 000 metres of sediments. The basin overlies the Lachlan Fold Belt and Late Carboniferous volcanoclastic sediments. The basin formed during extension in the Early Permian, with half-graben infilled with the Dalwood and Talaterang Groups. Foreland loading followed with the compression of the Currarong Orogen in the Early Permian. Late Permian uplift associated with the New England foreland loading phase resulted in the formation of depocentres with the northeast Sydney Basin. These depocentres filled with pyroclastic and alluvial-paludual sediments of the Newcastle Coal Measures. In the Triassic, uplift of the offshore basin resulted in reworking of Permian sediments in fluvial environments. The basin underwent a final phase of deformation (thrusting) in the Middle Triassic. Extension and breakup in the Tasman Sea beginning in the Late Cretaceous resulted in the current structural boundaries of the basin's eastern margin. Over 100 wells have been drilled in the onshore Sydney Basin, although no wells have yet been drilled offshore. The onshore basin contains rich coal deposits with associated natural gas and minor oil shows. The geochemistry of oil shows indicate a terrestrial source from a clay-rich environment, although not associated with the coal facies. The main trap types are anticlinal and overthrust, with some structural reactivation during Tasman Sea rifting. Basin Summary Table SYDNEY BASIN State(s) New South Wales Area (km2) Offshore 28 000 Onshore 36 000 Maximum thickness (m) > 6 000 Age Range Permian-Triassic (Jurassic and Cretaceous section believed to have existed but now eroded). Basin Overlies Palaeozoic granites, volcanics and metasediments. Underlies - Subdivisions Informal 'West', 'Central', 'South' and 'North' subdivisions are used onshore. Other Offshore structure quite different from onshore. Indicators Knowledge Detailed field scale geophysical and well data onshore; regional geophysical data only offshore. Basin type Convergent margin foreland thrust loaded basin. System(s) Gondwanan. Water Depth (m) 0-4 000 Exploration Status Frontier (offshore). Wells 0 offshore, 115 onshore petroleum exploration wells. Seismic line-km Sparse 2D regional coverage offshore. Discoveries Nil Shows Widespread oil and gas shows have been encountered throughout the section. HC evidence Active petroleum system (Maung and others, 1993). Geology Source(s) Late Permian coal measures and marine shales. Reservoirs Permian shallow marine to fluvial sands (but often affected by diagenesis); Triassic Narabeen Group has excellent reservoirs. Seals Numerous Permo-Triassic intra-formational seals. Trap types 1) Wrench related structures, 2) overthrust traps, 3) mild basin inversion features, 4) extension down to basement fault bound blocks, 5) sub-thrust traps, 6) stratigraphic traps, 7) extensional, combination traps. Palaeogeographic summary Early Permian: dominantly marine; late Early Permian to Late Permian: dominantly fluvial, with coal measures; Triassic: dominantly fluvial but some marine and volcanics; Jurassic-Cretaceous: eroded. Timing Oil generation Commenced Middle Jurassic to Early Cretaceous for Late Permian sources depending on location and amount of eroded section, late generation still occurring. A Late Cretaceous peak is probable. Gas generation Early Cretaceous to present. Trap formation Types 2, 4 and 5 Early Permian, type 1 Early Permian to Triassic, type 3 Late Permian, type 6 Late Permian to Triassic, type 7 Early Cretaceous. Other key times Major Late Cretaceous erosion accompanied breakup between Australia and the Lord Howe Rise. Other important information 1) The offshore basin lies under a while migration path for several months of the year; 2) The onshore basin includes large urban areas. Geoscience Australia products available 1) Harrington and others, 1989; 2) Maung and others, 1997. 3) Cadman and others, 1998. Regional Cross-sections Sydney Basin Cross Section © Geoscience Australia Key References Author(s) Year Title Alder, J.D., Hawley, S., Maung, T., Scott, J., Shaw, R.D., Sinelinikov, A. and Kouzmina, G. 1998 Prospectivity of the offshore Sydney Basin: A new prospective. The Australian Petroleum Production and Exploration Association (APPEA) Journal, 38(1), 68-91 Bembrick, C.S., Herbert, C., Scheibner, E. and Stuntz, J. 1973 Structural subdivisions of the New South Wales portion of the Sydney-Bowen Basin. Geological Survey of New South Wales, 116, 105-117 Bowman, H.N. 1981 Brief notes on the offshore coal potential of New South Wales. Geological Survey of New South Wales, Report GS 1981/372 Bradley, G.M., Yoo, E.K., Moloney, J., Beckett, J. and Richardson, S.J. 1985 Petroleum data package, Sydney Basin NSW. NSW Geological Survey Report GS 1985/004, 229 Brakel, A.T. 1986 Global sea level change as a method of correlating the Late Permian coal measures in the Sydney, Gunnedah and Bowen Basins, eastern Australia. BMR Journal of Australian Geology and Geophysics, 10, 79-116 Branagan, D., Herbert, C. and Langford-Smith, T. 1976 An outline of the geology and geomorphology of the Sydney Basin, Science Press, Department of Geology and Geophysics, University of Sydney Cadman, S. J., Pain, L. and Vuckovic, V. 1998 Bowen and Surat Basins, Clarence Morton Basin, Sydney Basin, Gunnedah Basin and other minor onshore basins, Queensland, NSW and NT. Australian Petroleum Accumulations Report 11, Bureau of Resource Sciences, Canberra Carey, S.W. 1969 Tectonic framework of the Sydney Basin. Abstracts for the 1st, 2nd, 3rd and 4th Symposia on Advances in the Study of the Sydney Basin. University of Newcastle, NSW, 53-59 Doyle, H.A., Underwood, R. and Polack, E.J. 1966 Seismic velocities from explosions off the central coast of New South Wales. Journal of the Geological Society of Australia, 13, 355-372 Eadington, P.J., Hamilton, P.J. and Bai, G.P. 1991 Fluid History Analysis - A New Concept for Prospect Evaluation. APEA Journal/Sydney Basin, 282-294 Evans P.R. and Migliucci, A. 1991 Evolution of the Sydney Basin during the Permian as a foreland basin to the Currarong and New England Orogen. Newcastle Symposium on the Advances in the Study of the Sydney Basin, University of Newcastle, Department of Geology, v.25, 22-29 Finlayson, D.M. and McCracken, H.M. 1981 Crustal structure under the Sydney Basin and Lachlan Fold Belt, determined from explosion seismic studies. Journal of the Geological Society of Australia, 28, 177-190 Gostin, V.A. and Herbert, C. 1973 Stratigraphy of the Upper Carboniferous and Lower Permian sequence, southern Sydney Basin. Journal of the Geological Society of Australia, 20, 49-70 Grybowski, D.A. 1992 Exploration in Permit NSW/P10 in the offshore Sydney Basin. APPEA Journal, 32, 251-263 Harrington, H.J. 1982 Keynote Address: Tectonics and the Sydney Basin. Abstracts for the 16th Symposium on Advances in the Study of the Sydney Basin, 15-19. University of Newcastle, NSW Harrington, H.J., Brakel, A.T. and Hunt, J. 1983 Tectonic settings of central and eastern Australian Permian coal basins. 6th Australian Geological Convention, Geological Society of Australia, Abstracts 9, 278 Harrington. H.J., Brakel, A.T., Hunt, J.W., Wells, A.T., Middleton, M.F., O'Brien, P.E., Hamilton, D.S., Beckett, J., Weber, C.R., Radke, S., Totterdell, J.M., Swaine, D.J. and Schmidt, P.W. 1989 Permian coals of Eastern Australia. Bureau of Mineral Resources, Australia, Bulletin 231 Hawley, S.P., Glen, R.A. and Baker, C.Y. 1995 1:100,000 scale Newcastle Coal Field Regional Geology Map. NSW Department of Mineral Resources, Geological Survey of NSW Herbert, C. 1987 Petroleum Prospectivity in the Sydney Basin. Newcastle Symposium on the Advances in the Study of the Sydney Basin, University of Newcastle, Department of Geology, v.21, 107-113 Maung, T.U., Alder, D., Shaw, R. and Hawley, S. 1997 Offshore Sydney Basin petroleum prospectivity bulletin. Petroleum Resources Branch, Bureau of Resource Sciences Mayne, S.J., Nicholas, E., Bigg-Wither, A.L., Rasidi, J.S. and Raine, M.J. 1974 Geology of the Sydney Basin - A Review. Australian Bureau of Mineral Resources, v.149, 229 Middleton, M.F. 1989 Coal-Rank Trends of Eastern Australia in Permian Coal Basins. IN: Harrington, H.J. (Editor) 'Permian Coals of Eastern Australia', Bureau of Mineral Resources Bulletin 231, 333-352 Packham, G.H. (editor) 1969 The Geology of New South Wales. Geological Society of New South Wales Incorporated. Journal. Geological Society of Australia, 16(1). 654 Robertson Research (Aust.) Pty Ltd. 1981 Exploration Report, PEL 242,243,244. NSW Department of Mineral Resources Report PGR 1982/02 Shepherd, J. and Huntington, J.F. 1981 Geological fracture mapping in coalfields and the stress fields of the Sydney Basin. Journal of the Geological Society of Australia, 28, 299-309 Smyth, M. 1983 Hydrocarbon Source Rock in the Sydney and Gunnedah Basins. Advances in the Study of the Sydney Basin. Proceedings of the 17th Symposium, University of Newcastle Tye, S.C, Fielding, C.R. and Jones, B.J. 1996 Stratigraphy and Sedimentology of the Permian Talaterang and Shoalhaven Groups in the southernmost Sydney Basin, NSW. Australian Journal of Earth Sciences (1996), v.43, 57-69 Topic contact: [email protected] Last updated: May 31, 2012	v0
2024-06-03T18:26:15.484Z	2013-12-06T05:54:02.000Z	r5bwgnfrz2sudmdzihy4e776hm5cgeop	{ "content_type": "text/html", "provenance": "cccc-CC-MAIN-2013-48-0004.json.gz:14518", "uncompressed_offset": 348825412, "url": "www.ga.gov.au/products/servlet/controller?catno=61906&event=FILE_SELECTION", "warc_date": "2014-01-03T03:19:54.000Z", "warc_filename": "<urn:uuid:ce5400bf-2999-41a1-a6e5-1708c58d9358>", "warc_url": "http://www.ga.gov.au/products/servlet/controller?event=FILE_SELECTION&catno=61906" }	cccc_CC-MAIN-2013-48	You are here: Home > Free Data Downloads Updated: 28 June 2013 File Selection Use the checkboxes to select the files you would like to download, then click on the "Continue to File Download" button. Product Details Available Files AUSGeoid98 v.1.0 data files: (sj48-04) Geodetic Data - AUSGeoid98 Themes: geodesy Data file, Download the file (.dat), 0.0MB Please tell us your: Sector * Industry * * mandatory fields To help us keep our products relevant, please register your email address to take part in our twice yearly survey Email address Unless otherwise noted, all Geoscience Australia material on this website is licensed under the Creative Commons Attribution 3.0 Australia Licence.	v0
2024-06-03T18:26:15.484Z	2013-12-06T06:04:41.000Z	kj67csjhksfpmh2457fmg25rewnh3bxa	{ "content_type": "text/html", "provenance": "cccc-CC-MAIN-2013-48-0004.json.gz:14525", "uncompressed_offset": 358271730, "url": "www.go4expert.com/forums/i-method-hack-schools-computers-i-doing-t23018/", "warc_date": "2014-01-03T03:19:54.000Z", "warc_filename": "<urn:uuid:ce5400bf-2999-41a1-a6e5-1708c58d9358>", "warc_url": "http://www.go4expert.com/forums/i-method-hack-schools-computers-i-doing-t23018/" }	cccc_CC-MAIN-2013-48	I have a method to hack my school's computers. How am I doing it? Newbie Member Okay, so at my school the student's accounts on the computers have very limited access. We don't have access to the C:, the Control Panel, CMD, etc. The computers' OS is Windows XP. Although I have no intention of doing anything harmful to anyone, I do like to have control over the computer. So I started researching how to hack school computers. After hours of searching, I managed to put together a hacking method that works at my school. Here's how I do it: 1. Using Notepad, I create a batch file that starts cmd in my student drive (by writing command.com and saving it as a .bat file on my student drive.) 2. I open the batch file. Next, I create a scheduled task. Assuming the time on the computer was 12:00, I would type "at 12:01 /interactive cmd.exe. 4. At 12:01 a new Command Prompt window appears. I am now in the C: drive. 5. I open the task manager by typing "taskmgr" in the Command Line. (I'm unable to start it any other way, not even if I try to start it from the command line in my student drive) 6. I end the "explorer.exe" process in the Task Manager. 7. Back in the command line, I type "explorer.exe", which restarts Windows Explorer. 8. I am now the SYSTEM user and have total access on the computer. So that's how I do it. I'm just curious how exactly my method works. How come I can't get to the C: drive from the command prompt window in my student drive, but yet from this same window I can start a scheduled task which opens a command prompt window in the C:? And how does ending explorer.exe and starting it up again magically make me the SYSTEM user? Also, is there a way I could run the whole method automatically from a batch file? For the record, I have no real interest in hacking the schools' computers. I'm really just interested in learning a little more about how Windows and the Command Prompt works, and how to make batch files. I know I'm kinda asking for a lot so any answer is greatly appreciated! Light Poster I don't think this method can take effect in Vista or Windows 7. Go4Expert Member haha what about mac lol Go4Expert Member but i'm a windows user vista	v0
2024-06-03T18:26:15.484Z	2013-12-06T05:52:17.000Z	6tkhgwxtrchvdbz67tm2olwxee2wpdpv	{ "content_type": "text/html", "provenance": "cccc-CC-MAIN-2013-48-0004.json.gz:14526", "uncompressed_offset": 361900975, "url": "www.grandtheftwiki.com/Cheat_Codes", "warc_date": "2014-01-03T03:19:54.000Z", "warc_filename": "<urn:uuid:ce5400bf-2999-41a1-a6e5-1708c58d9358>", "warc_url": "http://www.grandtheftwiki.com/Cheat_Codes" }	cccc_CC-MAIN-2013-48	Cheats From Grand Theft Wiki (Redirected from Cheat Codes) Jump to: navigation, search In GTA IV, you enter cheats by numbers being entered on phone Vehicles appear out of thin air and I haven't even been sniffing any glue today! - in-game website description Glitches in the network, dial a number and life will change. - in-game website description There is a wide array of cheats available for the Grand Theft Auto games on most major platforms. Be advised, due to the nature of cheats, they are to be used at your own risk. It is advisable to keep a back-up save game, due to the risk of a cheat code having adverse effects on your save file. Also be aware that some of the cheats are irrevocable: Most of the cheats will be de-activated if you type in the cheat once more, but certain cheats are not de-activated, no matter how many times you type them in. Also, in certain GTA games, using cheats degrade the player's criminal rating.	v0
2024-06-03T18:26:15.484Z	2013-12-06T05:37:46.000Z	6zz6dmcjjeldqcicpaas4sebkq6onvu6	{ "content_type": "application/xhtml+xml", "provenance": "cccc-CC-MAIN-2013-48-0004.json.gz:14530", "uncompressed_offset": 371585855, "url": "www.hindawi.com/journals/aaa/2012/269701/ref/", "warc_date": "2014-01-03T03:19:54.000Z", "warc_filename": "<urn:uuid:ce5400bf-2999-41a1-a6e5-1708c58d9358>", "warc_url": "http://www.hindawi.com/journals/aaa/2012/269701/ref/" }	cccc_CC-MAIN-2013-48	About this Journal Submit a Manuscript Table of Contents Abstract and Applied Analysis Volume 2012 (2012), Article ID 269701, 10 pages http://dx.doi.org/10.1155/2012/269701 Research Article Probabilistic (Quasi)metric Versions for a Stability Result of Baker Department of Mathematics, West University of Timişoara, 4 V. Pârvan Boulevard, 300223 Timişoara, Romania Received 8 June 2012; Revised 15 October 2012; Accepted 18 October 2012 Academic Editor: Bing Xu Copyright © 2012 Dorel Miheţ and Claudia Zaharia. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Linked References 1. J. A. Baker, “The stability of certain functional equations,” Proceedings of the American Mathematical Society, vol. 112, no. 3, pp. 729–732, 1991. View at Publisher · View at Google Scholar · View at Zentralblatt MATH 2. V. Radu, “The fixed point alternative and the stability of functional equations,” Fixed Point Theory, vol. 4, no. 1, pp. 91–96, 2003. View at Zentralblatt MATH 3. L. Cădariu and V. Radu, “Fixed points and the stability of Jensen's functional equation,” Journal of Inequalities in Pure and Applied Mathematics, vol. 4, no. 1, 7 pages, 2003. View at Zentralblatt MATH 4. D. Miheţ and V. Radu, “On the stability of the additive Cauchy functional equation in random normed spaces,” Journal of Mathematical Analysis and Applications, vol. 343, no. 1, pp. 567–572, 2008. View at Publisher · View at Google Scholar · View at Zentralblatt MATH 5. D. Miheţ, “The fixed point method for fuzzy stability of the Jensen functional equation,” Fuzzy Sets and Systems, vol. 160, no. 11, pp. 1663–1667, 2009. View at Publisher · View at Google Scholar · View at Zentralblatt MATH 6. A. K. Mirmostafaee, “A fixed point approach to almost quartic mappings in quasi fuzzy normed spaces,” Fuzzy Sets and Systems, vol. 160, no. 11, pp. 1653–1662, 2009. View at Publisher · View at Google Scholar · View at Zentralblatt MATH 7. D. Miheţ, “The probabilistic stability for a functional nonlinear equation in a single variable,” Journal of Mathematical Inequalities, vol. 3, no. 3, pp. 475–483, 2009. View at Publisher · View at Google Scholar · View at Zentralblatt MATH 8. M. E. Gordji and H. Khodaei, “The fixed point method for fuzzy approximation of a functional equation associated with inner product spaces,” Discrete Dynamics in Nature and Society, vol. 2010, Article ID 140767, 15 pages, 2010. View at Publisher · View at Google Scholar · View at Zentralblatt MATH 9. H. A. Kenary and Y. J. Cho, “Stability of mixed additive-quadratic Jensen type functional equation in various spaces,” Computers & Mathematics with Applications, vol. 61, no. 9, pp. 2704–2724, 2011. View at Publisher · View at Google Scholar · View at Zentralblatt MATH 10. C. Park, J. R. Lee, and D. Y. Shin, “Generalized Ulam-Hyers stability of random homomorphisms in random normed algebras associated with the Cauchy functional equation,” Applied Mathematics Letters, vol. 25, no. 2, pp. 200–205, 2012. View at Publisher · View at Google Scholar · View at Zentralblatt MATH 11. A. Ebadian, M. Eshaghi Gordji, H. Khodaei, R. Saadati, and Gh. Sadeghi, “On the stability of an m-variables functional equation in random normed spaces via fixed point method,” Discrete Dynamics in Nature and Society, vol. 2012, Article ID 346561, 13 pages, 2012. View at Publisher · View at Google Scholar 12. B. Schweizer and A. Sklar, Probabilistic Metric Spaces, North-Holland Series in Probability and Applied Mathematics, North-Holland Publishing, New York, 1983. 13. O. Hadžić, “On the (ε,λ)-topology of probabilistic locally convex spaces,” Glasnik Matematički III, vol. 13, no. 33, pp. 293–297, 1978. 14. O. Hadžić and M. Budincevic, “A fixed point theorem in PM spaces,” Colloquia Mathematica Societatis Janos Bolyai, vol. 23, pp. 569–579, 1978. 15. V. Radu, “On the t-norms of the Hadžić type and fixed points in probabilistic metric spaces,” Review of Research, vol. 13, pp. 81–85, 1983. 16. V. M. Sehgal and A. T. Bharucha-Reid, “Fixed points of contraction mappings on probabilistic metric spaces,” Mathematical Systems Theory, vol. 6, pp. 97–102, 1972. View at Zentralblatt MATH 17. O. Hadžić and E. Pap, Fixed Point Theory in Probabilistic Metric Spaces, Kluwer Academic Publishers, Dordrecht, The Netherlands, 2001. 18. D. Miheţ, “The probabilistic stability for a functional equation in a single variable,” Acta Mathematica Hungarica, vol. 123, no. 3, pp. 249–256, 2009. View at Publisher · View at Google Scholar · View at Zentralblatt MATH 19. Y. J. Cho, M. Grabiec, and V. Radu, On Nonsymmetric Topological and Probabilistic Structures, Nova Science Publishers, New York, NY, USA, 2006. 20. D. Miheţ, “A note on a fixed point theorem in Menger probabilistic quasi-metric spaces,” Chaos, Solitons and Fractals, vol. 40, no. 5, pp. 2349–2352, 2009. View at Publisher · View at Google Scholar · View at Zentralblatt MATH	v0
2024-06-03T18:26:15.484Z	2013-12-06T05:41:12.000Z	zb7in2ao7jozh2ziu6drzamgk2ifitwt	{ "content_type": "application/xhtml+xml", "provenance": "cccc-CC-MAIN-2013-48-0004.json.gz:14531", "uncompressed_offset": 371595360, "url": "www.hindawi.com/journals/cdi/2013/724592/", "warc_date": "2014-01-03T03:19:54.000Z", "warc_filename": "<urn:uuid:ce5400bf-2999-41a1-a6e5-1708c58d9358>", "warc_url": "http://www.hindawi.com/journals/cdi/2013/724592/" }	cccc_CC-MAIN-2013-48	About this Journal Submit a Manuscript Table of Contents Clinical and Developmental Immunology Volume 2013 (2013), Article ID 724592, 8 pages http://dx.doi.org/10.1155/2013/724592 Research Article Detection of Antiphosphatidylserine/Prothrombin Antibodies and Their Potential Diagnostic Value 1Immunology Laboratory, Department of Rheumatology, University Medical Centre, 1000 Ljubljana, Slovenia 2Faculty of Mathematics, Natural Science and Information Technology, University of Primorska, 6000 Koper, Slovenia 3Faculty of Pharmacy, University of Ljubljana, 1000 Ljubljana, Slovenia Received 30 April 2013; Accepted 15 July 2013 Academic Editor: Guixiu Shi Copyright © 2013 Polona Žigon et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Abstract Antiprothrombin antibodies, measured with phosphatidylserine/prothrombin complex (aPS/PT) ELISA, have been reported to be associated with antiphospholipid syndrome (APS). They are currently being evaluated as a potential classification criterion for this autoimmune disease, characterized by thromboses and obstetric complications. Given the present lack of clinically useful tests for the accurate diagnosis of APS, we aimed to evaluate in-house and commercial assays for determination of aPS/PT as a potential serological marker for APS. We screened 156 patients with systemic autoimmune diseases for antibodies against PS/PT, β2-glycoprotein I, cardiolipin and for lupus anticoagulant activity. We demonstrated a high degree of concordance between the concentrations of aPS/PT measured with the in-house and commercial assays. Both assays performed comparably relating to the clinical manifestations of APS, such as arterial and venous thromboses and obstetric complications. IgG aPS/PT represented the strongest independent risk factor for the presence of obstetric complications, among all tested aPL. Both IgG and IgM aPS/PT were associated with venous thrombosis, but not with arterial thrombosis. Most importantly, the association between the presence of IgG/IgM aPS/PT and lupus anticoagulant activity was highly significant. Taken together, aPS/PT antibodies detected with the in-house or commercial ELISA represent a promising serological marker for APS and its subsets. 1. Introduction Antiphospholipid syndrome (APS) is an autoimmune disease identified by clinical manifestations of vascular thromboses and obstetric complications, together with the serology of persistently positive antiphospholipid antibodies (aPL) [1, 2]. aPL represent a heterogeneous group of immunoglobulins detected by coagulation tests, such as lupus anticoagulant activity (LA) or measured by an enzyme-linked immunosorbent assays (ELISAs) as anticardiolipin antibodies (aCL) or antibodies against β2-glycoprotein I (anti-β2GPI). Antiprothrombin antibodies have not yet been included in the classification criteria of APS, although they are emerging as an increasingly important supportive marker. In recent years, their association with APS was evaluated with contradictory outcomes. Some studies failed to reveal a significant association of antiprothrombin antibodies with manifestations of APS [36], yet in other studies, their correlation to APS was found. The possibility of antiprothrombin antibodies becoming an additional serological classification criterion for APS emerged, especially relevant in APS patients negative for classical aPL [710]. Antibodies recognizing prothrombin can be detected by ELISA targeting prothrombin alone, coated onto irradiated plates (aPT), or targeting the phosphatidylserine/prothrombin complex (aPS/PT). It was demonstrated that antibodies recognized prothrombin more efficiently in aPS/PT ELISA [11] and that aPS/PT correlated better with APS and LA activity [7, 8, 12, 13] as compared to aPT. The inclusion of aPS/PT, but not aPT, to the laboratory criteria for APS has been proposed [14]. The first published aPS/PT protocol [7] was later modified in our previous study [10] in order to increase the analytical sensitivity of the test. We have reported that our in-house aPS/PT ELISA was the most optimal method for the determination of all clinically relevant aPS/PT antibodies, exhibiting the highest percentage of LA activity, compared to aCL and anti-β2GPI [10, 15]. We reported different avidity of antiprothrombin antibodies, as it is also known for several other autoimmune antibodies [1618]. Moreover, we showed that the avidity was associated with their detection by different ELISAs. Until recently, only some aPT commercial kits were available and they showed poor diagnostic sensitivity and specificity [6]. In 2010, the commercial QUANTA Lite aPS/PT IgG/IgM and LAC assays became available as an aid in the diagnosis of APS. The lack of comparative analytical data between the various aPS/PT assays led the present investigation to compare our in-house aPS/PT ELISA with the commercial QUANTA Lite aPS/PT assay, in terms of diagnostic efficiency of aPS/PT. We aimed to determine whether the presence of aPS/PT antibodies was associated with specific clinical manifestation of APS and whether they could therefore become an additional serological marker of APS diagnosis. Additionally, our goal was to compare commercial kits enabling the detection of low avidity antiprothrombin antibodies, as was previously shown for our in-house aPS/PT ELISA [10]. 2. Materials and Methods 2.1. Subjects Sera from 156 of patients with systemic autoimmune diseases (34 males and 122 females, mean age 47 years, range 16–85) were analyzed in a cross-sectional study. APS, based on the revised International Consensus criteria [1], was diagnosed in 58 patients, APS associated with systemic lupus erythematosus (SLE) [19] in 38 patients. The control groups of patients were comprised of 24 patients with SLE, 25 patients with rheumatoid arthritis (RA) [20], and 11 Sjögren’s syndrome patients (SS) [21]. Among all, 42 patients experienced an arterial event, 53 had a venous event, and 28 had obstetric complications (Table 1). The patients had their sera collected and analyzed when they were examined at the Department of Rheumatology (University Medical Centre, Ljubljana). This study was conducted as part of the National Research Program titled “Systemic Autoimmune Diseases” (number P3-0314). Participants signed an informed consent and the study was approved by the National Medical Ethics Committee, Ljubljana, Slovenia. Table 1: Prevalence of arterial thrombosis, venous thrombosis, and obstetric complications in the groups of selected autoimmune patients. 2.2. In-House aPS/PT ELISA The levels of aPS/PT were detected according to the previously described aPS/PT ELISA protocol [10]. Medium binding plates (Costar, Cambridge, USA) were coated with phosphatidylserine in chloroform/methanol 1 : 4 and dried overnight at 4°C. Following blocking with Tris-buffered saline (TBS) containing 1% bovine serum albumin (BSA) and 5 mM CaCl2 (1% BSA/TBS-Ca), 25 μL of human prothrombin (Enzyme Research Laboratories, Ltd., Swansea, UK) (20 mg/L) and 25 μL of patients’ sera diluted 1 : 50 were applied to wells immediately one after the other and incubated for 1 h at room temperature. After that, alkaline phosphatase-conjugated goat anti-human IgG or IgM (ACSC, Westbury, USA) were applied in TBS/Tween (0.05% Tween) and incubated for 30 min. Following 4 washes in TBS/Tween, 100 μL/well of para-nitrophenylphosphate (Sigma Chemical Company, St. Louis, USA) in diethanolamine buffer (pH 9.8) was applied and OD405 was kinetically measured by a spectrometer (Tecan Sunrise Remote, Grödig, Austria). 2.3. INOVA QUANTA Lite aPS/PT ELISA A semiquantitative ELISA for the individual detection of IgG and IgM aPS/PT was performed following the manufacturer’s instruction (INOVA Diagnostics, CA, USA). 2.4. INOVA QUANTA Lite LAC ELISA A semiquantitative ELISA for the detection of both IgG and IgM aPS/PT class antibodies was performed following the manufacturer’s instructions (INOVA Diagnostics, CA, USA). 2.5. aCL ELISA and Anti-β2GPI ELISA IgG and IgM aCL were determined according to the previously described method [22, 23]. Anti-β2GPI were measured with our in-house ELISA [24] and evaluated through the European forum for aPL [25]. 2.6. Avidity Determination of IgG aPS/PT by Chaotropic aPS/PT ELISA The chaotropic aPS/PT ELISA with increased concentrations of NaCl during the antibody binding phase was used for avidity determination [10, 15]. The presence of high avidity aPS/PT antibodies was identified when the binding of antibodies at 0.5 M NaCl remained higher than 70% of the initial binding at 0.136 M NaCl. Low avidity aPS/PT antibodies were declared when the binding decreased ≤30% of the initial binding. The remaining samples were considered to be of heterogeneous avidity. 2.7. Lupus Anticoagulant The assay was performed in blood samples collected in tubes containing 0.109 M sodium citrate. Platelet-poor plasma was obtained by centrifugation at 2400 g for 20 min at 4°C. After filtration, aliquots were stored at −80°C until use. Clotting tests were performed using coagulation analyzer BCS Siemens according to the previous guidelines of the International Society on Thrombosis and Haemostasis ISTH [26]. Simplified Dilute Russell’s Viper Venom Test (dRVVT) was performed using LA1 Screening reagent and LA2 Confirmatory reagent (Siemens) following the manufacturer’s instructions [27]. A dRVVT ratio (LA1 screen/LA2 confirmation) above 1.2 was considered positive for LA activity. Activity of LA was quantified as follows: low positive (LA1/LA2 1.2–1.5), medium (LA1/LA2 1.5–2.0), and high positive (LA1/LA2 2.0). 2.8. Statistical Analysis Statistical analysis was performed using the SPSS 15.0 program. Normal distribution was evaluated using descriptive statistic parameters, curve fittings, and Kolmogorov-Smirnov test. The Receiver Operating Characteristic (ROC) analysis and the area under the curve (AUC) were used to assess the diagnostic performance of the measured marker(s). The results of multivariate logistic models were approximated by odds ratio with its 95% confidence interval (OR (95%)). A 2-sided value 0.05 was considered statistically significant. 3. Results 3.1. Correlation between In-House and QUANTA Lite aPS/PT Assays Both IgG and IgM aPS/PT antibodies detected with in-house ELISA correlated significantly with results of QUANTA Lite immunoassays using Spearman correlation (rho 0.744 for IgG; rho 0.865 for IgM) (Figures 1(a) and 1(b)) in 156 patient sera. Substantial concordance was validated also with Lin’s concordance correlation coefficient (Rc 0.625 for IgG and Rc 0.572 for IgM), which is a reproducibility measure. Figure 1: aPS/PT antibodies detected with the in-house ELISA correlated significantly with results of QUANTA Lite IgG (a) and IgM (b) in 156 patient sera. The dashed lines represent the cut-off value (in-house ELISA 5 AU, QUANTA Lite 30 U/mL). AU: arbitrary units. 3.2. Diagnostic Applicability Comparison of Different Antiphospholipid Antibody Assays We evaluated APS diagnostic applicability of all assays with a receiver operating characteristic curve (ROC curve) and estimated the area under the curve (Figure 2). The highest diagnostic efficiency for APS was achieved by aCL IgG (AUC 0.88) (Figure 2(a)). Both, the in-house and the QUANTA Lite, IgG aPS/PT methods were comparable (0.73 and 0.72, resp.). All methods detecting IgM aPL (Figure 2(b)) showed a lower overall performance compared to IgG aCL. Figure 2: Receiver Operating Characteristic (ROC) curves and area under the curve (AUC) of different antiphospholipid antibody methods for APS (). The higher values of AUC indicate better diagnostic efficiency of the test. aCL: anticardiolipin, anti-β2GPI: anti-β2glycoprotein, and aPS/PT antiphosphatidylserine/prothrombin. 3.3. Relationship of aPL with Thrombosis and Obstetric Manifestations The positivity of an individual aPL test and clinical manifestations of APS were considered in a logistic regression analysis (Table 2). IgG and IgM aPS/PT measured with the in-house and QUANTA Lite ELISA presented the highest independent risk factor for obstetric complication, among all tested aPL (OR 9.3 and OR 6.3, resp., for IgG and IgM). Both IgG and IgM aPS/PT measured with either assay were an independent risk factor for the presence of venous thrombosis. However, the highest risk for venous thrombosis was achieved by LA (OR = 5.6). IgG aPS/PT measured with QUANTA Lite ELISA were also an independent risk factor for the presence of arterial thrombosis, but the association was rather weak (OR 2.3, ). Table 2: Antiphospholipid antibodies and LA in a relationship to arterial thrombosis (AT), venous thrombosis (VT), and obstetric complications (OC). The QUANTA Lite LAC screen test detected all sera positive in the individual IgG or IgM aPS/PT assays. The LAC screen did not achieve the diagnostic efficiency of the established LA coagulation test (Table 2). 3.4. Relationship between LA and aCL, Anti-β2GPI, or aPS/PT Antibodies Out of 156 patients included in the study, 16 (10%) did not have their LA activity determined due to their anticoagulant treatment. Seven patients (3 APS, 3 RA, and 1 SS) were solely positive for LA, three of them had low, and four medium LA activity. Among all the aCL positive patients, 51% had LA; among the anti-β2GPI positive patients, 55% had LA, while among the aPS/PT positive patients, 66% had LA activity. aPS/PT, measured with either in-house or commercial assay, were much higher independent risk factors for the presence of LA activity (OR 15.3 for IgG and OR 12.9 for IgM) as compared to either aCL or anti-β2GPI (OR 9.0 for IgG and OR 4.6 for IgM, resp.) (Table 3). Table 3: Association between the presence of antiphospholipid antibodies and LA activity. 3.5. Avidity of aPS/PT Avidity of IgG aPS/PT was determined using a chaotropic IgG aPS/PT ELISA in aPS/PT positive patients detected by the in-house IgG aPS/PT ELISA, regardless of the antibody level. Antibodies were detected of predominantly low, heterogeneous, and predominantly high avidity (, 33, 9 out of 51, resp.). Both the QUANTA Lite IgG aPS/PT ELISA and LAC screen assays detected more than 40% of sera with low avidity antibodies and more than 85% of those with heterogeneous or high avidity aPS/PT (Table 4). Table 4: Association of aPS/PT avidity with clinical features of autoimmune patients. Among nine patients with low avidity aPS/PT, seven were diagnosed with APS; three of which experienced arterial thrombosis, five venous thrombosis, and one had obstetric complications. Two out of 97 APS patients included in the study were positive in the QUANTA Lite IgG aPS/PT ELISA, but negative in the in-house aPS/PT ELISA and their avidity was not determined. 4. Discussion A comprehensive comparative study of anti-prothrombin antibodies (on two in-house and three commercial aPT tests) conducted in 2007 by Tincani et al. reported issues with reproducibility and interpretation of results and advised against their routine use [6]. Antibodies against PS/PT were first described by Matsuda et al. in patients with LA in 1996 [28], while one year later, Galli et al. [11] reported that the aPS/PT assay was more sensitive than the aPT test. In 2000, Atsumi et al. pointed out that aPS/PT can be used not only to confirm the presence of LA, but also to serve (in addition to aCL and anti-β2GPI) as one of the markers of APS and also thrombotic events in patients with autoimmune diseases [7]. Since 2000, aPS/PT antibody detection stood the test of time and was proven as a useful tool for the diagnosis of APS [29]. Comparative studies gave additional indication of their diagnostic relevance and confirmed their closer correlation with APS and LA activity as compared to aPT [7, 8, 13, 30]. The protocol by Matsuda et al. [12] used a higher concentration of phosphatidylserine (65 μg/mL) and prothrombin (20 μg/mL), while the protocols by Atsumi et al. [7], Tincani et al. [6], and Žigon et al. [10] all used lower concentrations of phosphatidylserine (50 μg/mL) and prothrombin (10 μg/mL). Additional major modifications between Matsuda et al. and later protocols are different times and temperatures of phosphatidylserine and prothrombin incubation. Recently, we have reported that our modified in-house aPS/PT ELISA (with increased analytical sensitivity) detects both presumably different populations of antibodies and low avidity antibodies, as well as it enables the identification of patients negative for other anti-phospholipid antibodies [10]. The modification (by means of the concomitant antigen and antibody incubation) resulted in increased prothrombin concentration on phospholipid surface and possible exposure of additional epitopes on prothrombin, enabling a higher intensity of antiprothrombin antibody binding. The current report shows that aPS/PT antibodies were the strongest independent risk factor for obstetric complications in our population of patients. Two previous studies on females with obstetric disorders found that aPS/PT antibodies were not frequent in patients with unexplained recurrent miscarriages without APS [5, 31]. However, in a recent study, comprising 163 women negative for the classical repertoire of aPL, antiprothrombin antibodies appeared to be associated with previous adverse pregnancy outcome [32]; however, the author did not support the potential use of these antibodies in clinical practice. In our study, among 28 female patients (26 were diagnosed with APS), IgG aPS/PT antibodies (measured by either in-house or commercial assay) showed the strongest correlation with obstetric complications, among all aPL antibodies. Further studies are warranted on a larger population of obstetric patients. Taking into account the logistic regression results, IgG/IgM aPS/PT were also independent risk factors for the presence of venous thrombosis (OR 3.5 and OR 2.2, resp.). The highest OR for venous thrombosis is presented by LA (OR 5.6), while all of the measured aPL showed statistically significantly correlation. On the other hand, aPS/PT antibodies were not strong independent risk factor for arterial thrombosis. Similarly, Vlagea et al. found no association between the presence of aPS/PT and arterial thrombosis [33]. Two previous studies [7, 8] have shown anti-prothrombin antibodies as an independent risk factor for arterial thrombosis, but other reports [6, 9, 34] presented their data without differentiating between arterial or venous thromboembolic events. In general, all IgM antibody subtypes of aPL demonstrated a lower diagnostic efficiency for thrombosis as compared to IgG aPL. These data are in line with the results of a systematic review [35] and a later study [36] which reported IgM aCL, anti-β2GPI, and anti-prothrombin antibodies to be less often associated with clinical events of APS than IgG. Correlation between aPS/PT and LA activity has been reported previously [7, 13, 33, 37] and our current study confirmed a strong correlation between aPS/PT and LA activity. IgG/IgM aPS/PT were the highest independent risk factors for LA activity with an OR 12.9 as compared to aCL and anti-β2GPI with an OR 9.0. Despite internationally accepted guidelines and many efforts to improve the standardization of LA activity assays, accurate detection and intralaboratory reproducibility are still not fully achieved. LA determination is a sequential series of analyses, which requires careful treatment of plasma specimens obtained from patients who are not receiving any anticoagulant therapy. So, the aPS/PT assay could represent a solid additional test performed using sera samples of patients regardless of anticoagulant therapy. Very few studies have reported on the avidity of anti-prothrombin antibodies. Avidity was shown to importantly influence positivity in different antiprothrombin ELISAs given that none of the low avidity antibodies were positive in the aPT ELISA [15]. On the contrary, aPS/PT assay enables the detection of low avidity antibodies, as evidenced in the current report. Our in-house IgG aPS/PT detected 9 positive patients with low avidity; however, QUANTA Lite IgG aPS/PT assay detected only 40% of low avidity anti-prothrombin antibodies. (Table 4). Our group has previously shown that avidity of anti-β2GPI importantly correlated with the clinical onset; therefore, it appeared reasonable to assume the same for the avidity of antiprothrombin antibodies [16]. However, we could not draw the same conclusion, but found that out of nine patients with low avidity aPS/PT antibodies, seven had APS. Therefore, a method enabling the detection of low avidity aPS/PT is also essential for possible inclusion of aPS/PT in the classification criteria for APS. In conclusion, the present study is in line with the recommendations advising confirmation of previous data for “noncriteria aPL,” such as aPS/PT [38]. The only commercially available aPS/PT assay was evaluated in comparison to our in-house aPS/PT. aPS/PT detected with either in-house aPS/PT ELISA or with QUANTA Lite aPS/PT ELISA showed very high specificity for APS that could serve as an additional serological diagnostic marker for venous thrombosis and obstetric complications. The association of aPS/PT with LA activity was the highest among all aPL tested and therefore can be a useful feature of these antibodies. In summary, aPS/PT, measured with either in-house or commercial assay, in addition to aCL and anti-β2GPI antibodies, could represent an additional marker in patients with clinical manifestations of APS. Abbreviations Anti-β2GPI: Antibodies against -glycoprotein I aCL: Anti-cardiolipin antibodies APS: Antiphospholipid syndrome aPS/PT: Phosphatidylserine-dependent anti-prothrombin antibodies aPT: Antibodies against prothrombin alone AUC: Area under the curve CI: Confidence interval, LA: Lupus anticoagulant OR: Odds ratio PS: Phosphatidylserine RA: Rheumatoid arthritis ROC: Receiver operating characteristic SLE: Systemic lupus erythematosus SS: Sjögren’s syndrome. Conflict of Interests The authors state that there is no conflict of interests. Acknowledgments This work was supported by the Ministry of High Education, Science and Technology of Slovenia (National Research Program number P3-0314). The authors thank INOVA Diagnostics Inc., San Diego, USA, as well as their German and Slovenian distributors for kindly providing their products. References 1. S. Miyakis, M. D. Lockshin, T. Atsumi et al., “International consensus statement on an update of the classification criteria for definite antiphospholipid syndrome (APS),” Journal of Thrombosis and Haemostasis, vol. 4, no. 2, pp. 295–306, 2006. View at Publisher · View at Google Scholar · View at Scopus 2. W. A. Wilson, A. E. Gharavi, T. Koike Lockshin MD et al., “International consensus statement on preliminary classification criteria for definite antiphospholipid syndrome: report of an international workshop,” Arthritis & Rheumatism, vol. 42, no. 7, pp. 1309–1311, 1999. 3. N. Bardin, M. C. Alessi, F. Dignat-George et al., “Does the anti-prothrombin antibodies measurement provide additional information in patients with thrombosis?” Immunobiology, vol. 212, no. 7, pp. 557–565, 2007. View at Publisher · View at Google Scholar · View at Scopus 4. M. Galli, “Anti-prothrombin antibodies,” in The Antiphospholipid Syndrome II, R. A. Asherson, R. Cervera, J. C. Piette, and Y. Shoenfeld, Eds., pp. 59–70, Elsevier, New York, NY, USA, 2002. 5. M. Sugiura-Ogasawara, T. Atsumi, Y. Ozaki, T. Koike, and K. Suzumori, “Phosphatidylserine-dependent antiprothrombin antibodies are not useful markers for high-risk women with recurrent miscarriages,” Fertility and Sterility, vol. 82, no. 5, pp. 1440–1442, 2004. View at Publisher · View at Google Scholar · View at Scopus 6. A. Tincani, G. Morozzi, A. Afeltra et al., “Antiprothrombin antibodies: a comparative analysis of homemade and commercial methods. A collaborative study by the Forum Interdisciplinare per la Ricerca nelle Malattie Autoimmuni (FIRMA),” Clinical and Experimental Rheumatology, vol. 25, no. 2, pp. 268–274, 2007. View at Scopus 7. T. Atsumi, M. Ieko, M. L. Bertolaccini et al., “Association of autoantibodies against the phosphatidylserine-prothrombin complex with manifestations of the antiphospholipid syndrome and with the presence of lupus anticoagulant,” Arthritis & Rheumatism, vol. 43, no. 9, pp. 1982–1993, 2000. 8. M. L. Bertolaccini, T. Atsumi, T. Koike, G. R. V. Hughes, and M. A. Khamashta, “Antiprothrombin antibodies detected in two different assay systems. Prevalence and clinical significance in systemic lupus erythematosus,” Thrombosis and Haemostasis, vol. 93, no. 2, pp. 289–297, 2005. View at Publisher · View at Google Scholar · View at Scopus 9. A. Ghirardello, N. Bizzaro, S. Zampieri et al., “Biological and clinical relevance of anti-prothrombin antibodies,” Annals of the New York Academy of Sciences, vol. 1109, pp. 503–510, 2007. View at Publisher · View at Google Scholar · View at Scopus 10. P. Žigon, A. Ambrožič, S. Čučnik, T. Kveder, B. Rozman, and B. Božič, “Modified phosphatidylserine-dependent antithrombin ELISA enables identification of patients negative for other antiphospholipid antibodies and also detects low avidity antibodies,” Clinical Chemistry and Laboratory Medicine, vol. 49, no. 6, pp. 1011–1018, 2011. View at Publisher · View at Google Scholar · View at Scopus 11. M. Galli, G. Beretta, M. Daldossi, E. M. Bevers, and T. Barbui, “Different anticoagulant and immunological properties of anti-prothrombin antibodies in patients with antiphospholipid antibodies,” Thrombosis and Haemostasis, vol. 77, no. 3, pp. 486–491, 1997. View at Scopus 12. J. Matsuda, T. Sanaka, A. Nishizawa, M. Gotoh, and K. Gohchi, “Two antiprothrombin antibodies against prothrombin and prothrombin-phosphatidyl serine show partial but not total identity,” Blood Coagulation and Fibrinolysis, vol. 13, no. 8, pp. 697–702, 2002. View at Publisher · View at Google Scholar · View at Scopus 13. J. Nojima, Y. Iwatani, E. Suehisa, H. Kuratsune, and Y. Kanakura, “The presence of anti-phosphatidylserine/prothrombin antibodies as risk factor for both arterial and venous thrombosis in patients with systemic lupus erythematosus,” Haematologica, vol. 91, no. 5, pp. 699–702, 2006. View at Scopus 14. T. Atsumi and T. Koike, “Antiprothrombin antibody: why do we need more assays?” Lupus, vol. 19, no. 4, pp. 436–439, 2010. View at Publisher · View at Google Scholar · View at Scopus 15. P. Žigon, S. Čučnik, A. Ambrožič, S. S. Šemrl, T. Kveder, and B. Božič, “Antibodies to phosphatidylserine/prothrombin complex as an additional diagnostic marker of APS?” Lupus, vol. 21, no. 7, pp. 790–792, 2012. 16. S. Čučnik, T. Kveder, I. Križaj, B. Rozman, and B. Božič, “High avidity anti-β2-glycoprotein I antibodies in patients with antiphospholipid syndrome,” Annals of the Rheumatic Diseases, vol. 63, no. 11, pp. 1478–1482, 2004. View at Publisher · View at Google Scholar · View at Scopus 17. W. Lin, M. Chen, and M.-H. Zhao, “Follow-up of avidity and titer of anti-myeloperoxidase antibodies in sera from patients with primary ANCA-associated vasculitis,” Autoimmunity, vol. 42, no. 3, pp. 198–202, 2009. View at Publisher · View at Google Scholar · View at Scopus 18. P. Suwannalai, H. U. Scherer, D. Van Der Woude et al., “Anti-citrullinated protein antibodies have a low avidity compared with antibodies against recall antigens,” Annals of the Rheumatic Diseases, vol. 70, no. 2, pp. 373–379, 2011. View at Publisher · View at Google Scholar · View at Scopus 19. M. C. Hochberg, “Updating the American College of Rheumatology revised criteria for the classification of systemic lupus erythematosus,” Arthritis & Rheumatism, vol. 40, no. 9, article 1725, 1997. View at Scopus 20. F. C. Arnett, S. M. Edworthy, D. A. Bloch et al., “The American Rheumatism Association 1987 revised criteria for the classification of rheumatoid arthritis,” Arthritis & Rheumatism, vol. 31, no. 3, pp. 315–324, 1988. View at Scopus 21. C. Vitali, S. Bombardieri, R. Jonsson et al., “Classification criteria for Sjögren's syndrome: a revised version of the European criteria proposed by the American-European Consensus Group,” Annals of the Rheumatic Diseases, vol. 61, no. 6, pp. 554–558, 2002. View at Publisher · View at Google Scholar · View at Scopus 22. B. Božič, T. Kveder, M. Stegnar et al., “Influence of degraded phosphatidylserine on binding of antiphospholipid antibodies,” International Archives of Allergy and Immunology, vol. 112, no. 1, pp. 19–26, 1997. View at Scopus 23. S. Loizou, J. D. McCrea, and A. C. Rudge, “Measurement of anti-cardiolipin antibodies by an enzyme-linked immunosorbent assay (ELISA): standardization and quantitation of results,” Clinical and Experimental Immunology, vol. 62, no. 3, pp. 738–745, 1985. View at Scopus 24. S. Čučnik, A. Ambrožič, B. Božič, M. Skitek, and T. Kveder, “Anti-β2-glycoprotein I ELISA: methodology, determination of cut-off values in 434 healthy Caucasians and evaluation of monoclonal antibodies as possible international standards,” Clinical Chemistry and Laboratory Medicine, vol. 38, no. 8, pp. 777–783, 2000. View at Scopus 25. G. Reber, I. Schousboe, A. Tincani et al., “Inter-laboratory variability of anti-β2-glycoprotein I measurement: a Collaborative Study in the Frame of the European Forum on Antiphospholipid Antibodies Standardization Group,” Thrombosis and Haemostasis, vol. 88, no. 1, pp. 66–73, 2002. View at Scopus 26. J. T. Brandt, D. A. Triplett, B. Alving, and I. Scharrer, “Criteria for the diagnosis of lupus anticoagulants: an update. On behalf of the Subcommittee on Lupus Anticoagulant/Antiphospholipid Antibody of the Scientific and Standardisation Committee of the ISTH,” Thrombosis and Haemostasis, vol. 74, no. 4, pp. 1185–1190, 1995. View at Scopus 27. T. Exner, G. Papadopoulos, and J. Koutts, “Use of a simplified dilute Russell's viper venom time (DRVVT) confirms heterogeneity among 'lupus anticoagulants',” Blood Coagulation. Fibrinolysis, vol. 1, no. 3, pp. 259–266, 1990. View at Scopus 28. J. Matsuda, N. Saitoh, M. Gotoh, K. Kawasugi, K. Gohchi, and M. Tsukamoto, “Phosphatidyl serine-dependent antiprothrombin antibody is exclusive to patients with lupus anticoagulant,” British Journal of Rheumatology, vol. 35, no. 6, pp. 589–591, 1996. View at Scopus 29. T. Atsumi, O. Amengual, S. Yasuda, and T. Koike, “Antiprothrombin antibodies—are they worth assaying?” Thrombosis Research, vol. 114, no. 5-6, pp. 533–538, 2004. View at Publisher · View at Google Scholar · View at Scopus 30. A. Tsutsumi, T. Hayashi, Y. Chino et al., “Significance of antiprothrombin antibodies in patients with systemic lupus erythematosus: clinical evaluation of the antiprothrombin assay and the antiphosphatidylserine/prothrombin assay, and comparison with other antiphospholipid antibody assays,” Modern Rheumatology, vol. 16, no. 3, pp. 158–164, 2006. View at Publisher · View at Google Scholar · View at Scopus 31. A. Tsutsumi, T. Atsumi, H. Yamada et al., “Anti-phosphatidylserine/prothrombin antibodies are not frequently found in patients with unexplained recurrent miscarriages,” American Journal of Reproductive Immunology, vol. 46, no. 3, pp. 242–244, 2001. View at Scopus 32. L. Marozio, A. Curti, G. Botta et al., “Anti-prothrombin antibodies are associated with adverse pregnancy outcome,” American Journal of Reproductive Immunology, vol. 66, no. 5, pp. 404–409, 2011. View at Publisher · View at Google Scholar · View at Scopus 33. A. Vlagea, A. Gil, M. V. Cuesta et al., “Antiphosphatidylserine/Prothrombin antibodies (aPS/PT) as potential markers of antiphospholipid syndrome,” Clinical and Applied Thrombosis/Hemostasis, vol. 19, no. 3, pp. 289–296, 2012. View at Publisher · View at Google Scholar 34. T. D. Jaskowski, A. R. Wilson, H. R. Hill, W. D. Branch, and A. E. Tebo, “Autoantibodies against phosphatidylserine, prothrombin and phosphatidylserine-prothrombin complex: identical or distinct diagnostic tools for antiphospholipid syndrome?” Clinica Chimica Acta, vol. 410, no. 1-2, pp. 19–24, 2009. View at Publisher · View at Google Scholar · View at Scopus 35. M. Galli, D. Luciani, G. Bertolini, and T. Barbui, “Anti-β2-glycoprotein I, antiprothrombin antibodies, and the risk of thrombosis in the antiphospholipid syndrome,” Blood, vol. 102, no. 8, pp. 2717–2723, 2003. View at Publisher · View at Google Scholar · View at Scopus 36. M. Galli, G. Borrelli, E. M. Jacobsen et al., “Clinical significance of different antiphospholipid antibodies in the WAPS (warfarin in the antiphospholipid syndrome) study,” Blood, vol. 110, no. 4, pp. 1178–1183, 2007. View at Publisher · View at Google Scholar · View at Scopus 37. Y. Sakai, T. Atsumi, M. Ieko et al., “The effects of phosphatidylserine-dependent antiprothrombin antibody on thrombin generation,” Arthritis and Rheumatism, vol. 60, no. 8, pp. 2457–2467, 2009. View at Publisher · View at Google Scholar · View at Scopus 38. M. L. Bertolaccini, O. Amengual, T. Atsumi et al., “‘Non-criteria’ aPL tests: report of a task force and preconference workshop at the 13th International Congress on Antiphospholipid Antibodies, Galveston, TX, USA, April 2010,” Lupus, vol. 20, no. 2, pp. 191–205, 2011. View at Publisher · View at Google Scholar · View at Scopus	v0
2024-06-03T18:26:15.484Z	2013-12-06T05:38:29.000Z	h4cbi54oihjplixx3ciua5zrk3zzwx7l	{ "content_type": "text/html", "provenance": "cccc-CC-MAIN-2013-48-0004.json.gz:14532", "uncompressed_offset": 388235875, "url": "www.intechopen.com/books/water-quality-monitoring-and-assessment", "warc_date": "2014-01-03T03:19:54.000Z", "warc_filename": "<urn:uuid:ce5400bf-2999-41a1-a6e5-1708c58d9358>", "warc_url": "http://www.intechopen.com/books/water-quality-monitoring-and-assessment" }	cccc_CC-MAIN-2013-48	Environmental Sciences Water Quality Monitoring and Assessment Edited by Kostas Voudouris and Dimitra Voutsa, ISBN 978-953-51-0486-5, 602 pages, Publisher: InTech, Chapters published April 05, 2012 under CC BY 3.0 license DOI: 10.5772/2411 The book attempts to covers the main fields of water quality issues presenting case studies in various countries concerning the physicochemical characteristics of surface and groundwaters and possible pollution sources as well as methods and tools for the evaluation of water quality status. This book is divided into two sections: Statistical Analysis of Water Quality Data;Water Quality Monitoring Studies.	v0
2024-06-03T18:26:15.484Z	2013-12-06T05:38:30.000Z	xp7ubaya7csglvn5hs3zxmfnimcrkh6r	{ "content_type": "text/html", "provenance": "cccc-CC-MAIN-2013-48-0004.json.gz:14540", "uncompressed_offset": 418497390, "url": "www.libreoffice.org/download/?lang=pa-IN&type=src&version=3.6.3", "warc_date": "2014-01-03T03:19:54.000Z", "warc_filename": "<urn:uuid:ce5400bf-2999-41a1-a6e5-1708c58d9358>", "warc_url": "http://www.libreoffice.org/download/?type=src&version=3.6.3&lang=pa-IN" }	cccc_CC-MAIN-2013-48	The free office suite Download LibreOffice For commercial support around LibreOffice see our list of certified partners. Selected: LibreOffice Source code, version 3.6.3, Panjabi No regular installation files are available. Please change your selection or pick one from the additional downloads below. If you're looking for old versions, please visit our download archive.	v0
2024-06-03T18:26:15.484Z	2013-12-06T05:38:12.000Z	tn4hp7kxw3twavyebloleuna3ixrqeus	{ "content_type": "text/html", "provenance": "cccc-CC-MAIN-2013-48-0004.json.gz:14544", "uncompressed_offset": 433517317, "url": "www.mdpi.com/1422-0067/14/5/9099", "warc_date": "2014-01-03T03:19:54.000Z", "warc_filename": "<urn:uuid:ce5400bf-2999-41a1-a6e5-1708c58d9358>", "warc_url": "http://www.mdpi.com/1422-0067/14/5/9099" }	cccc_CC-MAIN-2013-48	Int. J. Mol. Sci. 2013, 14(5), 9099-9110; doi:10.3390/ijms14059099 Article Expression Pattern of Small Nucleolar RNA Host Genes and Long Non-Coding RNA in X-rays-Treated Lymphoblastoid Cells Department of Medical Laboratory and Radiation Sciences, University of Vermont, Burlington, VT 05405, USA Received: 5 March 2013; in revised form: 19 April 2013 / Accepted: 22 April 2013 / Published: 25 April 2013 (This article belongs to the Special Issue Radiation Toxicity in Cells) Download PDF Full-Text [368 KB, uploaded 25 April 2013 11:24 CEST] Abstract: A wide variety of biological effects are induced in cells that are exposed to ionizing radiation. The expression changes of coding mRNA and non-coding micro-RNA have been implicated in irradiated cells. The involvement of other classes of non-coding RNAs (ncRNA), such as small nucleolar RNAs (snoRNAs), long ncRNAs (lncRNAs), and PIWI-interacting RNAs (piRNAs) in cells recovering from radiation-induced damage has not been examined. Thus, we investigated whether these ncRNA were undergoing changes in cells exposed to ionizing radiation. The modulation of ncRNAs expression was determined in human TK6 (p53 positive) and WTK1 (p53 negative) cells. The snoRNA host genes SNHG1, SNHG6, and SNHG11 were induced in TK6 cells. In WTK1 cells, SNHG1 was induced but SNHG6, and SNHG11 were repressed. SNHG7 was repressed in TK6 cells and was upregulated in WTK1 cells. The lncRNA MALAT1 and SOX2OT were induced in both TK6 and WTK1 cells and SRA1 was induced in TK6 cells only. Interestingly, the MIAT and PIWIL1 were not expressed in TK6 cells before or after the ionizing radiation treatment. The MIAT and PIWIL1 were upregulated in WTK1 cells. This data provides evidence that altered ncRNA expression is a part of the complex stress response operating in radiation-treated cells and this response depends on functional p53. Keywords: non-coding RNA; TK6 cells; radiation-induced effects Article Statistics Click here to load and display the download statistics. Cite This Article MDPI and ACS Style Chaudhry, M.A. Expression Pattern of Small Nucleolar RNA Host Genes and Long Non-Coding RNA in X-rays-Treated Lymphoblastoid Cells. Int. J. Mol. Sci. 2013, 14, 9099-9110. AMA Style Chaudhry MA. Expression Pattern of Small Nucleolar RNA Host Genes and Long Non-Coding RNA in X-rays-Treated Lymphoblastoid Cells. International Journal of Molecular Sciences. 2013; 14(5):9099-9110. Chicago/Turabian Style Chaudhry, M. A. 2013. "Expression Pattern of Small Nucleolar RNA Host Genes and Long Non-Coding RNA in X-rays-Treated Lymphoblastoid Cells." Int. J. Mol. Sci. 14, no. 5: 9099-9110. Int. J. Mol. Sci. EISSN 1422-0067 Published by MDPI AG, Basel, Switzerland RSS E-Mail Table of Contents Alert	v0
2024-06-03T18:26:15.484Z	2013-12-06T05:38:23.000Z	gzmfsbwsnbfumdnxlyztdhd5bhvc5c22	{ "content_type": "text/html", "provenance": "cccc-CC-MAIN-2013-48-0004.json.gz:14549", "uncompressed_offset": 448641138, "url": "www.musicstreetjournal.com/interviews_display.cfm?id=100467", "warc_date": "2014-01-03T03:19:54.000Z", "warc_filename": "<urn:uuid:ce5400bf-2999-41a1-a6e5-1708c58d9358>", "warc_url": "http://www.musicstreetjournal.com/interviews_display.cfm?id=100467" }	cccc_CC-MAIN-2013-48	Artists \| Issues \| CD Reviews \| Interviews \| Concert Reviews \| DVD/Video Reviews \| Book Reviews \| Who We Are \| Staff \| Home Progressive Rock Interviews Delusion Squared Interviewed by Gary Hill Interview with Delusion Squared from 2010 MSJ: Can you catch the readers up on the history of your involvement in music – both individually and as a band? Lorraine Young: I'm a singer since I can speak and maybe even before. Also I'm playing acoustic guitar. Steve Francis: I've been playing music and composing for many years, from classical piano training to playing guitar and composing for several obscure bands, and also doing some solo work. Emmanuel de Saint Méen: I've got pretty much the same musical history as Steve, only my favorite instrument is the bass. Steve Francis: In 2008, we started playing together with Emmanuel de Saint Méen in a local cover band specializing in power rock and metal, but this was not very satisfactory considering our mutual desire to create some original music. The project was launched in 2009, and we recorded the first demos and discussed the concept and story behind the album. It was soon very clear this was going to be a female fronted project, so we set to look for the perfect vocalist. Several singers got a message from us, including Sharon den Adel from Within Temptation. Fortunately she did not answer it, and we ended up meeting Lorraine Young, who is a young lady completely in love with singing. Her dedication and her magnificent voice play a major role in the album. MSJ: If you weren't involved in music what do you think you'd be doing? Steve Francis: I've dreamed myself a luthier, so I guess I would be crafting custom guitars... only it's still involvement in music. Emmanuel de Saint Méen: Maybe a gardener in a desert... Lorraine Young: I've never thought about that MSJ: How did the name of the group originate? Lorraine Young: There was a brainstorm between the three of us... the name had to somehow be related to the story, it had to appeal to the three of us, and also it had to be uncommon enough that we could easily get some visibility online. We considered more than a hundred names I believe (I've got the list somewhere...) MSJ: Who would you see as your musical influences? Steve Francis: I've been an avid listener and admirer of Steve Lukather, ELO, Mike Oldfield, Pink Floyd, Genesis, Yes, then Steve Morse, Dream Theater, Porcupine Tree, Anathema, O.S.I., Pain of Salvation, Opeth... Lorraine Young: Hayley Williams, Sharon den Adel, Angela Gossow, Porcupine Tree and many others Emmanuel de Saint Méen: Anathema, Pink Floyd, Jeff Beck, Adagio, too many to cite them all actually MSJ: What's ahead for you? Steve Francis: Considering the sci-fi nature of the story behind the album, I think we have no choice but to release two more albums for the trilogy to be complete! Seriously, we are currently talking with some labels, and personally I'm eager to get back to "composition mode,” which is my favorite work, probably thanks to some serendipitous experiences. One such moment was laying down Prof. Stephen Hawking's speech on the intro of "What We Will Be,” the whole piece was instantly in place, and the music took on an intensity that gave us goose bump. MSJ: I know artists hate to have their music pigeonholed or labeled, but how would you describe your music? Steve Francis: storytelling? Emmanuel de Saint Méen: Basically I consider it to be progressive rock, although some fans talk about symphonic rock, well that's okay with me Lorraine Young: Actually, I hate to have our "music pigeonholed or labeled" MSJ: Are there musicians with whom you would like to play with in the future? Emmanuel de Saint Méen: Following Mike Portnoy's recent announcement, we would like to publicly invite him to play on the second album! Steve Francis: Seriously I think the three of us would be thrilled to work with several musicians we admire and respect... Steve Morse, Steven Wilson, Mikael Åkerfeldt, Jim Matheos would be my personal favorites. MSJ: Do you think that illegal downloading of music is a help or hindrance to the careers of musicians? Steve Francis: One thing is for sure, this is much more efficient at delivering music on a global scale. We are still waiting for some digital resellers to list our album... We chose to let things happen online after releasing the album, and today there are more than 90 different direct download sites offering it as "free sound.” Honestly, I like the exposure, but I'm a bit uncomfortable with some of these guys competing with our official websites in search results. I mean, I'd like people looking for Delusion Squared to still be able to find us, not only leeched copies! MSJ: In a related question, how do you feel about fans recording shows and trading them? Lorraine Young: This is great! Emmanuel de Saint Méen: Don't care MSJ: If you were a superhero, what music person would be your arch nemesis and why? Emmanuel de Saint Méen: uh ? Lorraine Young: Some manufactured artists from well-known TV shows... Also Justin Bieber (but can he be considered a superhero?) Steve Francis: Some people I'm uncomfortable with are in Performing Right Societies or in record labels, actively lobbying the governments of several places in the world so that the Internet is heavily filtered. I guess that's the reason for the copyright plot in the album... MSJ: If you were to put together your ultimate band (a band you'd like to hear or catch live), who would be in it and why? Emmanuel de Saint Méen: Mike Portnoy on drums, because he's amazing and also because he's currently free Lorraine Young: Kurt Cobain, one of the most evocative voices I've ever heard Emmanuel de Saint Méen: Jaco Pastorius (he's already playing with Kurt where he is, I'm sure) Steve Francis: Steve Vai, he's an alien and he loves secrets, and also Derek Sherinian on the keyboards MSJ: What was the last CD you bought and/or what have you been listening to lately? Steve Francis: Anathema - We're Here Because We're Here - flawless. Lorraine Young: These days I'm listening to Office of Strategic Influence, and also I really enjoy Old Detroit Radio, I'm in love with their title Eisbrecher Emmanuel de Saint Méen: Touchstone, double live CD Live in the US, with my friend Adam J. Hogdson MSJ: Have you read any good books lately? Steve Francis: Transitions from Iain Banks, although I'm not sure I like it as much as I enjoyed his "Culture" works. Lorraine Young: Montesquieu, Persian Letters Emmanuel de Saint Méen: the last Houellebecq, The Map and the Territory MSJ: What about the last concert you attended for your enjoyment? Steve Francis: I think that was Kamelot in Paris, epic! We were together with de Saint Méen, who was here primarily to see the support band Adagio Lorraine Young: Paramore, it was great MSJ: Do you have a musical “guilty pleasure?” Steve Francis: Nope. No guilt, only pleasure Lorraine Young: Lady Gaga... Emmanuel de Saint Méen: uh? MSJ: If you could sit down to dinner with any three people, living or dead, for food and conversation, with whom would you be dining? Steve Francis: I'd go for a (nerdy) sci-fi dinner, with the late Frank Herbert, with Greg Egan, and with Arjen Lucassen. This would probably be the genesis to an ambitious, guest-stars filled, symphonic-math-prog-rock concept-album with an epic story about religious virtual beings reinventing quantum politics on a galactic scale Emmanuel de Saint Méen: Artists from the beat generation: William Burroughs, Allen Ginsberg and Jack Kerouac Lorraine Young: My three best friends MSJ: Are there any closing thoughts you would like to get out there? Emmanuel de Saint Méen: Sure, thanks to all our fans and long live Music Street Journal! More Interviews Metal/Prog Metal Non-Prog Progressive Rock This work is licensed under a Creative Commons Attribution 3.0 United States License. © 2013 Music Street Journal Site design and programming by Studio Fyra, Inc./Beetcafe.com	v0
2024-06-03T18:26:15.484Z	2013-12-06T05:53:45.000Z	xvpjnd4o5nzlwuxawjrhfem3rjje74l6	{ "content_type": "text/html", "provenance": "cccc-CC-MAIN-2013-48-0004.json.gz:14575", "uncompressed_offset": 611855106, "url": "www.werelate.org/wiki/Place:Mbandaka%2C_Democratic_Republic_of_the_Congo", "warc_date": "2014-01-03T03:19:54.000Z", "warc_filename": "<urn:uuid:ce5400bf-2999-41a1-a6e5-1708c58d9358>", "warc_url": "http://www.werelate.org/wiki/Place:Mbandaka%2C_Democratic_Republic_of_the_Congo" }	cccc_CC-MAIN-2013-48	Place:Mbandaka, Democratic Republic of the Congo Watchers NameMbandaka Alt namesCoquilhatvillesource: Wikipedia TypeCity Located inDemocratic Republic of the Congo the text in this section is copied from an article in Wikipedia Mbandaka, formerly known as Coquilhatville or Coquilhatstad (named after Camille-Aimé Coquilhat), is a city on the Congo River in the Democratic Republic of Congo, lying near the confluence of the Congo and Ruki Rivers. Research Tips This page uses content from the English Wikipedia. The original content was at Mbandaka. The list of authors can be seen in the page history. As with WeRelate, the content of Wikipedia is available under the Creative Commons Attribution/Share-Alike License.	v0
2024-06-03T18:26:15.484Z	2013-12-06T05:43:01.000Z	m5yjqtm3v3qiflxi3xyxtmf7hnxcteov	{ "content_type": "text/html", "provenance": "cccc-CC-MAIN-2013-48-0004.json.gz:14576", "uncompressed_offset": 611866806, "url": "www.werelate.org/wiki/Place:R%C3%A9union", "warc_date": "2014-01-03T03:19:54.000Z", "warc_filename": "<urn:uuid:ce5400bf-2999-41a1-a6e5-1708c58d9358>", "warc_url": "http://www.werelate.org/wiki/Place:R%C3%A9union" }	cccc_CC-MAIN-2013-48	Place:Réunion Watchers NameRéunion Alt namesDepartment of Reunionsource: Britannica Book of the Year (1991) p 686 DOMsource: Wikipedia Département de la Réunionsource: Britannica Book of the Year (1993) p 698 La Réunionsource: Wikipedia Reunionsource: NIMA, GEOnet Names Server (1996-1998); Webster's Geographical Dictionary (1984) p 1011 Reuniãosource: Novo Dicionário Aurélio (1975) p 1232 Reuniónsource: Cassell's Spanish Dictionary (1978) p 964 Réunionsource: Getty Vocabulary Program TypeNation Coordinates21.1°S 55.6°E source: Getty Thesaurus of Geographic Names source: Family History Library Catalog source: Family History Library Catalog the text in this section is copied from an article in Wikipedia Réunion (; previously Île Bourbon) is a French island with a population of about 800,000 located in the Indian Ocean, east of Madagascar, about south west of Mauritius, the nearest island. Administratively, Réunion is one of the overseas departments of France. Like the other overseas departments, Réunion is also one of the 27 regions of France (being an overseas region) and an integral part of the Republic with the same status as those situated on the European mainland. Réunion is an outermost region of the European Union and, as an overseas department of France, is part of the Eurozone. Contents How places in Réunion are organized All places in Réunion Further information on historical place organization in Réunion Research Tips This page uses content from the English Wikipedia. The original content was at Réunion. The list of authors can be seen in the page history. As with WeRelate, the content of Wikipedia is available under the Creative Commons Attribution/Share-Alike License.	v0
2024-06-03T18:26:15.484Z	2013-12-06T05:38:40.000Z	i3p3ymlbk6go53c2ayn7fvpjolqulf72	{ "content_type": "text/html", "provenance": "cccc-CC-MAIN-2013-48-0004.json.gz:14583", "uncompressed_offset": 8947322, "url": "archive.mises.org/5464/greed-and-katrina/", "warc_date": "2014-01-03T03:19:42.000Z", "warc_filename": "<urn:uuid:111902af-34e2-4fd3-ab14-3018733c70c8>", "warc_url": "http://archive.mises.org/5464/greed-and-katrina/" }	cccc_CC-MAIN-2013-48	1. Skip to navigation 2. Skip to content 3. Skip to sidebar Source link: http://archive.mises.org/5464/greed-and-katrina/ Greed and Katrina August 14, 2006 by Greed for political power can be more harmful to a population’s overall well-being than the capitalist “greed” an entrepreneur might have for a larger market share or the “greed” a worker might have within capitalism for a larger income. As a case in point, recent disclosures about the level of corruption and fraud related to the relief efforts involving Hurricane Katrina show a pattern of dishonesty and “greed” among all sectors, among businesses, government and the general population. Some examples cited by The New York Times illustrate the wide-ranging nature of the corruption: • An estimated 1,100 prison inmates across the Gulf Coast collected in excess of $10 million in rental assistance and disaster-relief money. Crime pays! FEMA, in addition, distributed millions of tax dollars to people who used names and Social Security numbers belonging to state and federal prisoners. • A hotel owner in Sugar Land, Texas, has been charged with submitting $232,000 in invoices for evacuees who allegedly never stayed at his hotel, billing FEMA for purportedly empty rooms or rooms occupied by paying guests or hotel employees. • An Illinois woman who was living in Illinois at the time of the storm sought relief benefits by claiming she had watched her two daughters drown in the flood waters of New Orleans. The children never existed. • A Department of Labor employee in Louisiana, appropriately named Wayne Lawless, has been charged with handing out nearly 100 falsified disaster unemployment benefit cards in exchange for kickbacks of up to $300 per card. • In New Orleans, two FEMA officials have pleaded guilty to pocketing $20,000 in bribes in exchange for inflating the count on the number of meals a contractor was serving to relief workers. • With the $2,000 debit cards distributed by FEMA for disaster relief, an estimated 5,000 people have double dipped, receiving both the $2,000 plastic card and a second $2,000 by check or electronically. • Two men, one a representative of the Army Corps of Engineers, have pleaded guilty to taking kickbacks in exchange for approving payments for removal of nonexistent loads of hurricane debris. In contrast, with loads of debris that were not nonexistent, a councilman in St. Tammany Parish, Louisiana, has been charged with attempting to extort $100,000 from a debris-removal contractor. • One creative scam artist is charged with collecting 26 federal disaster relief checks totaling $139,000 by using 13 Social Security numbers and fake claims of damage at bogus addresses. Others collected and pocketed hurricane relief donations by posing as Red Cross workers. All told, what the above represents is “one of the most extraordinary displays of scams, schemes and stupefying bureaucratic bungles in modern history,” reports the Times, “costing taxpayers up to $2 billion.” The $2 billion guesstimate might well prove to be just the proverbial tip of the iceberg. Commenting on the extent of fraud and waste in FEMA’s response to Katrina, Gregory D. Kutz, a director of audits at the General Accounting Office, stated, “I still don’t think they fully understand the depth of the problem.” By the time the Katrina accounting is over, it won’t be surprising if the fraud and boondoggles hit $5 billion. The question: How high does the price of ineptitude and corruption have to go before we all begin to understand the depth of the problem? Previous post: Next post:	v0
2024-06-03T18:26:15.484Z	2013-12-06T05:39:01.000Z	hyjdyd4n6cx3k5nm6zopeormdmpuud5b	{ "content_type": "text/html", "provenance": "cccc-CC-MAIN-2013-48-0004.json.gz:14597", "uncompressed_offset": 25996547, "url": "buffalo.nas-central.org/w/index.php?oldid=26651&title=Freelink_upgrade_to_lenny_with_SATA-USB_adapter", "warc_date": "2014-01-03T03:19:42.000Z", "warc_filename": "<urn:uuid:111902af-34e2-4fd3-ab14-3018733c70c8>", "warc_url": "http://buffalo.nas-central.org/w/index.php?title=Freelink_upgrade_to_lenny_with_SATA-USB_adapter&oldid=26651" }	cccc_CC-MAIN-2013-48	Freelink upgrade to lenny with SATA-USB adapter From NAS-Central Buffalo - The Linkstation Wiki Revision as of 23:17, 7 January 2009 by JonSenior (Talk \| contribs) Jump to: navigation, search WARNING! There is a possibility that you could brick your NAS with these instructions. Please make sure that you read the entire page carefully. 23:42 7th Jan 2009 - This is a work in progress and may change dramatically over the next few hours. - JonSenior Usual warnings and caveats apply. This is my experience using a Linkstation Live v2. You brick it... you bought it. Preamble SATA<->USB The goal was to make the Linkstation work with a USB sound card, and thus to act as a media player, not a media server. With this in mind and using Add_a_USB_sound_card as a proof of concept, I installed Freelink following the instructions on FreeLink_for_the_LinkStation_PRO/LIVE. The first problem was Alsa which didn't play well on the 2.6.12 kernel that came with Freelink. After a lot of searching I found that there was a problem with the Alsa tools when running an EABI kernel with OABI userspace tools. This is well-documented on-line. My first attempts to [Buffalo_ARM9_Kernel_Port upgrade the kernel to a vanilla 2.6.28] were disastrous and resulted in the box going into a reboot every 30 seconds, before even allowing a connection. Since it wasn't attempting to contact a TFTP server, I couldn't get it to go into [EM_Mode] and I didn't own a serial cable, I was left with no option but to access the drive directly. So I browsed around and found a SATA<->USB adapter that I could use to access the HDD without complete disassembly. The version to the right requires that the either the HDD be removed, or the device be hacked apart. Modifying and connecting the adapter The second time I connected it, I opted for the later. The case comes apart fairly easily and you'll need to pull off the plastic cover from the switch and then use a pair of wire cutters to cut the switch shorter. With that done, the HDD can be connected by removing the front of the case and the daughterboard. If you have nimble fingers you don't even need to remove the side panel. See [Disassemble_the_LS_Pro_v2_/_LS_Live_v2] for further instructions. Since the switch will be near inaccessible, you will need to connect the adapter to the HDD, then plug it into the USB port and connect the molex connecter which provides power. Installation • Follow the instructions in [Buffalo_ARM9_Kernel_Port] to create a kernel and modules for your Linkstation. • Connect the drive and mount the partitions. They should appear as /dev/sdXY. Assuming a default partitioning and /dev/sdb as the root you should see • sdb1 = The boot partition • sdb2 = The root filesystem • sdb4 = The extended partition containing the rest • sdb5 = A swap partition • sdb6 = The media partition (You do want to store stuff on this, right?) • In a default setup sdb2 and sdb6 will be in XFS format. As of 08 Jan 2009 there are ongoing issues with XFS on Arm. I had an error on my rootfs after only two boots. It is worth switching to another filesystem. I used ext3 as I'm familiar with it, but there appears to be a strong consensus on using JFS for the media partition. • Back up the old root system. You will want to be able to revert if anything goes wrong. From within the mounted system use tar cjf /path/to/backup.tar.bz2 * • Reformat to a new filesystem if you wish to do so. • Decompress the Lenny image using the following from within the mounted system: tar xf /path/to/lennyimage.tar.gz Instructions end here for the minute. More to be added tomorrow.	v0
2024-06-03T18:26:15.484Z	2013-12-06T05:40:31.000Z	gf7atq24h7m4kmhyyyfnuusf4qwkeq5g	{ "content_type": "text/html", "provenance": "cccc-CC-MAIN-2013-48-0004.json.gz:14599", "uncompressed_offset": 29558349, "url": "ccforum.com/content/17/4/R146/abstract", "warc_date": "2014-01-03T03:19:42.000Z", "warc_filename": "<urn:uuid:111902af-34e2-4fd3-ab14-3018733c70c8>", "warc_url": "http://ccforum.com/content/17/4/R146/abstract" }	cccc_CC-MAIN-2013-48	Email updates Keep up to date with the latest news and content from Critical Care and BioMed Central. Research Cardiac index and oxygen delivery during low and high tidal volume ventilation strategies in patients with acute respiratory distress syndrome: a crossover randomized clinical trial Giuseppe Natalini1*, Cosetta Minelli2, Antonio Rosano1, Pierluigi Ferretti1, Carmine R Militano1, Carlo De Feo3 and Achille Bernardini1 Author Affiliations 1 General Intensive Care Unit, Poliambulanza Foundation Hospital, Brescia, Italy 2 Centre for Biomedicine, EURAC research, Bolzano, Italy 3 Intensive Care Unit, Desenzano del Garda Hospital, Desenzano del Garda, Italy For all author emails, please log on. Critical Care 2013, 17:R146 doi:10.1186/cc12825 Published: 23 July 2013 Abstract Introduction The beneficial effect of low tidal volume (TV) ventilation strategy on mortality in patients with acute respiratory distress syndrome (ARDS) has been attributed to the protective effect on ventilator-induced lung injury, and yet its effect on cardiovascular function might also play an important role. The aim of this study was to assess whether low TV ventilation improves cardiac output and oxygen delivery compared with high TV ventilation strategy in patients with ARDS. Methods In this crossover randomized clinical trial 16 ARDS patients were recruited in an intensive care unit at a university-affiliated hospital. Each patient was ventilated for 30 min with low (6 mL/kg) and 30 min with high (12 mL/kg) TV. The two experimental periods, applied in random order and with allocation concealment, were separated by 30 min of basal ventilation. Minute ventilation was constantly maintained by appropriate respiratory rate changes. Results Compared with high TV ventilation, low TV ventilation showed decreased pH (7.37 vs. 7.41, P = 0.001) and increased PaCO2 (49 vs. 43 mmHg; P = 0.002). Cardiac index and oxygen delivery index were increased with low compared with high TV ventilation (3.9 vs. 3.5 L.min-1.m-2, P = 0.012, and 521 vs. 463 mL.min-1.m-2, P = 0.002, respectively), while oxygen extraction ratio decreased (0.36 vs. 0.44, P = 0.027). In four patients oxygen extraction ratio was >0.5 during high TV but not during low TV strategy. The magnitude of the change in cardiac index was positively associated with PaCO2 variation (P = 0.004), while it was unrelated to the magnitude of changes in TV and airway pressure. The decrease of cardiac index was predicted by PaCO2 reduction, with and area under ROC curve of 0.72. Conclusions Our findings suggest that a low TV ventilation strategy increases cardiac index and oxygen delivery, thus supporting the hypothesis that the beneficial effect of low TV ventilation in patients with ARDS could be partially explained by hemodynamic improvement. In other words, low tidal volume ventilation could be protective also for the cardiovascular system and not only for the lung. The slight increase of PaCO2 during low TV ventilation seems to predict the increase of cardiac index. Trial registration ClinicalTrials.gov: NCT00713713 Keywords: Cardiac Output; Tidal Volume; Respiratory Distress Syndrome; Adult; Hemodynamics	v0
2024-06-03T18:26:15.484Z	2013-12-06T05:42:20.000Z	n3jey6ycm7wjmrh4mbh3pcikdll65cxc	{ "content_type": "text/html", "provenance": "cccc-CC-MAIN-2013-48-0004.json.gz:14614", "uncompressed_offset": 57110323, "url": "elinux.org/index.php?diff=next&oldid=179960&title=File_Systems", "warc_date": "2014-01-03T03:19:42.000Z", "warc_filename": "<urn:uuid:111902af-34e2-4fd3-ab14-3018733c70c8>", "warc_url": "http://elinux.org/index.php?title=File_Systems&diff=next&oldid=179960" }	cccc_CC-MAIN-2013-48	Difference between revisions of "File Systems" From eLinux.org Jump to: navigation, search (Comparison of flash filesystems) (UBIFS) Line 166: Line 166: == UBIFS == == UBIFS == UBIFS is a flash-based filesystem, implemented on top of the Unsorted Block Images ([[File_Systems#UBI\|UBI]]) interface. + [[UBIFS]] is a flash-based filesystem, implemented on top of the Unsorted Block Images ([[File_Systems#UBI\|UBI]]) interface. It has good performance compared to Jffs2 and yaffs. It has good performance compared to Jffs2 and yaffs. Revision as of 19:25, 12 October 2012 This page has information about file systems which are of interest for embedded projects. Introduction[edit] Most embedded devices use flash memory as storage media. Also, size and bootup time are very important in many consumer electronics products. Therefore, special file systems are often used with differrent features, such as enhanced compression, or the ability to execute files directly from flash. MTD[edit] Note that flash memory may be managed by the Memory Technology Devices (MTD) system of Linux. See the MTD/Flash FAQ for more information. Most of the filesystems mentioned here are built on top of the MTD system. UBI[edit] The Unsorted Block Images (UBI) system in the Linux kernel manages multiple logical volumes on a single flash device. It provides a mapping from logical blocks to physical erase blocks, via the MTD layer. UBI provides a flexible partitioning concept which allows for wear-leveling across the whole flash device. See the UBI page or UBI FAX and Howto for more information. Partitioning[edit] The kernel requires at least one "root" file system, onto which other file systems can be mounted. In non-embedded systems, often only a single file system is used. However, in order to optimize limited resources (flash, RAM, processor speed, boot up time), many embedded systems break the file system into separate parts, and put each part on its own partition (often in different kinds of storage. For example, a developer may wish to take all the read-only files of the system, and put them into a compressed, read-only file system in flash. This will consume the least amount of space on flash, at the cost of some read-time performance (for decompression). Another configuration might have executable files stored uncompressed on flash, so that they can be executed-in-place, which saves RAM and boot-up time (with a potential small loss of performance). For writable data, if the data does not need to be persistent, sometimes a ramdisk is used. Depending on the performance needs and the RAM limits, the file data may be compressed or not. There is no single standard for interleaving the read-only and read-write portions of the file system. This depends heavily on the set of embedded applications used for the project. eMMC and UFS[edit] As flash memories have gotten larger, a variety of factors has caused a shift from use of raw NAND to packaged, block-addressable NAND flash memory for embedded devices. These are chips which contain firmware on board to accept block I/O requests, similar to rotating storage media (old hard disk drives), and fullfill them. This involves mapping the read and write requests to areas of the NAND flash in the chip, and managing the NAND flash to try to optimize for correctness and longevity of the flash memory. NAND flash must be re-written in large blocks (erase blocks) that are many times the size of individual file system blocks. Therefore, the method of mapping, re-arranging and garbage collecting the allocation of blocks in the system is quite important. These chips are run with a block-based, rather than flash-based filesystem (e.g. ext4). As of 2012, optimizing the ext4 file system for use with these systems is a hot topic area of file system research. See http://lwn.net/Articles/502472 Embedded Filesystems[edit] Here are some filesystems designed for and/or commonly used in embedded devices, sorted in alphabetical order: AXFS[edit] • AXFS - Advanced XIP File System • Website: http://axfs.sourceforge.net/ • This file system is designed specifically to support Execute-in-place operations. It uses a bi-phased approach. The first phase is to have the filesystem in flash and run it to collect profile data, stating what pages are used. In the second phase you build a filesystem using these profile data. This filesystem makes all pages metioned in the profile file as XIP data, which can then will be loaded to RAM upon mounting (and executed as XIP). It is also possible to put the XIP pages in NOR flash and run them from there. Btrfs[edit] CramFS[edit] • CRAMFS - A compressed read-only file system for Linux. The maximum size of CRAMFS is 256MB. • "Linear Cramfs" is the name of a special feature to use uncompressed file, in a linear block layout with the Cramfs file system. This is useful for storing files which can be executed in-place. For more information on Linear Cramfs, see Application XIP InitRAMFS[edit] From March 2006 Linux Devices: INTRODUCING INITRAMFS, A NEW MODEL FOR INITIAL RAM DISKS This clear, technical article introduces initramfs, a Linux 2.6 feature that enables an initial root filesystem and init program to reside in the kernel's memory cache, rather than on a ramdisk (as with initrd filesystems). Compared to initrd, intramfs can increase boot-time flexibility, memory efficiency, and simplicity, the author says. One especially interesting feature for embedded Linux developers is that relatively simple, deeply embedded systems can use initramfs as their sole filesystem. http://www.linuxfordevices.com/c/a/Linux-For-Devices-Articles/Introducing-initramfs-a-new-model-for-initial-RAM-disks/ Here is a good article about how to build an initramfs: For more information, look in: Documentation/early-userspace/README JFFS2[edit] LogFS[edit] LogFS was a scalable flash filesystme aimed at replacing JFFS2 for most uses. Unfortunately, it seems to be abandoned at present. See LogFS for details. NFS[edit] Due to space constraints on embedded devices, it is common during development to use a network file system for the root filesystem for the target. This allows the target to have a very large area where full-size binaries and lots of development tools can be placed during development. One drawback to this approach is that the system will need to be re-configured with local file systems (and most likely re-tested) for final product shipment, at some time during the development cycle. An NFS client can be built into the Linux kernel, and the kernel can be configured to use NFS as the root filesystem. This requires support for networking, and mechanisms for specifying the IP address for the target, and the path to the filesystem on the NFS host. Also, the host must be configured to run an NFS server. Often, the host also provides the required address and path information to the target board by running a DHCP server. See the the file Documentation/nfsroot.txt in the Linux kernel source for more information about mounting an NFS root filesystem with the kernel. PRAMFS[edit] • PRAMFS - Persistent and protected RAM File System The Persistent/Protected RAM Special Filesystem (PRAMFS) is a full-featured read/write filesystem that has been designed to work with fast I/O memory, and if the memory is non-volatile, the filesystem will be persistent. In addition, it has Execute-in-place support. Info on the PRAMFS specification can be found at Pram Fs Specification Romfs[edit] SquashFS[edit] Squash Fs is a (more) compressed read-only file system for Linux. This file system has better compression than JFFS2 or CRAMFS. After spending a long time outside of the mainline kernel, Squashfs have finally been merged and released with kernel 2.6.29. It is possible to tune the amount of compression when running mksquashfs. The -b option allows you to specify the block size. A smaller block size generally gives less compression and a larger -b option gives more compression. However there is a downside to this. Data is read from the flash using blocks. So if you use a block size of 128k, and you need a page of 4k, still the compressed equivalent of 128k data will be read from flash. As 128k comprises 32 pages, it will result in 32 pages being read into the buffer cache, even though at the moment of reading you only need one. Often the other 31 pages will be needed as well, but if not you wasted some tiem to read and decompress the unused data. Also you got some unneeded data in the buffer cache (possibly the system even had to kick used pages from the cache in order to make room for these 31 pages). If you care for the smallest filesystem you probably want to go with the largest block size. However, if your primary concern is performance you might want to experiment a little bit to see what works out best for you (and that could even be applying no compression at all! Mksquashfs has options: -noInodeCompression, -noDataCompression and –noFragmentCompression to control this). If you also applied function reordering (see Boot Time#User-space and application speedups a large block size will probably work out well for you. The table below gives an idea of the amount of compression that is achieved by the various block sizes. Input was a root filesystem of an embedded device. size compression Initial 53128K 100 % 4K 17643K 33.2 % 8K 16572K 31.2 % 16K 15780K 29.7 % 32K 15204K 28.6 % 64K 14812K 27.9 % A presentation on Squash FS by Phillip Lougher at ELC Europe 2008: slides and video. UBIFS[edit] UBIFS is a flash-based filesystem, implemented on top of the Unsorted Block Images (UBI) interface. It has good performance compared to Jffs2 and yaffs. Please see the UBIFS page for more details. YAFFS2[edit] • YAFFS - Yet Another Flash File System - a file system designed specifically for NAND flash. YAFFS2 is simple, portable, reliable and self-contained. It is widely used in embedded OSes other than Linux, and can also be used stand-alone without an OS, e.g. in bootloaders. When used with Linux it can use MTD or its own flash driver. Similarly it can use the VFS or its own posix layer. It is log-structured, and single-threaded. It does not do compression itself - either compress the data itself or use squashfs on top of YAFFS2. YAFFS2 is designed to boot quickly (insofar as a log-structured FS that has to scan the flash can). It uses checkpointing so that if a partition was unmounted cleanly then there is no need to rescan the flash on power-up. All the features of the FS are configuable so you can trade off things like maximum file/partition size, flash block size, file granulaity etc. Data is written straight through to the flash except for caching to ensure efficienct use of blocks. YAFFS2 normally uses the OOB are of the flash for its metadata, allowing faster booting as only the OOB needs to be read for flash scan. It can keep its metadata inside the main page area at the expense of some speed. Despite having been in use on Linux in real products since 2004 it has not yet made it to the mainline. • Presentation on YAFFS2 by Wookey at ELC Europe 2007: yaffs.pdf • Presentation from CELF Jamboree 17 comparing YAFFS and JFFS2 on 2.6.10: celf_flash.pdf YAFFS2 is GPLed, but is also available under dual-licensing terms for use in non-free contexts from Aleph One Ltd. Mounting the root filesystem[edit] The root filesystem is mounted by the kernel, using a kernel command line option. Other file systems are mounted from user space, usually by init scripts or an init program, using the 'mount' command. The following are examples of command lines used for mounting a root filesystem with Linux: • Use the first partition on the first IDE hard drive: • root=/dev/hda1 • or in later kernels: • root=/dev/sda1 • Use NFS root filesystem (kernel config must support this) • root=/dev/nfs (Usually you need to add some other arguments to make sure the kernel IP address gets configured, or to specify the host NFS path.) • Use flash device partition 2: • root=/dev/mtdblock2 [FIXTHIS - should probably mention initrd's here somewhere] Mounting JFFS2 image on PC using mtdram[edit] Since it is not possible to use the loopback device to mount JFFS2 images, mtdram needs to be used instead. Usually three modules are needed to get it working: • mtdram: Provides an MTD partition in RAM. The size can be defined with the total_size parameter in kilobytes. • mtdblock: This will create a block device for access to the partition. • jffs2: Since JFFS2 is usually not used as a filesystem on a PC, support needs to be loaded manually. modprobe mtdram total_size=16384 modprobe mtdblock modprobe jffs2 Depending on the target's endianess the image file might need conversion to PC endianess. jffs2dump from the MTD tools can be used to archive this. jffs2dump -b -c -e <output-filename> <input-filename> The final image can be copied to the block device using dd. dd if=<image-file> of=/dev/mtdblock0 Mounting is done in the usuall way. mount /dev/mtdblock0 /tmp/jffs2 -t jffs2 Mounting UBI Image on PC using nandsim[edit] First create a simulated NAND device (this one is 256MB, 2048 page size). <number>_id_byte= corresponds to the ID bytes sent back from the NAND. $ sudo modprobe nandsim first_id_byte=0x20 second_id_byte=0xaa third_id_byte=0x00 fourth_id_byte=0x15 Check it was created. $ cat /proc/mtd dev: size erasesize name mtd0: 10000000 00020000 "NAND simulator partition 0" Next, attach it to a mtd device. $ sudo modprobe ubi mtd=0 I had to detach it prior to formatting it. $ sudo ubidetach /dev/ubi_ctrl -m 0 If that ubidetach step fails when you enter it, just proceed to the next step to format the mtd device. $ sudo ubiformat /dev/mtd0 -f <image>.ubi ubiformat: mtd0 (nand), size 268435456 bytes (256.0 MiB), 2048 eraseblocks of 131072 bytes (128.0 KiB), min. I/O size 2048 bytes libscan: scanning eraseblock 2047 -- 100 % complete ubiformat: 2048 eraseblocks have valid erase counter, mean value is 1 ubiformat: flashing eraseblock 455 -- 100 % complete ubiformat: formatting eraseblock 2047 -- 100 % complete Then, attach it. $ sudo ubiattach /dev/ubi_ctrl -m 0 UBI device number 0, total 2048 LEBs (264241152 bytes, 252.0 MiB), available 0 LEBs (0 bytes), LEB size 129024 bytes (126.0 KiB) Make a target directory, and mount the device. $ mkdir temp $ sudo mount -t ubifs ubi0 temp Issues with General Purpose filesystems used in embedded[edit] MMC/sdcard card characteristics[edit] MMCs and SDcards are flash devices which present a block-oriented interface to their host computer. Often, these devices are used in embedded devices and have characteristics that are tuned for block access using a FAT filesystem. But they are presented at "black boxes", with internal logic and algorithms that are not exposed to the host computer. Some work is in progress to survey characterize these attributes, and to adapt Linux to be able to use these devices more efficiently. See https://wiki.linaro.org/WorkingGroups/KernelConsolidation/Projects/FlashCardSurvey and https://wiki.linaro.org/WorkingGroups/KernelConsolidation/Projects/FlashDeviceMapper (These projects appear to be the work of Arnd Bergmann) Special-purpose Filesystems[edit] ABISS[edit] The Active Block I/O Scheduling System is a file system designed to be able to provide real-time features for file system I/O activities. See ABISS Layered Filesystems[edit] Layered filesystems enable you to mount read-only media and still have the possibility to write to it. At least, the writing part will end up somewhere else, which is transparantly handled by the layered filesystem. It has been around for quite some time and below are some examples of filesystems already usable on (embedded) Linux systems out-of-the-box. UnionFS[edit] Sometimes it is handy to be able to overlay file systems on top of each other. For example, it can be useful in embedded products to use a compressed read-only file system, mounted "underneath" a read/write file system. This give the appearance of a full read-write file system, while still retaining the space savings of the compressed file system, for those files that won't change during the life of the product. UnionFS is a project to provide such a system (providing a "union" of multiple file systems). See http://www.filesystems.org/project-unionfs.html See also union mounts, which are described at http://lkml.org/lkml/2007/6/20/18 (and also in Documentation/union-mounts.txt in the kernel source tree - or will be, when this feature is merged.) aufs[edit] Another UnionFS. Go to http://aufs.sourceforge.net for more details. mini_fo[edit] minifo = mini fanout overlay file system. Go to http://www.denx.de/wiki/Know.MiniFOHome for more details. Apparently this is not maintained any more. Last information is from 2005. Performance and benchmarks[edit] Tools to measure performance[edit] You can use IOZone to measure the performance of a Linux filesystem. See http://www.iozone.org/ Some benchmark systems that are commonly used with desktop linux are Comparison of flash filesystems[edit] Free Electrons tests (2011)[edit] In 2011, the CE Linux Forum contracted with Free Electrons to perform systematic testing of multiple flash filesystems over multiple kernel versions. The results are here: Flash_Filesystem_Benchmarks Other projects[edit] Multi-media file systems[edit] • XPRESS file system - [See OLS 2006 proceedings, presentation by Joo-Young Hwang] • I found out at ELC 2007 that this FS project was recently suspended internally at Samsung WikipediaFS[edit] A mountable virtual filesystem that allows accessing mediawiki based sites as regular files using a regular editor. Currently this filesystem is unmaintained. See http://wikipediafs.sourceforge.net/ for more info. wikifs[edit] This one seems similar to WikipediaFS, but aimed at Plan9 and inferno. See http://www.cs.bell-labs.com/magic/man2html/4/wikifs for more info.	v0
2024-06-03T18:26:15.484Z	2013-12-06T05:41:22.000Z	uzsrchmdb67gu2pmebjfcr2226gaa46a	{ "content_type": "text/html", "provenance": "cccc-CC-MAIN-2013-48-0004.json.gz:14621", "uncompressed_offset": 62813610, "url": "familysearch.org/learn/wiki/en/Lippe-F%C3%BCrstentum_Heraldry", "warc_date": "2014-01-03T03:19:42.000Z", "warc_filename": "<urn:uuid:111902af-34e2-4fd3-ab14-3018733c70c8>", "warc_url": "http://familysearch.org/learn/wiki/en/Lippe-F%C3%BCrstentum_Heraldry" }	cccc_CC-MAIN-2013-48	Lippe-Fürstentum HeraldryEdit This Page From FamilySearch Wiki Back to Lippe – Fürstentum (principality) Page Need additional research help? Contact our research help specialists. Need wiki, indexing, or website help? Contact our product teams. Did you find this article helpful? You're invited to explain your rating on the discussion page (you must be signed in). • This page was last modified on 14 July 2012, at 12:46. • This page has been accessed 263 times.	v0
2024-06-03T18:26:15.484Z	2013-12-06T05:54:15.000Z	3lc6bbrxnbuloijmcuhlqmceysk56g4k	{ "content_type": "text/html", "provenance": "cccc-CC-MAIN-2013-48-0004.json.gz:14622", "uncompressed_offset": 62835442, "url": "familysearch.org/learn/wiki/en/index.php?oldid=1214930&title=France", "warc_date": "2014-01-03T03:19:42.000Z", "warc_filename": "<urn:uuid:111902af-34e2-4fd3-ab14-3018733c70c8>", "warc_url": "http://familysearch.org/learn/wiki/en/index.php?title=France&oldid=1214930" }	cccc_CC-MAIN-2013-48	FranceEdit This Page From FamilySearch Wiki Revision as of 01:00, 12 January 2013 by Paynescrossing (Talk \| contribs) Contents Getting started with French research Welcome to the France page! FamilySearch Wiki is a community website dedicated to helping people throughout the world learn how to find their ancestors. Through the France page you can learn how to find, use, and analyze French records of genealogical value. The content is variously targeted to beginners, intermediate, and expert researchers. Here you will find helpful research tools and research guidance. Please visit the help page to learn more about using the site. The French Page is a work in progress, your contributions and feedback are essential! For help with specific areas in France, click here for a list of locations and topics. See the tutorials at the FamilySearch Learning Center on basic French Researchand on Reading French Handwritten Records. History of France See the Facebook page "Histoire de France - sites et blogs" for more information. Jurisdictions Prior to March 1790 France was organized into provinces. Several administrative regions of France still carry the names of the former provinces. Historic Provinces (and their capitals) Departments Today France is divided into 96 departments plus 5 overseas departments. This number has changed over the years, in 1790 there were 83 and at the height of Napoleon's reign there were as many as 130. Records are kept on the town level, but one needs to know in which department the town is located. Research Tools Wiki article describing online collections are found at: Research Strategies Featured Content (Your text or images here) Related Content French citizens of Alsace-Lorraine (Haut Rhin, Bas Rhin, Moselle) often speak German. Many people from this area moved to Russia and the Ukraine and are discussed in Germans from Russia. Did you know? • The archives of most of the départements (states) in France and 60 French cities have digitized a wide range of historical records and made them available online. Additional French archives are coming online monthly. Records available often include birth, marriage, and death records, cadastral and other land records, military records, censuses, and more. Click here to see the latest updates. • French national censuses are seldom used for primary research by most family historians, and many have not been microfilmed. • Some French military records begin as early as the 1500s. Records since the 19th century may include information about an ancestor's military career, such as promotions, places served, pensions, and conduct. In addition, these records may include information about his age, birthplace, residence, occupation, physical description, and family members. Things you can do In order to make this wiki a better research tool, we need your help! Many tasks need to be done. You can help by: Articles that need editing: Beginners Corner News and Events • Hot off the Press! • Current Events more... Topics Helpful Websites Genealogy courses: Learn how to research from an expert in France courses. Find us on Facebook Ask a question Learn what's new Build the community Need additional research help? Contact our research help specialists. Need wiki, indexing, or website help? Contact our product teams. Did you find this article helpful? You're invited to explain your rating on the discussion page (you must be signed in).	v0
2024-06-03T18:26:15.484Z	2013-12-06T05:53:35.000Z	acrufujmyxt5epyepesf6m3t6s7w6kgx	{ "content_type": "text/html", "provenance": "cccc-CC-MAIN-2013-48-0004.json.gz:14625", "uncompressed_offset": 74859335, "url": "genomebiology.com/2004/5/12/R96/", "warc_date": "2014-01-03T03:19:42.000Z", "warc_filename": "<urn:uuid:111902af-34e2-4fd3-ab14-3018733c70c8>", "warc_url": "http://genomebiology.com/2004/5/12/R96/" }	cccc_CC-MAIN-2013-48	Research A Drosophila protein-interaction map centered on cell-cycle regulators Clement A Stanyon1, Guozhen Liu1, Bernardo A Mangiola1, Nishi Patel1, Loic Giot2, Bing Kuang2, Huamei Zhang1, Jinhui Zhong1 and Russell L Finley13* Author Affiliations 1 Center for Molecular Medicine & Genetics, Wayne State University School of Medicine, 540 E. Canfield Avenue, Detroit, MI 48201, USA 2 CuraGen Corporation, 555 Long Warf Drive, New Haven, CT 06511, USA 3 Department of Biochemistry and Molecular Biology, Wayne State University School of Medicine, 540 E. Canfield Avenue, Detroit, MI 48201, USA For all author emails, please log on. Genome Biology 2004, 5:R96 doi:10.1186/gb-2004-5-12-r96 The electronic version of this article is the complete one and can be found online at: http://genomebiology.com/2004/5/12/R96 Received:26 July 2004 Revisions received:27 October 2004 Accepted:1 November 2004 Published:26 November 2004 © 2004 Stanyon et al. licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Abstract Background Maps depicting binary interactions between proteins can be powerful starting points for understanding biological systems. A proven technology for generating such maps is high-throughput yeast two-hybrid screening. In the most extensive screen to date, a Gal4-based two-hybrid system was used recently to detect over 20,000 interactions among Drosophila proteins. Although these data are a valuable resource for insights into protein networks, they cover only a fraction of the expected number of interactions. Results To complement the Gal4-based interaction data, we used the same set of Drosophila open reading frames to construct arrays for a LexA-based two-hybrid system. We screened the arrays using a novel pooled mating approach, initially focusing on proteins related to cell-cycle regulators. We detected 1,814 reproducible interactions among 488 proteins. The map includes a large number of novel interactions with potential biological significance. Informative regions of the map could be highlighted by searching for paralogous interactions and by clustering proteins on the basis of their interaction profiles. Surprisingly, only 28 interactions were found in common between the LexA- and Gal4-based screens, even though they had similar rates of true positives. Conclusions The substantial number of new interactions discovered here supports the conclusion that previous interaction mapping studies were far from complete and that many more interactions remain to be found. Our results indicate that different two-hybrid systems and screening approaches applied to the same proteome can generate more comprehensive datasets with more cross-validated interactions. The cell-cycle map provides a guide for further defining important regulatory networks in Drosophila and other organisms. Background Protein-protein interactions have an essential role in a wide variety of biological processes. A wealth of data has emerged to show that most proteins function within networks of interacting proteins, and that many of these networks have been conserved throughout evolution. Although some of these networks constitute stable multi-protein complexes while others are more dynamic, they are all built from specific binary interactions between individual proteins. Maps depicting the possible binary interactions among proteins can therefore provide clues not only about the functions of individual proteins but also about the structure and function of entire protein networks and biological systems. One of the most powerful technologies used in recent years for mapping binary protein interactions is the yeast two-hybrid system [1]. In a yeast two-hybrid assay, the two proteins to be tested for interaction are expressed with amino-terminal fusion moieties in the yeast Saccharomyces cerevisiae. One protein is fused to a DNA-binding domain (BD) and the other is fused to a transcription activation domain (AD). An interaction between the two proteins results in activation of reporter genes that have upstream binding sites for the BD. To map interactions among large sets of proteins, the BD and AD expression vectors are placed initially into different haploid yeast strains of opposite mating types. Pairs of BD and AD fused proteins can then be tested for interaction by mating the appropriate pair of yeast strains and assaying reporter activity in the resulting diploid cells [2]. Large arrays of AD and BD strains representing, for example, most of the proteins encoded by a genome, have been constructed and used to systematically detect binary interactions [3-6]. Most large-scale screens have used such arrays in a library-screening approach in which the BD strains are individually mated with a library containing all of the AD strains pooled together. After plating the diploids from each mating onto medium that selects for expression of the reporters, the specific interacting AD-fused proteins are determined by obtaining a sequence tag from the AD vector in each colony. High-throughput two-hybrid screens have been used to map interactions among proteins from bacteria, viruses, yeast, and most recently, Caenorhabditis elegans and Drosophila melanogaster [4-10]. Analyses of the interaction maps generated from these screens have shown that they are useful for predicting protein function and for elaborating biological pathways, but the analyses have also revealed several shortcomings in the data [11-13]. One problem is that the interaction maps include many false positives - interactions that do not occur in vivo. Unfortunately, this is a common feature of all high-throughput methods for generating interaction data, including affinity purification of protein complexes and computational methods to predict protein interactions [11-14]. A solution to this problem has been suggested by several studies that have shown that the interactions detected by two or more different high-throughput methods are significantly enriched for true positives relative to those detected by only one approach [11-13]. Thus it has become clear that the most useful protein-interaction maps will be those derived from combinations of cross-validating datasets. A second shortcoming of the large-scale screens has been the high rate of false negatives, or missed interactions. This is evident from comparing the high-throughput data with reference data collected from published low-throughout studies. Such comparisons with two-hybrid maps from yeast [13] and C. elegans [5], for example, have shown that the high-throughput data rarely covers more than 13% of the reference data, implying that only about 13% of all interactions are being detected. The finding that different large datasets show very little overlap, despite having similar rates of true positives, supports the conclusion that high-throughput screens are far from saturating [10,12]. For example, three separate screening strategies were used to detect hundreds of interactions among the approximately 6,000 yeast proteins, and yet only six interactions were found in all three screens [10]. These results suggest that many more interactions might be detected simply by performing additional screening, or by applying different screening strategies to the same proteins. In addition, anecdotal evidence has suggested that the use of two-hybrid systems based on different fusion moieties may broaden the types of protein interactions that can be detected. In one study, for example, screens performed using the same proteins fused to either the LexA BD or the Gal4 BD produced only partially overlapping results, and each system detected biologically significant interactions missed by the other [15]. Thus, the application of different two-hybrid systems and different screening strategies to a proteome would be expected to provide more comprehensive datasets than would any single screen. We set out to map interactions among the approximately 14,000 predicted Drosophila proteins by using two different yeast two-hybrid systems (LexA- and Gal4-based) and different screening strategies. Results from the screens using the Gal4 system have already been published [6]. In that study, Giot et al. successfully amplified 12,278 Drosophila open reading frames (ORFs) and subcloned a majority of them into the Gal4 BD and Gal4 AD expression vectors by recombination in yeast. They screened the arrays using a library-screening approach and detected 20,405 interactions involving 7,048 proteins. To extend these results we subcloned the same amplified Drosophila ORFs into vectors for use in the LexA-based two-hybrid system, and constructed arrays of BD and AD yeast strains for high-throughput screening. Our expectation was that maps generated with these arrays would include interactions missed in previous screens, and would also partially overlap the Gal4 map, providing opportunities for cross-validation. Initially, we screened for interactions involving proteins that are primarily known or suspected to be cell-cycle regulators. We chose cell-cycle proteins as a starting point for our interaction map because cell-cycle regulatory systems are known to be highly conserved in eukaryotes, and because previous results have suggested that the cell-cycle regulatory network is centrally located within larger cellular networks [16]. This is most evident from examination of the large interaction maps that have been generated for yeast proteins using yeast two-hybrid and other methods. Within these maps there are more interactions between proteins that are annotated with the same function (for example, 'Pol II transcription', 'cell polarity', 'cell-cycle control') than between proteins with different functions, as expected for a map depicting actual functional connections between proteins. Interestingly, however, certain functional groups have more inter-function interactions than others. Proteins annotated as 'cell-cycle control', in particular, were frequently connected to proteins from a wide range of other functional groups, suggesting that the process of cell-cycle control is integrated with many other cellular processes [16]. Thus, we set out to further elaborate the cell-cycle regulatory network by identifying new proteins that may belong to it, and new connections to other cellular networks. Results Construction of an extensive protein interaction map centered on cell-cycle regulators by high-throughput two-hybrid screening We used the same set of 12,278 amplified Drosophila full-length ORFs from the Gal4 project [6] to generate yeast arrays for use in a modified LexA-based two-hybrid system (see Materials and methods). In the LexA system the BD is LexA and the AD is B42, an 89-amino-acid domain from Escherichia coli that fortuitously activates transcription in yeast [17]. In the version that we used, both fusion moieties are expressed from promoters that are repressed in glucose so that their expression can be repressed during construction and amplification of the arrays [18]. Previous results have shown that this prevents the loss of genes encoding proteins that are toxic to yeast, and that interactions involving such proteins can be detected by inducing their expression only on the final indicator media [18,19]. The ORFs were subcloned into the two vectors by recombination in yeast as previously described [3,6], and the yeast transformants were arrayed in a 96-well format. The resulting BD and AD arrays each have approximately 12,000 yeast strains, over 85% of which have a full-length Drosophila ORF insert (see Materials and methods). For all strains involved in an interaction reported here, the plasmid was isolated and the insert was sequenced to verify the identity of the ORF. As a first step toward generating a LexA-based protein-interaction map, we chose 152 BD-fused proteins that were either known or homologous to regulators of the cell cycle or DNA damage repair (see Additional data file 2). We used all 152 proteins as 'baits' to screen the 12,000-member AD array. We used a pooled mating approach [19] in which individual BD bait strains are first mated with pools of 96 AD strains. For pools that are positive with a particular BD, the corresponding 96 AD strains are then mated with that BD in an array format to identify the particular interacting AD protein(s). We had previously shown that this approach is very sensitive and allows detection of interactions involving proteins that are toxic to yeast or BD fused proteins that activate transcription on their own [19]. Moreover, the final assay in this approach is a highly reproducible one-on-one assay between an AD and a BD strain, in which the reporter gene activities are recorded to provide a semi-quantitative measure of the interaction. Using this approach we detected 1,641 reproducible interactions involving 93 of the bait proteins. We also performed library screening [6] with a subset of the 152 baits that did not activate the reporter genes on their own. This resulted in the detection of 173 additional interactions with 57 bait proteins. Thirty-nine interactions were found by both approaches, and these involved 21 of the 44 BD genes active in both approaches. There were 95 BD genes for which interaction data was obtained by the pooled mating approach, and 59 active BD genes in the library screening approach. The average number of interactions was 18 per BD gene in the pooled mating data, while the library screening data had an average of only four interactions per active BD gene. The average level of reporter activation for the 39 interactions that were detected in both screens was significantly higher than the average of all interactions (see Additional data file 3), suggesting that the weaker interactions are more likely to be missed by one screen or another, even though they are reproducible once detected. Altogether we detected interactions with 106 of the 152 baits, which resulted in a protein-interaction map with 1,814 unique interactions among the products of 488 genes (see Additional data file 3). The map includes interactions that were already known or that could be predicted from known orthologous or paralogous interactions (see below). The map also includes a large number of novel interactions, including many involving functionally unclassified proteins. Evaluation of the LexA-based protein interaction map As is common with data derived from high-throughput screens, the number of novel interactions detected was large, making direct in vivo experimental verification impracticable. Thus, we set out to assess the quality of the data by examining the topology of the interaction map, by looking for enrichment of genes with certain functions, and by comparing the LexA map with other datasets. First we examined the topology of the interaction map, because recent studies have shown that cellular protein networks have certain topological features that correlate with biological function [20]. In our interaction map, the number of interactions per protein (k) varies over a broad range (from 1 to 84) and the distribution of proteins with k interactions follows a power law, similar to previously described protein networks [6,21]. Most (98%) of the proteins in the map are linked together into a single network component by direct or indirect interactions (Figure 1a). The network has a small-world topology [22], characterized by a relatively short average distance between any two proteins (Table 1) and highly interconnected clusters of proteins. Removal of the most highly connected proteins from the map does not significantly fragment the network, indicating that the interconnectivity is not simply due to the most promiscuously interacting proteins (Figure 1b). In other interaction maps generated with randomly selected baits, proteins with related functions tend to be clustered into regions that are more highly interconnected than is typical for the map as a whole [5,6,16]. Moreover, interactions within more highly interconnected regions of a protein-interaction map tend to be enriched for true positives [6,23-25]. Thus, the overall topology of the interaction map that we generated is consistent with that of other protein networks, and in particular, with the expectation for a network enriched for functionally related proteins. Figure 1. A protein interaction map centered on cell cycle regulators. (a) The entire map includes 1,814 unique interactions (lines) among the proteins encoded by 488 genes (circles). The map has five distinct networks; one network contains 479 (98%) of the proteins, one has three proteins, and three have two proteins (upper right, green circles). (b) The interconnectedness of the map does not depend strongly on the proteins with the most interactions. The map shown comprises data filtered to remove proteins with more than 30 interactions (k > 30), leaving 792 interactions among 343 proteins. This produced only one additional network, which has two proteins (green circles on the left of (b)); 97% of the proteins still belong to a single large network. Further deletion of proteins with k > 20 removes an additional 469 interactions, which creates only four additional small networks and leaves 85% of the proteins in a single network (data not shown). A high-resolution version of this figure with live links to gene information can be drawn using a program available at [47]. Table 1. Comparison of Drosophila protein-interaction maps generated by high-throughput yeast two-hybrid methods Next we assessed the list of proteins in the interaction map to look for enrichment of proteins or pairs of proteins with particular functions. An interaction map with a high rate of biologically relevant interactions should have a high frequency of interactions between pairs of proteins previously thought to be involved in the same biological process. Among the 488 proteins in the map, 153 have been annotated with a putative biological function using the Gene Ontology (GO) classification system [26,27]. Because we used a set of BD fusions enriched for cell-cycle and DNA metabolic functions, we expected to see similar enrichments in the list of interacting AD fusions, as well as more interactions between genes with these functions. Both of these expectations are borne out. In the list of BD genes, both cell-cycle and DNA metabolism functions are enriched approximately 17-fold compared to similarly sized lists of randomly selected proteins (P < 0.00002). In the AD list, these two functions are enriched four- and threefold, respectively (Table 2). The frequency with which interactions occur between pairs of proteins annotated for DNA metabolism is five times more than expected by chance; similarly, cell-cycle genes interact with each other six times more frequently than expected (P < 0.001). Thus, the enrichment for proteins and pairs of interacting proteins annotated with the same function suggests that many of the novel interactions will be biologically significant. It also suggests that the map will be useful for predicting the functions of novel proteins on the basis of their connections with proteins having known functions, as described for other interaction maps [16,28]. Table 2. Enrichment of the most frequently classified gene functions Comparison of the Drosophila protein-interaction maps Direct comparison of the LexA cell-cycle map with the Gal4 data revealed that only 28 interactions were found in common between the two screens (Table 1). Moreover, more than a quarter of the proteins in the LexA map were absent from the Gal4 proteome-wide map. Among the 106 baits that had interactions in the LexA map, for example, 60 failed to yield interactions in the Gal4 proteome-wide map, even though all but six of these were successfully cloned in the Gal4 arrays [6] (see Additional data file 6). Similarly, 46 of the 152 LexA baits that we used failed to yield interactions from our work, yet 14 of these had interactions in the Gal4 map. Thus, the lack of overlap between the two datasets is partly due to their unique abilities to detect interactions with specific proteins. Nevertheless, for the 347 proteins common to both maps, the two screens combined to detect 1428 interactions, and yet only 28 of these were in both datasets. This indicates that the two screens detected mostly unique interactions even among the same set of proteins. Comparison with a set of approximately 2,000 interactions recently generated in an independent two-hybrid screen [29] showed only three interactions in common with our data, in part because only eight of the same bait proteins were used successfully in both screens. Although only 28 interactions were found in both the Gal4 map and our map, this rate of overlap is significantly greater than expected by chance (p < 10-6; Table 1). To show this, we generated 106 random networks having the same BD proteins, total interactions and topology as the LexA map, and found that none of these random maps shared more than two interactions in common with the Gal4 map. To assess the relative quality of the 28 common interactions we used the confidence scores assigned to them by Giot et al. [6]. They used a statistical model to assign confidence scores (from 0 to 1), such that interactions with higher scores are more likely to be biologically relevant than those with lower scores. The average confidence scores of the 28 interactions in common with our LexA data (0.63), was higher than the average for all 20,439 Gal4 interactions (0.34), or for random samplings of 28 Gal4 interactions (0.32; P < 0.0001), indicating that the overlap of the two datasets is significantly enriched for biologically relevant interactions. Thus, the detection of interactions by both systems could be used as an additional measure of reliability. The surprisingly small number of common interactions, however, severely limits the opportunities for cross-validation, and suggests that both datasets are far from comprehensive. An alternative explanation for the small proportion of common interactions is the possible presence of a large number of false positives in one or both datasets. The estimation of false-positive rates is challenging, in part because it is difficult to prove that an interaction does not occur under all in vivo conditions, and also because the number of potential false positives is enormous. Nevertheless, the relative rates of false positives between two datasets can be inferred by comparing their estimated rates of true positives [11-13]. To compare true-positive rates between the LexA and Gal4 datasets, we looked for their overlap with several datasets that are thought to be enriched for biologically relevant interactions (Table 3). These include a reference set of published interactions involving the proteins that were used as baits in both the LexA and Gal4 screens; interactions between the Drosophila orthologs of interacting yeast or worm proteins (orthologous interactions or 'interlogs' [30,31]); and between proteins encoded by genes known to interact genetically, which are more likely to physically interact than random pairs of proteins [32,33]. As expected, the overlap with these datasets is enriched for higher confidence interactions. The average confidence scores for the Gal4 interactions in common with the yeast interlogs, worm interlogs and Drosophila genetic interactions are 0.63, 0.68 and 0.80, respectively, substantially higher than the average confidence scores for all Gal4 interactions (0.34). This supports the notion that these datasets are enriched for true-positive interactions relative to randomly selected pairs of proteins. We found that the fractions of LexA- and Gal4-derived interactions that overlap with these datasets are similar (Table 3). For example, 25 (1.4%) of the 1814 LexA interactions and 294 (1.4%) of the 20,439 Gal4 interactions have yeast interlogs. This suggests that the LexA and Gal4 two-hybrid datasets have similar percentages of true positives, and thus similar rates of false positives. They also appear to have similar rates of false negatives, which may be over 80% if calculation is based on the lack of overlap with published interactions (Table 3). This supports the explanation that the main reason for the lack of overlap between the datasets is that neither is a comprehensive representation of the interactome, and suggests that a large number of interactions remain to be detected. Table 3. Overlap of two-hybrid data with datasets enriched for true positives Biologically informative interactions Further inspection of the LexA cell-cycle interaction map revealed biologically informative interactions and additional insights for interpreting high-throughput two-hybrid data. For example, we expected to observe interactions between cyclins and cyclin-dependent kinases (Cdks), which have been shown to interact by a number of assays. Our interaction map includes six proteins having greater than 40% sequence identity to Cdk1 (also known as Cdc2). A map of all the interactions involving these proteins reveals that they are multiply connected with several cyclins (Figure 2). For example, all of the known cyclins in the map interacted with at least two of the Cdk family members. The map includes 20 interactions between five Cdks and six known cyclins plus one uncharacterized protein, CG14939, which has sequence similarity to cyclins. Only one of these interactions (Cdc2c-CycJ) is known to occur in vivo [34], and several others are thought not to occur in vivo (for example Cdc2-CycE [35]). Similarly, the Gal4 interaction map has three Cdk-cyclin interactions [6], including one known to occur in vivo (Cdk4-CycD) and two that do not occur in vivo [35]. Figure 2. A map of the interactions involving cyclin-dependent kinases (Cdks). All the interactions involving at least one of the six Cdks (Cdc2, Cdc2c, Cdk4, Cdk5, Cdk7) and Eip63E (red nodes) are shown. All the Cdks except Cdk7 interacted with at least two cyclins (red text). All the cyclins interacted with at least two Cdks, with the exception of the novel cyclin-like protein CG14939, which only interacted with Eip63E. Other known or paralogous interactions include, Cdc2c-dap, Cdc2-twe, and the interactions of Cdc2 and Cdc2c with CG9790, a Cks1-like protein. Proteins are depicted according to whether they appear in the map only as BD fusions (squares), only as AD fusions (circles), or as both BD and AD fusions (triangles). Proteins connected to more than one Cdk are green. Interactions are colored if they involve proteins contacting two Cdks (red), three Cdks (blue), or five Cdks (green). Thus, while some of these interactions are false positives in the strictest sense, the data is informative nevertheless, as it clearly demonstrates a high incidence of paralogous interactions - where pairs of interacting proteins each have paralogs, some combinations of which also interact in vivo. Such patterns are consistent with potential interactions between members of different protein families, even though they do not reveal the precise pair of proteins that interact in vivo. This class of informative false positives may be common in two-hybrid data where the interaction is assayed out of biological context. Experimentally reproducible interactions, whether or not they occur in vivo, can be used to discover interacting protein motifs or domains [6,36]. They can also suggest functional relationships between protein families and guide experiments to establish the actual in vivo interactions and functions of specific pairs of interacting proteins. The Cdk subgraph also illustrates that proteins with similar interaction profiles may have related functions or structural features. To look for other groups of proteins having similar interaction profiles we used a hierarchical clustering algorithm to cluster BD and AD fusion proteins according to their interactions (see Materials and methods). The resulting clustergram reveals several groups of proteins with similar interaction profiles (Figure 3). One of the most prominent clusters (Figure 3, circled in blue) includes three related proteins involved in ubiquitin-mediated proteolysis, SkpA, SkpB and SkpC. Skp proteins are known to interact with F-box proteins, which act as adaptors between ubiquitin ligases, known as SCF (Skp-Cullin-F-box) complexes, and proteins to be targeted for destruction by ubiquitin-mediated proteolysis [37]. A map of the interactions involving the Skp proteins shows a group of 21 AD proteins that each interact with two or three of the Skp proteins (Figure 4). This group is highly enriched for F-box proteins, including 13 of the 15 F-box proteins in the AD list; the other two F-box proteins interacted with only one Skp (Figure 4). Several of the interactions in common with the Gal4 data are also in the Skp cluster, and 12 out of 16 of these involve proteins that interact with two or more Skp proteins. Figure 3. Proteins clustered by their interaction profiles. BD fused proteins (y-axis) and AD fused proteins (x-axis) were independently clustered according to the similarities of their interaction profiles using a hierarchical clustering algorithm (see Materials and methods). An interaction between a BD and AD protein is indicated by a small colored square. The squares are colored according to the level of two-hybrid reporter activity, which is the sum of LEU2 (0-3) and lacZ (0-5) scores, where higher scores indicate more reporter activity (1, yellow; 5+, red). The cluster circled in blue (center) corresponds to interactions involving SkpA, SkpB and SkpC BD fusions, which are mapped in Figure 4. Maps of other clusters (circled in green) are shown in Additional data file 7. The large cluster at upper left is due primarily to AD proteins that interact with many different BD proteins. A larger version of the figure with the gene names indicated in the axes is in Additional data file 8. Figure 4. A map of the interactions in the Skp cluster. All the interactions with the BD fusions SkpA, SkpB and SkpC, are shown. Proteins (green) interacting with more that one Skp paralog are enriched for proteins possessing an F-box domain (red text). Other colors and shapes are as in Figure 2. Thus, the Skp cluster provides another example of how proteins with similar interaction profiles may be structurally or functionally related, and how such clusters may be enriched for biologically relevant interactions. This is consistent with previous results showing that protein pairs often have related functions if they have a significantly larger number of common interacting partners than expected by chance [24,38]. These groups of proteins are likely to be part of more extensive functional clusters that could be identified by more sophisticated topological analyses (for example [39-44]. Maps showing several other major clusters derived from the cluster-gram are shown in Additional data file 7. The interaction profile data is statistically confirmed by domain-pairing data, which shows that certain pairs of domains are found within interacting pairs of proteins more frequently than expected by chance (Table 4). These include the Skp domain and F-box pair, the protein kinase and cyclin domains, and several less obvious pairings. For example, the cyclin and kinase domains are observed to be associated with various zinc-finger and homeodomain proteins, and the kinase domain with a number of nucleic-acid metabolism domains (Table 4). A similar analysis of the Gal4 data, performed by Giot et al. [6], revealed a number of significant domain pairings, including the Skp/F-box and the kinase/cyclin pairs and several others found in the LexA dataset. Therefore, although the number of proteins in the LexA dataset is relatively small, domain associations are observed in the data, demonstrating that a high-density interaction map, with a high average number of interactions per protein, provides insight into patterns of domain interactions that is equally valuable as that obtained from a proteome-wide map. Table 4. Domain pair enrichment Discussion Proteome-wide maps depicting the binary interactions among proteins provide starting points for understanding protein function, the structure and function of protein complexes, and for mapping biological pathways and regulatory networks. High-throughput approaches have begun to generate large protein-interaction maps that have proved useful for functional studies, but are also often plagued by high rates of false positives and false negatives. Several analyses have shown that the set of interactions detected by more than one high-throughout approach is enriched for biologically relevant interactions, suggesting that the application of multiple screens to the same set of proteins results in higher-confidence, cross-validated interactions [11-13]. Such cross-validation has been limited, however, by the lack of overlap among high-throughput datasets. Here we describe initial efforts to complement a recently published Drosophila protein interaction map that was generated using the Gal4 yeast two-hybrid system [6]. We constructed yeast arrays for use in the LexA-based two-hybrid system by subcloning approximately 12,000 Drosophila ORFs, using the same PCR amplification products used in the Gal4 project, into the LexA two-hybrid vectors. Initially, we used a novel pooled mating approach [19] to screen one of the 12,000-member arrays with 152 bait proteins related to cell cycle regulators. By using both a different screening approach and a different two-hybrid system, we expected to increase coverage and to validate some of the interactions detected by the Gal4 screens. The level of coverage for a high-throughput screen can be estimated by determining the percentage of a reference dataset that was detected; reference sets have been derived from published low-throughput experiments, for example, which are considered to have relatively low false-positive rates. High-throughput two-hybrid data for yeast and C. elegans proteins were shown to cover only about 10-13% of the corresponding reference datasets [5,10,13]. Two factors may contribute to this lack of coverage. First, some interactions cannot be detected using the yeast two-hybrid system, even though they could be detected in low-throughput studies using other methods. Examples include interactions that depend on certain post-translational modifications, that require a free amino terminus or that involve membrane proteins. Second, high-throughput yeast two-hybrid screens often fail to test all possible combinations of interactions; in other words, the screens are not saturating or complete. Although the relative contribution of these two factors is difficult to estimate, results from screens to map interactions among yeast proteins suggest that the major reason for the lack of coverage is that the screens are incomplete. Complete screens would identify all interactions that could possibly be detected by a given method; ideally therefore, two complete screens using the same method would identify all the same interactions. However, the rate of overlap among the different yeast proteome screens is low, even though they used very similar two-hybrid systems. Moreover, the overlap between screens is not significantly greater than the rate at which they overlap any reference set [4,10]. This is true even when only higher-confidence interactions are considered; for example, two large interaction screens of yeast proteins detected 39% and 65% of a higher-confidence dataset, respectively, but only 11% of the reference set was detected by both screens [12]. These results indicate that the lack of coverage in high-throughput two-hybrid data is largely due to incomplete screening, and that significantly larger datasets than those currently available will be needed before different datasets can be used to cross-validate interactions. The rates of coverage and completeness from our high-throughput two-hybrid screening with Drosophila proteins are consistent with those for the yeast proteins. We used the LexA system to detect 1,814 reproducible interactions to complement the 20,439 interactions previously detected in a proteome-wide screen using the Gal4 system [6]. The overlap between the LexA and Gal4 screens is less than 2% of each dataset, whereas their overlap with a reference set was 17% and 14%, respectively, and only 2% of the reference set was detected by both screens (Table 2). Taken together, these results suggest that, like the yeast interaction data, both Drosophila datasets are far from complete and that many more interactions could be detected by additional two-hybrid screening. The actual number of interactions that might be detected by complete two-hybrid screening might be roughly estimated from the partially overlapping datasets, as was performed for accurate estimation of the number of genes in the human genome [45,46]. In this approach, the overlap of two subsets, given that one subset is a homogeneous random sample of the whole, is sufficient to estimate the size of the whole. To make such an estimate with high-throughput two-hybrid data, however, it is necessary to first filter out false positives, as they are mostly different for the two datasets, as suggested by the fact that the nonoverlapping data has a lower rate of true positives than the overlapping data. Giot et al. estimated that at least 11% of the Gal4 interactions are likely to be biologically relevant, based on the prediction accuracy of their statistical model [6]. We found by comparison with other datasets that the rates of true positives are not substantially different between the LexA and Gal4 data (Table 3). Thus, if we use 11% as the minimal rate of true positives in each dataset, we obtain 200 true interactions from the LexA screen and 2,248 from the Gal4 screens. If we further assume that all of the 28 common interactions are true positives, we can estimate that complete screens should be able to detect around 16,000 true positive interactions (200 × 2,248/28). If each screening approach has a false-positive rate of 89%, then around 150,000 interactions from each approach would be required in order to create complete, cross-validating datasets, where the overlap would be comprised of true positives. This estimate is highly sensitive to both the frequency of true positives in the two datasets, and the number of positives in the overlap between the datasets; for example, if true-positive frequency is underestimated by only twofold, there will be four times as many interactions. False-positive interactions have been classified as technical or biological [5]. A technical false positive is an artifact of the particular interaction assay, and the two proteins involved do not actually interact under any setting. A biological false positive is one in which the two proteins genuinely and reproducibly interact in a particular assay, but the interaction does not take place in a biological setting; for example, the interacting proteins may never be temporally or spatially co-localized in vivo. Using the approach described here, the interactions are shown to be reproducible during the one-on-one two-hybrid assays that are used to record reporter activity scores, suggesting that we have minimized the frequency of technical false positives. We suggest that the biological false positives might be further classified as informative and non-informative. Informative false positives are interactions that do not occur in vivo, but that nevertheless have some biological basis for being detected and are potentially useful for guiding future experiments. In our data, for example, the Cdk and Skp proteins each interact with a different group of targets, which in turn interact with multiple Cdk or Skp proteins. From this data alone, we would accurately predict that Cdk proteins interact with cyclins, and that Skp proteins interact with F-box proteins, even though only some of the specific combinations are true in vivo partners. Similarly, from analysis of domain pairs in the LexA dataset, other patterns are evident, such as homeobox domains being associated with both protein kinase and cyclin domains (Table 4). Additional information or experimentation would be needed to determine which of the specific paralogous interactions function in vivo. Co-affinity purification, for example, might be used to directly test all possible pairs of paralogous interactions implied by the two-hybrid map. Alternatively, the genes encoding each possible pair of proteins could be examined for correlated expression patterns, for example, to suggest more likely pairs or to exclude pairs that are not coexpressed. Conclusions We used high-throughput screening to detect 1,814 protein interactions involving many proteins with cell-cycle and related functions. The resulting interaction map is similar in quality to other large interaction maps and is predominated by previously unidentified interactions. The majority of the proteins in the map have not been assigned a biological function, and the map provides a first clue about the potential functions of these proteins by connecting them with characterized proteins or pathways. High-throughput interaction data such as this should allow researchers to quickly identify possible patterns of protein interactions for use in selecting additional functional assays to perform on their gene(s) of interest. This narrows down the number of potential assays necessary to establish function for a given gene from hundreds to just a handful; conversely, when studying a specific function, such as the cell cycle, interaction data can identify which few genes, selected from thousands, may have a role in the process. Just as the sequencing of various genomes has not allowed unambiguous ascription of biological function to the majority of the identified genes, mapping of an interactome by high-throughput methods does not allow final assignment of interaction capacity or of higher functionality to a protein. This requires additional experiments, guided by these and other high-throughput data. The results presented here show that extending and combining different two-hybrid datasets will allow further refinement of the selection of functional analyses to be performed for each protein of the proteome. Materials and methods Plasmids and strains Yeast two-hybrid vectors used are related to those originally described for the LexA system [17]. The vector for expressing amino-terminal LexA DNA-binding domain (BD) fusions was pHZ5-NRT, which expresses fusions from the regulated MAL62 promoter [18]. The vector for expressing amino-terminal activation domain (AD) fusions from the GAL1 promoter was pJZ4-NRT, which was constructed from pJG4-5 [17] by replacing the ADH1 terminator with the CYC1 terminator and inserting the 5' and 3' recombination tags (5RT1 and 3RT1 [18]) into the cloning site downstream from the AD coding region. Construction details can be found in Additional data file 1. Maps and sequences are available at [47]. Yeast (S. cerevisiae) strain RFY231 (MAT trp1::hisG his3 ura3-1 leu2::3Lexop-LEU2) and RFY206 (Mata his3Δ200 leu2-3 lys2Δ201 ura3-52 trp1Δ::hisG) were previously described [2,48]. RFY206 containing the lacZ reporter plasmid pSH18-34 [49] is referred to here as strain Y309. Yeast two-hybrid arrays Two yeast arrays were constructed by homologous recombination (gap repair) in yeast [3]. We began with the 13,393 unique PCR products, which were generated using gene-specific primer pairs corresponding to the predicted Drosophila ORFs, from ATG to stop codon, described in Giot et al. [6]. For the AD array, we co-transformed RFY231 with each PCR product along with pJZ4-NRT that had been linearized with EcoRI and BamHI, and selected recombinants on glucose minimal media lacking tryptophan. Five colonies from each transformation were picked and combined into a well of a 96-well plate. For the BD array, we co-transformed Y309 with each PCR product along with pHZ5-NRT that had been linearized with EcoRI and BamHI, and selected recombinants on glucose minimal medium lacking histidine and uracil. BD clones used in the screens and AD clones showing positive interactions were sequenced to verify the ORF identities. See Additional data files for details. Two-hybrid screening The BD fused proteins used as baits in our screens are listed in Additional data file 2. The AD array was screened using a two-phase pooled mating approach [19]. First, pools containing the 96 AD strains from each plate in the AD array were constructed by scraping strains grown on agar plates, dispersing in 15% glycerol, and aliquoting into a 96-well format; the 142 pools, representing approximately 13,000 AD strains, were arrayed on two 96-well plates. In the first phase, individual BD strains were mated with the 142 AD pools by dispensing 5-μl volumes of each culture onto YPD plates using a Biomek FX robot (Beckman Coulter). After 2 days growth at 30°C, yeast were replicated to medium selective for diploids, which have the AD, BD and lacZ reporter plasmids, and containing both galactose and maltose to induce expression of the AD and BD fusions, respectively. The plates also lacked leucine to assay for expression of the LEU2 reporter, and contained X-Gal (40 μg/ml) to assay for expression of lacZ. These plates were photographed after 5 days at 30°C and interactions were scored as described [19]. In the second phase of screening, single BD strains were mated with the appropriate panel(s) of 93 AD strains corresponding to the pools that were positive in the first phase. The LEU2 and lacZ reporters were assayed on separate plates: growth on plates lacking leucine was scored from 0 (no growth) to 3 (heavy growth); the extent of blue on the X-Gal plates was scored from 0 (white) to 5 (dark blue). After re-testing interactions (see Additional data files) the AD plasmids from interacting AD strains were rescued in bacteria and clones were sequenced to verify insert identity. Cloned plasmids were then reintroduced into RFY231 and used in all possible combinations of one-on-one mating operations with the appropriate BD strains to repeat the interaction assay a third time. The same set of BDs was also used to screen a pool of all approximately 13,000 AD strains using a library screening approach as described in the Additional data files. All interaction data from both screens are listed in Additional data file 3 and are also available at [47,50] and at IntAct [51] in the Proteomics Standards Initiative - Molecular Interactions (PSI-MI) standard exchange format [52]. Data analysis The interaction profiles for the BD fused proteins and AD fused proteins were independently clustered and are plotted in Figure 3 using Genespring software (Silicon Genetics). Protein-interaction map graphs in Figures 1, 2 and 4 and Additional data file 7 were drawn with a program developed by Lana Pacifico (L. Pacifico, F. Fotouhi and R.L.F., unpublished work) available at [47]. To determine Drosophila interlogs of yeast or worm interactions, a list of Drosophila proteins belonging to eukaryotic clusters of orthologous groups (KOGs) [53] was obtained from the National Center for Biotechnology Information (NCBI) [54]. Each fly protein was assigned one or more KOG IDs, based on the cluster(s) to which it belongs. A list of interactions among yeast (S. cerevisiae) proteins, derived mostly from high-throughput yeast two-hybrid screens [4,55] and from the determination of proteins in precipitated complexes [56,57], was obtained from the Comprehensive Yeast Genome Database [58,59]. For the interactions determined by precipitation of complexes, two lists were generated. One list includes the binary interactions between the bait protein and every protein that was co-precipitated, but not between the precipitated proteins (hub and spoke model). The second list included all possible binary interactions among the members of a complex (matrix model). The lists were each used to generate a list of interactions between KOG pairs, which in turn was used to generate a list of potential interactions between pairs of Drosophila proteins belonging to those KOGs. Similarly, Drosophila-worm (C. elegans) interlogs were determined using the list of interactions between worm proteins determined by high-throughput yeast two-hybrid screening [5]. Drosophila genetic interactions were obtained from Flybase [27,60]. To compare the two-hybrid data with other datasets we generated random interaction maps having the same BD proteins, total interactions and topological properties as the LexA or Gal4 data. The AD clones in each interaction list were indexed, an array of the same number of genes as the AD clones was randomly fetched from the Drosophila Release 3.1 genome [61] and these genes were used to replace the original AD clones at the same indexed positions. Fifty thousand such random networks were generated for each two-hybrid dataset, and then compared with the yeast interlogs, worm interlogs, and genetic interactions to determine the amount of overlap expected by chance. P values represented the number of times that the observed number of overlapping interactions was detected in 50,000 iterations of a random network, divided by 50,000. In most cases P < 0.0002 (see Additional data file 6). Additional methods are in Additional data file 1. To compare the number of common interactions between the LexA and Gal4 maps with the number expected by chance, we generated 106 random LexA maps and found that they never contained more than two interactions in common with the Gal4 map; thus, the P-value for the 28 common interactions is significantly less than 10-6. Additional data files The following additional data are available with the online version of this paper. Additional data file 1 contains Supplementary materials and methods; Additional data file 2 contains Supplementary Table 1, BD 'baits' used in the LexA screens; Additional data file 3 contains Supplementary Table 2, Interactions detected in the LexA screens; Additional data file 4 contains Supplementary Table 3, Enrichment of Gene Ontology classes, complete list; Additional data file 5 contains Supplementary Table 4, Enrichment of Domain pairs, complete list; Additional data file 6 contains Supplementary Table 5, P-values for overlap among datasets, and Supplementary Table 6, Interactions from the LexA and Gal4 screens that successfully used the same BD bait proteins; Additional data file 7 is a PDF containing Supplementary Figure 1, Interaction maps of other clusters; Additional data file 8 is a PDF containing Supplementary Figure 2, Proteins clustered by interaction profile; Additional data file 9 contains the legends to Supplementary Figures 1 and 2. Additional data file 1. Supplementary Materials and methods Format: RTF Size: 74KB Download file Additional data file 2. Supplementary Table 1: BD 'baits' used in the LexA screens Format: XLS Size: 85KB Download file This file can be viewed with: Microsoft Excel Viewer Additional data file 3. Supplementary Table 2: Interactions detected in the LexA screens Format: XLS Size: 583KB Download file This file can be viewed with: Microsoft Excel Viewer Additional data file 4. Supplementary Table 3: Enrichment of Gene Ontology classes (the complete list) Format: XLS Size: 36KB Download file This file can be viewed with: Microsoft Excel Viewer Additional data file 5. Supplementary Table 4: Enrichment of Domain pairs (the complete list) Format: XLS Size: 1.1MB Download file This file can be viewed with: Microsoft Excel Viewer Additional data file 6. Supplementary Table 5: P-values for overlap among datasetsa nd Supplementary Table 6: Interactions from the LexA and Gal4 screens that successfully used the same BD bait proteins Format: PDF Size: 35KB Download file This file can be viewed with: Adobe Acrobat Reader Additional data file 7. Supplementary Figure 1: Interaction maps of other clusters Format: PDF Size: 463KB Download file This file can be viewed with: Adobe Acrobat Reader Additional data file 8. Supplementary Figure 2: Proteins clustered by interaction profile Format: PDF Size: 272KB Download file This file can be viewed with: Adobe Acrobat Reader Additional data file 9. The legends to Supplementary Figures 1 and 2 Format: DOC Size: 21KB Download file This file can be viewed with: Microsoft Word Viewer Acknowledgements We thank Ari Firestone for developing the array of AD pools and members of the Finley laboratory for helpful discussions and technical assistance. We also thank Kyle Gardenour and Jodi Parrish for critical comments on the manuscript. We are particularly grateful to Mike McKenna for his help in the initial stages of this project. This work was supported by NIH grants HG01536 and GM62403. References 1. Fields S, Song O: A novel genetic system to detect protein-protein interactions. Nature 1989, 340:245-246. PubMed Abstract \| Publisher Full Text 2. Finley RL Jr, Brent R: Interaction mating reveals binary and ternary connections between Drosophila cell cycle regulators. Proc Natl Acad Sci USA 1994, 91:12980-12984. PubMed Abstract \| Publisher Full Text \| PubMed Central Full Text 3. Hudson JR Jr, Dawson EP, Rushing KL, Jackson CH, Lockshon D, Conover D, Lanciault C, Harris JR, Simmons SJ, Rothstein R, Fields S: The complete set of predicted genes from Saccharomyces cerevisiae in a readily usable form. Genome Res 1997, 7:1169-1173. PubMed Abstract \| Publisher Full Text 4. Uetz P, Giot L, Cagney G, Mansfield TA, Judson RS, Knight JR, Lockshon D, Narayan V, Srinivasan M, Pochart P, et al.: A comprehensive analysis of protein-protein interactions in Saccharomyces cerevisiae. Nature 2000, 403:623-627. PubMed Abstract \| Publisher Full Text 5. Li S, Armstrong CM, Bertin N, Ge H, Milstein S, Boxem M, Vidalain PO, Han JD, Chesneau A, Hao T, et al.: A map of the interactome network of the metazoan C. elegans. Science 2004, 303:540-543. PubMed Abstract \| Publisher Full Text 6. Giot L, Bader JS, Brouwer C, Chaudhuri A, Kuang B, Li Y, Hao YL, Ooi CE, Godwin B, Vitols E, et al.: A protein interaction map of Drosophila melanogaster. Science 2003, 302:1727-1736. PubMed Abstract \| Publisher Full Text 7. Rain JC, Selig L, De Reuse H, Battaglia V, Reverdy C, Simon S, Lenzen G, Petel F, Wojcik J, Schachter V, et al.: The protein-protein interaction map of Helicobacter pylori. Nature 2001, 409:211-215. PubMed Abstract \| Publisher Full Text 8. McCraith S, Holtzman T, Moss B, Fields S: Genome-wide analysis of vaccinia virus protein-protein interactions. Proc Natl Acad Sci USA 2000, 97:4879-4884. PubMed Abstract \| Publisher Full Text \| PubMed Central Full Text 9. Bartel PL, Roecklein JA, SenGupta D, Fields S: A protein linkage map of Escherichia coli bacteriophage T7. Nat Genet 1996, 12:72-77. PubMed Abstract \| Publisher Full Text 10. Ito T, Chiba T, Ozawa R, Yoshida M, Hattori M, Sakaki Y: A comprehensive two-hybrid analysis to explore the yeast protein interactome. Proc Natl Acad Sci USA 2001, 98:4569-4574. PubMed Abstract \| Publisher Full Text \| PubMed Central Full Text 11. Bader GD, Hogue CW: Analyzing yeast protein-protein interaction data obtained from different sources. Nat Biotechnol 2002, 20:991-997. PubMed Abstract \| Publisher Full Text 12. Deane CM, Salwinski L, Xenarios I, Eisenberg D: Protein interactions: two methods for assessment of the reliability of high-throughput observations. Mol Cell Proteomics 2002, 1:349-356. PubMed Abstract \| Publisher Full Text 13. von Mering C, Krause R, Snel B, Cornell M, Oliver SG, Fields S, Bork P: Comparative assessment of large-scale data sets of protein-protein interactions. Nature 2002, 417:399-403. PubMed Abstract \| Publisher Full Text 14. Jansen R, Yu H, Greenbaum D, Kluger Y, Krogan NJ, Chung S, Emili A, Snyder M, Greenblatt JF, Gerstein M: A Bayesian networks approach for predicting protein-protein interactions from genomic data. Science 2003, 302:449-453. PubMed Abstract \| Publisher Full Text 15. Fromont-Racine M, Mayes AE, Brunet-Simon A, Rain JC, Colley A, Dix I, Decourty L, Joly N, Ricard F, Beggs JD, Legrain P: Genome-wide protein interaction screens reveal functional networks involving Sm-like proteins. Yeast 2000, 17:95-110. PubMed Abstract \| Publisher Full Text 16. Schwikowski B, Uetz P, Fields S: A network of protein-protein interactions in yeast. Nat Biotechnol 2000, 18:1257-1261. PubMed Abstract \| Publisher Full Text 17. Gyuris J, Golemis E, Chertkov H, Brent R: Cdi1, a human G1 and S phase protein phosphatase that associates with Cdk2. Cell 1993, 75:791-803. PubMed Abstract \| Publisher Full Text 18. Finley RL Jr, Zhang H, Zhong J, Stanyon CA: Regulated expression of proteins in yeast using the MAL61-62 promoter and a mating scheme to increase dynamic range. Gene 2002, 285:49-57. PubMed Abstract \| Publisher Full Text 19. Zhong J, Zhang H, Stanyon CA, Tromp G, Finley RL Jr: A strategy for constructing large protein interaction maps using the yeast two-hybrid system: regulated expression arrays and two-phase mating. Genome Res 2003, 13:2691-2699. PubMed Abstract \| Publisher Full Text \| PubMed Central Full Text 20. Barabasi AL, Oltvai ZN: Network biology: understanding the cell's functional organization. Nat Rev Genet 2004, 5:101-113. PubMed Abstract \| Publisher Full Text 21. Jeong H, Mason SP, Barabasi AL, Oltvai ZN: Lethality and centrality in protein networks. Nature 2001, 411:41-42. PubMed Abstract \| Publisher Full Text 22. Watts DJ, Strogatz SH: Collective dynamics of 'small-world' networks. Nature 1998, 393:440-442. PubMed Abstract \| Publisher Full Text 23. Saito R, Suzuki H, Hayashizaki Y: Interaction generality, a measurement to assess the reliability of a protein-protein interaction. Nucleic Acids Res 2002, 30:1163-1168. PubMed Abstract \| Publisher Full Text \| PubMed Central Full Text 24. Goldberg DS, Roth FP: Assessing experimentally derived interactions in a small world. Proc Natl Acad Sci USA 2003, 100:4372-4376. PubMed Abstract \| Publisher Full Text \| PubMed Central Full Text 25. Bader JS, Chaudhuri A, Rothberg JM, Chant J: Gaining confidence in high-throughput protein interaction networks. Nat Biotechnol 2004, 22:78-85. PubMed Abstract \| Publisher Full Text 26. Ashburner M, Ball CA, Blake JA, Botstein D, Butler H, Cherry JM, Davis AP, Dolinski K, Dwight SS, Eppig JT, et al.: Gene ontology: tool for the unification of biology. The Gene Ontology Consortium. Nat Genet 2000, 25:25-29. PubMed Abstract \| Publisher Full Text 27. FlyBase Consortium: The FlyBase database of the Drosophila genome projects and community literature. Nucleic Acids Res 2003, 31:172-175. PubMed Abstract \| Publisher Full Text \| PubMed Central Full Text 28. Vazquez A, Flammini A, Maritan A, Vespignani A: Global protein function prediction from protein-protein interaction networks. Nat Biotechnol 2003, 21:697-700. PubMed Abstract \| Publisher Full Text 29. Hybrigenics web site [http://www.hybrigenics.com] webcite 30. Yu H, Luscombe NM, Lu HX, Zhu X, Xia Y, Han JD, Bertin N, Chung S, Vidal M, Gerstein M: Annotation transfer between genomes: protein-protein interologs and protein-DNA regulogs. Genome Res 2004, 14:1107-1118. PubMed Abstract \| Publisher Full Text 31. Ge H, Liu Z, Church GM, Vidal M: Correlation between transcriptome and interactome mapping data from Saccharomyces cerevisiae. Nat Genet 2001, 29:482-486. PubMed Abstract \| Publisher Full Text 32. Tong AH, Lesage G, Bader GD, Ding H, Xu H, Xin X, Young J, Berriz GF, Brost RL, Chang M, et al.: Global mapping of the yeast genetic interaction network. Science 2004, 303:808-813. PubMed Abstract \| Publisher Full Text 33. Tewari M, Hu PJ, Ahn JS, Ayivi-Guedehoussou N, Vidalain PO, Li S, Milstein S, Armstrong CM, Boxem M, Butler MD, et al.: Systematic interactome mapping and genetic perturbation analysis of a C. elegans TGF-beta signaling network. Mol Cell 2004, 13:469-482. PubMed Abstract \| Publisher Full Text 34. Kolonin MG, Finley RL Jr: A role for cyclin J in the rapid nuclear division cycles of early Drosophila embryogenesis. Dev Biol 2000, 227:661-672. PubMed Abstract \| Publisher Full Text 35. Lane ME, Sauer K, Wallace K, Jan YN, Lehner CF, Vaessin H: Dacapo, a cyclin-dependent kinase inhibitor, stops cell proliferation during Drosophila development. Cell 1996, 87:1225-1235. PubMed Abstract \| Publisher Full Text 36. Reiss DJ, Schwikowski B: Predicting protein-peptide interactions via a network-based motif sampler. Bioinformatics 2004, 20(Suppl 1):I274-I282. PubMed Abstract \| Publisher Full Text 37. Jackson PK, Eldridge AG: The SCF ubiquitin ligase: an extended look. Mol Cell 2002, 9:923-925. PubMed Abstract \| Publisher Full Text 38. Samanta MP, Liang S: Predicting protein functions from redundancies in large-scale protein interaction networks. Proc Natl Acad Sci USA 2003, 100:12579-12583. PubMed Abstract \| Publisher Full Text \| PubMed Central Full Text 39. Rives AW, Galitski T: Modular organization of cellular networks. Proc Natl Acad Sci USA 2003, 100:1128-1133. PubMed Abstract \| Publisher Full Text \| PubMed Central Full Text 40. Spirin V, Mirny LA: Protein complexes and functional modules in molecular networks. Proc Natl Acad Sci USA 2003, 100:12123-12128. PubMed Abstract \| Publisher Full Text \| PubMed Central Full Text 41. King AD, Przulj N, Jurisica I: Protein complex prediction via cost-based clustering. Bioinformatics 2004. doi:10.1093/bioinformatics/bth351 PubMed Abstract \| Publisher Full Text 42. Bu D, Zhao Y, Cai L, Xue H, Zhu X, Lu H, Zhang J, Sun S, Ling L, Zhang N, et al.: Topological structure analysis of the protein-protein interaction network in budding yeast. Nucleic Acids Res 2003, 31:2443-2450. PubMed Abstract \| Publisher Full Text \| PubMed Central Full Text 43. Bader GD, Hogue CW: An automated method for finding molecular complexes in large protein interaction networks. BMC Bioinformatics 2003, 4:2. PubMed Abstract \| BioMed Central Full Text \| PubMed Central Full Text 44. Gagneur J, Krause R, Bouwmeester T, Casari G: Modular decomposition of protein-protein interaction networks. Genome Biol 2004, 5:R57. PubMed Abstract \| BioMed Central Full Text \| PubMed Central Full Text 45. Ewing B, Green P: Analysis of expressed sequence tags indicates 35,000 human genes. Nat Genet 2000, 25:232-234. PubMed Abstract \| Publisher Full Text 46. Aparicio SA: How to count ... human genes. Nat Genet 2000, 25:129-130. PubMed Abstract \| Publisher Full Text 47. Welcome to the Finley Lab [http://proteome.wayne.edu/finlabindex.html] webcite 48. Kolonin MG, Finley RL Jr: Targeting cyclin-dependent kinases in Drosophila with peptide aptamers. Proc Natl Acad Sci USA 1998, 95:14266-14271. PubMed Abstract \| Publisher Full Text \| PubMed Central Full Text 49. Golemis EA, Serebriiskii I, Finley RL Jr, Kolonin MG, Gyuris J, Brent R: Interaction trap/two-hybrid system to identify interacting proteins. In Current Protocols in Molecular Biology. Volume 20.1. Edited by Ausubel FM, Brent R, Kingston RE, Morre D, Seidman JG, Struhl K. New York: John Wiley & Sons; 1998. 50. FlyGrid [http://biodata.mshri.on.ca/fly_grid/servlet/SearchPage] webcite 51. IntAct Interaction database [http://www.ebi.ac.uk/intact/index.html] webcite 52. Hermjakob H, Montecchi-Palazzi L, Bader G, Wojcik J, Salwinski L, Ceol A, Moore S, Orchard S, Sarkans U, von Mering C, et al.: The HUPO PSI's molecular interaction format - a community standard for the representation of protein interaction data. Nat Biotechnol 2004, 22:177-183. PubMed Abstract \| Publisher Full Text 53. Koonin EV, Fedorova ND, Jackson JD, Jacobs AR, Krylov DM, Makarova KS, Mazumder R, Mekhedov SL, Nikolskaya AN, Rao BS, et al.: A comprehensive evolutionary classification of proteins encoded in complete eukaryotic genomes. Genome Biol 2004, 5:R7. PubMed Abstract \| BioMed Central Full Text \| PubMed Central Full Text 54. NCBI Clusters of Orthologous Groups database [ftp://ftp.ncbi.nih.gov/pub/COG] webcite 55. Ito T, Tashiro K, Muta S, Ozawa R, Chiba T, Nishizawa M, Yamamoto K, Kuhara S, Sakaki Y: Toward a protein-protein interaction map of the budding yeast: a comprehensive system to examine two-hybrid interactions in all possible combinations between the yeast proteins. Proc Natl Acad Sci USA 2000, 97:1143-1147. PubMed Abstract \| Publisher Full Text \| PubMed Central Full Text 56. Ho Y, Gruhler A, Heilbut A, Bader GD, Moore L, Adams SL, Millar A, Taylor P, Bennett K, Boutilier K, et al.: Systematic identification of protein complexes in Saccharomyces cerevisiae by mass spectrometry. Nature 2002, 415:180-183. PubMed Abstract \| Publisher Full Text 57. Gavin AC, Bosche M, Krause R, Grandi P, Marzioch M, Bauer A, Schultz J, Rick JM, Michon AM, Cruciat CM, et al.: Functional organization of the yeast proteome by systematic analysis of protein complexes. Nature 2002, 415:141-147. PubMed Abstract \| Publisher Full Text 58. Mewes HW, Amid C, Arnold R, Frishman D, Guldener U, Mannhaupt G, Munsterkotter M, Pagel P, Strack N, Stumpflen V, et al.: MIPS: analysis and annotation of proteins from whole genomes. Nucleic Acids Res 2004, 32 (Database issue):D41-D44. PubMed Abstract \| Publisher Full Text \| PubMed Central Full Text 59. CYGD: MIPS Comprehensive Yeast Genome Database [http://mips.gsf.de/proj/yeast/CYGD/interaction] webcite 60. Flybase [http://flybase.net] webcite 61. Celniker SE, Wheeler DA, Kronmiller B, Carlson JW, Halpern A, Patel S, Adams M, Champe M, Dugan SP, Frise E, et al.: Finishing a whole-genome shotgun: release 3 of the Drosophila melanogaster euchromatic genome sequence. Genome Biol 2002, 3:research0079.1-0079.14. PubMed Abstract \| BioMed Central Full Text \| PubMed Central Full Text 62. Angermayr M, Bandlow W: RIO1, an extraordinary novel protein kinase. FEBS Lett 2002, 524:31-36. PubMed Abstract \| Publisher Full Text 63. Wallar BJ, Alberts AS: The formins: active scaffolds that remodel the cytoskeleton. Trends Cell Biol 2003, 13:435-446. PubMed Abstract \| Publisher Full Text	v0
2024-06-03T18:26:15.484Z	2013-12-06T05:53:06.000Z	ostwwcz56g6uykirszy6t2jkc2dbgtsy	{ "content_type": "text/html", "provenance": "cccc-CC-MAIN-2013-48-0004.json.gz:14634", "uncompressed_offset": 89154326, "url": "ipkitten.blogspot.com/2012/01/monday-miscellany_09.html", "warc_date": "2014-01-03T03:19:42.000Z", "warc_filename": "<urn:uuid:111902af-34e2-4fd3-ab14-3018733c70c8>", "warc_url": "http://ipkitten.blogspot.com/2012/01/monday-miscellany_09.html" }	cccc_CC-MAIN-2013-48	For the half-year to 31 December 2013, the IPKat's regular team is supplemented by contributions from guest bloggers Miri Frankel, Laetitia Lagarde and Bertrand Sautier Two of our regular Kats are currently on blogging sabbaticals. They are David Brophy and Catherine Lee. Monday, 9 January 2012 Monday miscellany Of Cooks and Turnips. Scott Smith is a man with a mission. Incensed that collection attorney David Cook was granted a US trade mark which conferred exclusive rights to the surname COOK for legal services, he decided to file pro se a petition to cancel it with the Trademark Trial and Appeal Board of the US Patent and Trademark Office. While he was at it, Scott decided to take a pot-shot at another David Cook US mark, SQUEEZEBLOODFROMTURNIP.COM, on the basis that it's "immoral or scandalous" for a collections attorney to own such a mark (the petition to cancel can be read here). Merpel surmises that it's not such a bad idea for just one Cook to monopolise the word, on the basis that ... you've guessed it, too many Cooks spoil the turnip broth. If you're only getting one glass, it may as well be a big one ... This event is coming up so soon that there's no point in listing it on the IPKat's special Fothcoming Events page: it's the Institute of Trade Mark Attorneys (ITMA) Seminar and Drinks Reception with the UK Intellectual Property Office (IPO). This event is hosted by law firm Burges Salmon at One Glass Wharf, Bristol. Says Merpel: this presumably means that if you want a second glass, you'd better bring your own. Full details, for those who wish to have an informal drink with an IPO examiner, are available here. If you miss this event, you can catch up with the itinerant ITMA reception circus a week later when it hits Glasgow in time for Burness Night (no mistake: this event is hosted by Burness LLP). This time there are no examiners to meet; presumably they are all drying out after the Burges Salmon bash the week before. There is however a theme: "To write or not to write? That is the question". Further details are available here. In case you were wondering: Michael Factor really does look like this ... Around the blogs. What message about the America Invents Act are the US judiciary sending out for foreign consumption? The IP Factor reports here on what leading US patent judge Randall Rader has been telling a sharp-witted and enthusiastic audience in Israel. Still in the US, take a look at the Scrivener's Error, where a penetrating beam of creative criticism from the Kat's friend C. E. Petit shows SOPA in a whole new light. Over on the 1709 Blog, the delightfully productive Eleonora Rosati has been reporting on Kopimism and on Groovesharks. Over on the IP Finance blog, fellow Kat Neil Wilkof muses on "gaming the patent system": what does this curious expression mean? On IP Tango, Patricia Covarrubia waxes lyrical on the concept of the Andean trout. Meanwhile, writing for Afro-IP, Kingley Egbuonu admires Malawi's surprising link with Scotland. Finally, the IPKat and Merpel salute Dennis and Jason at PatentlyO on winning the ABA's Favorite Law Blog award for 2011 -- an award that, in the Kats' opinion, is well merited. IPKat reader Kenneth Yip has a good eye for an eyebrow-raising news item. He tells us how, in the vibrant and ever-awake city of Hong Kong, a D&G shop has made the astonishing claim that copyright protection allows it to forbid the local members of the public to take photos of its window display from a pedestrian walk -- a privilege which is open only to luxury goods purchasers from China's mainland (click here for CNN report). Hong Kong copyright law has many fine provisions for the protection of authorship, but this is not apparently among them: shopkeepers and window-dressers have no such power. Is this another unfortunate example of how a few copyright owners abuse the law and give copyright law a bad name? A brilliant way to draw attention to the creative content of one's window display -- or another reason why the man in the street, especially if he is armed with any sort of mobile device that lets him take photos, deserves to know more about copyright law? Subscribe to the IPKat's posts by email here Just pop your email address into the box and click 'Subscribe':	v0
2024-06-03T18:26:15.484Z	2013-12-06T05:46:04.000Z	ptqc3henblhhaiedqxpkjtn7mp6jeggy	{ "content_type": "text/html", "provenance": "cccc-CC-MAIN-2013-48-0004.json.gz:14661", "uncompressed_offset": 132455849, "url": "openwetware.org/index.php?oldid=281147&title=RNA_electrophoresis", "warc_date": "2014-01-03T03:19:42.000Z", "warc_filename": "<urn:uuid:111902af-34e2-4fd3-ab14-3018733c70c8>", "warc_url": "http://openwetware.org/index.php?title=RNA_electrophoresis&oldid=281147" }	cccc_CC-MAIN-2013-48	RNA electrophoresis From OpenWetWare Revision as of 12:19, 30 January 2009 by Jakob Suckale (Talk \| contribs) Jump to: navigation, search Contents Curators Anyone should feel free to add themselves as a curator for this consensus protocol. You do not need to be a curator in order to contribute. Abstract Electrophoresis permits assessment of RNA by size and amount. In general, electrophoresis of RNA is done as a step prior to Northern analysis. Materials List everything necessary to perform the protocol here. Include all information about suppliers, ordering details, etc. Links to the suppliers' page on that material are also appropriate and encouraged. Please be aware that users of this protocol may not be working in the same country as you. Reagents Biological resources e.g. cell lines, buffers (link to a method for making them), enzymes, chemicals, kits, etc. Equipment Any equipment used to perform the protocol (link to a method for using them). Procedure A step by step guide to the experimental procedure. Critical steps • RNA secondary structure can strongly impact how RNA electrophoreses through the gel. Therefore, electrophoresis of RNA is usually done under denaturing conditions. However, to simply assess the presence of RNA and its quality, a native gel might be sufficient. [1] • The choice of gel matrix depends on the size range of RNAs to be analyzed. Use 3-20% polyacrylamide for RNAs < 500bp. For RNAs between 0.5-8.0 kb, use 1.5% denaturing agarose gel. For a larger size range (typically necessary for Northern analysis), use 1.0-1.2% denaturing agarose gel. Troubleshooting Notes • For best resolution, pour gels as thin as possible (0.5-0.75cm is typical especially for efficient blotting later) and run at low voltage. [2] • Tom Knight strongly recommends using glyoxal denaturation rather than formaldehyde denaturation due to the safety issues of formaldehyde. • Many protocols call for recirculation of buffer during electrophoresis of glyoxylated RNA. However, recent electrophoresis buffers (like 10X BPTE electrophoresis buffer) are more stable and do not require this. [3] Acknowledgments Specific Protocols References 1. isbn:0-471-12536-9. [LabGuidetoRNA] 2. isbn:0-12-249695-7. [RNAmethodologies] 3. Molecular Cloning: Separation of RNA According to Size: Electrophoresis of Glyoxylated RNA through Agarose Gels [MolecularCloning1] 4. Molecular Cloning: Separation of RNA According to Size: Electrophoresis of RNA through Agarose Gels Containing Formaldehyde [MolecularCloning2] 5. Northern Hybridization of RNA Denatured by Glyoxal/DMSO Treatment [CurrentProtocols] 6. Agarose Gel Electrophoresis of RNA from Ambion [Ambion] 7. RNA electrophoresis [ProtocolsOnline] Personal tools	v0
2024-06-03T18:26:15.484Z	2013-12-06T05:41:39.000Z	6ngda7s7v5s3vd6hosafag37wup4lbjz	{ "content_type": "text/html", "provenance": "cccc-CC-MAIN-2013-48-0004.json.gz:14672", "uncompressed_offset": 145327470, "url": "quotationsbook.com/quote/24919/", "warc_date": "2014-01-03T03:19:42.000Z", "warc_filename": "<urn:uuid:111902af-34e2-4fd3-ab14-3018733c70c8>", "warc_url": "http://quotationsbook.com/quote/24919/" }	cccc_CC-MAIN-2013-48	Added by staff For love... has two faces; one white, the other black; two bodies; one smooth, the other hairy. It has two hands, two feet, two tails, two, indeed, of every member and each one is the exact opposite of the other. Yet, so strictly are they joined together • 3 This quote is about love. Search on Google Books to find all references and sources for this quotation. A bit about Woolf, Virginia ... Virginia Woolf was an English novelist and essayist regarded as one of the foremost modernist literary figures of the twentieth century. Her most famous works include the novels Mrs Dalloway (1925), To the Lighthouse (1927), and Orlando (1928), and the book-length essay A Room of One's Own (1929). These people bookmarked this quote: Demons-and-Dragons I'm male, say nothing debsringer1222 I'm female, taken saisons I'm female, say nothing This quote around the web Loading...	v0
2024-06-03T18:26:15.484Z	2013-12-06T05:50:49.000Z	6iefuw37r5sh2lwrcnf3lw2ejbbu2m22	{ "content_type": "text/html", "provenance": "cccc-CC-MAIN-2013-48-0004.json.gz:14674", "uncompressed_offset": 148730878, "url": "redsarmy.com/tag/nba-finals-2/page/9/", "warc_date": "2014-01-03T03:19:42.000Z", "warc_filename": "<urn:uuid:111902af-34e2-4fd3-ab14-3018733c70c8>", "warc_url": "http://redsarmy.com/tag/nba-finals-2/page/9/" }	cccc_CC-MAIN-2013-48	NBA FInals Lakers need cash motivation to take charges The Los Angeles Lakers have never been known as a team that takes offensive charges. They are trying to change that. Last series, Phil Jackson called his big men "thin-chested" as a way of goading them into standing strong and taking a hit, and the team has been offering financial incentive — $50 per charge. [...] June 2, 2010 Chuck - Red's Army Uncategorized 28 Celtics/Lakers NBA Finals Preview Schedule: Game 1: Thursday, June 3 Boston at LA, 9 p.m., ABC Game 2: Sunday, June 6 Boston at LA, 8 p.m., ABC Game 3: Tuesday, June 8 LA at Boston, 9 p.m., ABC Game 4: Thursday, June 10 LA at Boston, 9 p.m., ABC Game 5: Sunday, June 13 LA at Boston, 8 p.m., [...] June 2, 2010 Chuck - Red's Army Uncategorized 6 The Lakers game plan for Rondo Jackson said that the Lakers have four players they will put on Rondo at times: Bryant, Derek Fisher, Shannon Brown and Jordan Farmar. Even though Boston's "Big Three" have been transformed to the "Big Four" thanks to Rondo's emergence, Jackson believes that Rondo still falls further down in the pecking order in a controlled game [...] June 2, 2010 Chuck - Red's Army Uncategorized 7 Your Morning Dump… The Zen master strikes again Every morning, we compile the links of the day and dump them here… highlighting the big storyline. Because there’s nothing quite as satisfying as a good morning dump. “We don’t have a smackdown mentality,’’ he said. “You might have seen that with [Kevin] Garnett on [Orlando’s Dwight] Howard in Game 6 in Boston, where he [...] June 1, 2010 Chuck - Red's Army Uncategorized 13 Bynum has a lot of fluid drained from knee Via the LA Times: Lakers center Andrew Bynum had a substantial amount of fluid drained from his right knee Monday, according to a team spokesman. Bynum had almost 2 1/2 ounces removed, after being slowed by torn cartilage in the knee for a little more than a month, an injury that has limited his time and effectiveness [...] May 31, 2010 Chuck - Red's Army Uncategorized 11 Superchoke Courtney Lee is off the hook. Dwight Howard is the new goat of this series. Yes, I know he sucks at free throws. But if Howard makes one of the two freebies with 11 seconds left and Orlando up 3, the Magic win this game. There's no second-guessing Stan Van Gundy for not-fouling the Lakers. [...] June 12, 2009 Chuck - Red's Army Uncategorized 22 Et tu, Larry? You know, I'm having a hard enough time coping with Kobe Bryant's seemingly eventual championship (and the onslaught of Laker trolls that will hit this site)… the last thing I needed was to hear Larry Bird's current favorite player is a Laker. Johnson: Larry Bird told me that Kobe Bryant is his favorite player. How [...] June 5, 2009 RedsArmyAdmin Uncategorized 22 Two States Like Orlando’s Chances Tonight Via ESPN's SportsNation Poll – Which Team will win Game 1 of the NBA Finals? Go Magic!!!! I'm working on the New Hampshire vote. [...] June 4, 2009 Chuck - Red's Army Uncategorized 37 No Confidence in the Magic While I thoroughly enjoyed watching the Orlando Magic manhandle the Cavaliers, deep down, minus all the talk about x's and o's, I doubt their ability to beat the Lakers on the biggest stage in basketball. You can't underestimate just how bad Kobe Bryant wants to redeem himself after last year's embarrassing performance. As for [...] May 31, 2009 Chuck - Red's Army Uncategorized 4	v0
2024-06-03T18:26:15.484Z	2013-12-06T05:58:23.000Z	k2wjzlqtl5yni34eixk7qf2l7cajdylt	{ "content_type": "text/html", "provenance": "cccc-CC-MAIN-2013-48-0004.json.gz:14707", "uncompressed_offset": 197647249, "url": "wikitravel.org/wiki/en/index.php?oldid=643694&title=Tiffin", "warc_date": "2014-01-03T03:19:42.000Z", "warc_filename": "<urn:uuid:111902af-34e2-4fd3-ab14-3018733c70c8>", "warc_url": "http://wikitravel.org/wiki/en/index.php?title=Tiffin&oldid=643694" }	cccc_CC-MAIN-2013-48	Help Wikitravel grow by contributing to an article! Learn how. Tiffin From Wikitravel Northwest Ohio : Tiffin Revision as of 20:06, 20 August 2007 by Workerbee (Talk \| contribs) Jump to: navigation, search Tiffin is a city in Northwest Ohio and part of the United States of America. It is the county seat of Seneca County, a rural county of Ohio. It is also the home to two institutions of higher learning: Tiffin University and Heidelberg College. Understand Once a bustling industrial city, Tiffin's manufacturing base and population has declined in recent decades. However, Tiffin residents enjoy cultural and educational opportunities unmatched by most small towns thanks to the two colleges that that call Tiffin home. The city of Tiffin is bisected by the Sandusky River. Just east of the river is the city's downtown area, including city hall and public library. On the western side of the river, on the outskirts of town is the Wal-Mart, shopping mall, and supermarket. Tiffin itself is seldom a destination for tourists. However, if family or business reasons call you to Tiffin, rest assured you will find activities to fill your time, as well as a friendly small town atmosphere. Get in Driving is the only realistic way to get in. At one time the city was served by frequent rail and bus service; these have been discontinued although freight trains continue to pass through th city at all hours. There is an airport, although no regularly scheduled commercial flights serve Tiffin. Get around Tiffin is a small town and you can easily walk anywhere in the downtown area or through the older neighborhoods. Some newer neighborhoods and shopping malls are on the outskirts of town, requiring a car. Tiffin does have several taxi services available for those who do not drive. See The Tiffin Glass Museum features displays of Tiffin glass including some for sale. Museum employees can explain to you the history of the (now defunct) Tiffin glass works. The Ritz Theater[1] was first opened in 1928 in the opulent style of theaters of that era. Renovated in 1998, the theater is now managed as a not for profit and presents a full schedule of acts. Do • Seneca County Museum, 28 Clay Street. • Tiffin Glass Museum & Shoppe, 25-27 S. Washington St., 1+ 419-448-0200, [2]. Tiffin Glass from 1889-1980. Tu-Sa 1PM-5PM. Hedges-Boyer park is the main city park. A YMCA with indoor pool is located within the park. The park also has a public outdoor pool, playground, and play fields. The park is the site of Tiffin's elaborate 4th of July fireworks display. Buy • The Tiffin Glass Company was famous for its fancy and ornamental glass. The company and factory went out of business in the early 1980's, however the Tiffin Glass Muesum has pieces for sale. • Tiffin is famous for its Ballreich's Potato Chips[3], the original "marcelled" or ridged chips. The potato chip factory is located in Tiffin. The chips can be bought at any local grocery store or supermarket, where potato chips are sold. • Buying necessities from your car at a drive-through grocery store adds a certain amount of charm and kitsch to your purchases. Drive on in at 205 S Sandusky Street, Tiffin, OH (419) 447-6555. Eat Tiffin's 40 or so restaurants are listed on the Seneca County Visitor's Bureau web site [4]. Two restaurants especially worthy of a visit include: The Pioneer Mill Restaurant [5], on the Sandusky river, is located inside a historic mill. The restaurant serves typical American in an upscale casual setting. One can walk across a footbridge from the mill to a small island on the Sandusky river. Occasionally this site is used for concerts and other events in the summer. Unique tidbit: From the restaurant's lower level, one can look through a portal built into the floor and see part of the electrical-generating waterwheel installed years ago. Shell Shuckers Inn is a sports themed restaurant and bar located at the Quality Inn hotel[6]. The hotel is just on the banks of the Sandusky River just outside the city limits. The restaurant features great food in a fun atmosphere. One hallmark of the restaurant is the complimentary peanuts provided to each table; guests are encouraged to drop the peanut shells to the floor. The restaurant also features an excellent breakfast buffet, free to hotel guests. Tiffin also has some ethnic restaurants, including 2 Chinese restaurants and one Mexican restaurant and an Italian restaurant. Drink There's a few bars in town. Sleep Tiffin has a few hotels and motels. Get out You can go to Cedar Point, a major amusement park in Sandusky, Ohio. The Seneca Caverns[7], a cave system in the northwest corner of the county, makes for an ideal trip. This article is an outline and needs more content. It has a template, but there is not enough information present. Please plunge forward and help it grow! Personal tools Namespaces Variants Actions Navigation Feeds Destination Docents Toolbox In other languages	v0
2024-06-03T18:26:15.484Z	2013-12-06T05:55:24.000Z	qq3tcieg2qymmmfty5ohfukwiwmsrldy	{ "content_type": "text/html", "provenance": "cccc-CC-MAIN-2013-48-0004.json.gz:14716", "uncompressed_offset": 208109867, "url": "www.abs.gov.au/AUSSTATS/abs%40.nsf/Lookup/3201.0Explanatory%20Notes1Jun%202010", "warc_date": "2014-01-03T03:19:42.000Z", "warc_filename": "<urn:uuid:111902af-34e2-4fd3-ab14-3018733c70c8>", "warc_url": "http://www.abs.gov.au/AUSSTATS/[email protected]/Lookup/3201.0Explanatory%20Notes1Jun%202010?OpenDocument" }	cccc_CC-MAIN-2013-48	Australian Bureau of Statistics Celebrating the International Year of Statistics 2013 ABS Home > Statistics > By Catalogue Number 3201.0 - Population by Age and Sex, Australian States and Territories, Jun 2010 Quality Declaration Latest ISSUE Released at 11:30 AM (CANBERRA TIME) 21/12/2010 Final Page tools: Print Page Print All RSS Search this Product EXPLANATORY NOTES INTRODUCTION 1 This publication contains estimates of the resident population (ERP) of Australian states and territories by single year of age and by sex as at 30 June of each reference year and include mean ages and sex ratios. The data is based on the 2006 Census of Population and Housing. Estimates up to June 2006 are final based on the results of the 2006 Census of Population and Housing. Estimates for June 2007 and June 2008 have been revised and estimates from June 2009 onwards are preliminary. 2 Following the 1992 amendments to the Acts Interpretation Act to include the Indian Ocean Territories of Christmas Island and the Cocos (Keeling) Islands as part of geographic Australia, population estimates commencing from September quarter 1993 include estimates for these two territories. To reflect this change, another category of the state and territory level has been created, known as Other Territories. Other Territories include Jervis Bay Territory, previously included with the Australian Capital Territory, as well as Christmas Island and the Cocos (Keeling) Islands, previously excluded from population estimates for Australia. Data for Other Territories, while not detailed separately, are included in tables where specifically noted. RESIDENT POPULATION ESTIMATES SERIES 3 Australia’s population estimates for the period since 1971 are compiled according to the place of usual residence of the population. An explanation of the place of usual residence conceptual basis for population estimates is given in Population Estimates: Concepts, Sources and Methods (cat. no. 3228.0.55.001). METHOD OF ESTIMATION 4 The estimates by age of the population of Australia and the states and territories at the date of the census are derived from the census counts by place of usual residence, by adjusting for under-enumeration and adding the number of Australian residents estimated to have been temporarily overseas at the time of the census. 5 Post-censal population estimates are obtained by advancing the previous year's estimates to the next year by subtracting deaths and adding births and net estimated interstate and overseas migration. After each census, estimates for the preceding intercensal period are revised by incorporating an additional adjustment (intercensal discrepancy) to ensure that the total intercensal increase at each age agrees with the difference between the estimated resident populations at the two respective census dates. AVERAGE ANNUAL RATE OF GROWTH 6 The average annual growth rate, r, is calculated as a percentage using the formula: where P0 is the population at the start of the period, Pn is the population at the end of the period and n is the length of the period between Pn and P0 in years. ACCURACY/RELIABILITY 7 It should be noted that while the Australian Bureau of Statistics (ABS) seeks to produce the most accurate estimates of the population possible, the accuracy of the estimates depends on the quality of the source data used. The major source of potential error is considered to be the estimates of interstate migration based on Medicare transfer data. 8 Single year age estimates are not shown for persons aged 85 years or older. The reliability of age estimates decreases as older ages are reached. However, estimates for each age up to 99 and 100 years or more are available in the time series spreadsheets released with this publication. 9 In recognition of the inherent accuracy involved in population estimation, population figures over 1,000 in the text are rounded to the nearest hundred, and figures less than 1,000 are rounded to the nearest ten. While unrounded figures are provided in tables, accuracy to the last digit is not claimed and should not be assumed. ACKNOWLEDGMENT 10 ABS publications draw extensively on information provided freely by individuals, businesses, governments and other organisations. Their continued cooperation is very much appreciated: without it, the wide range of statistics published in the ABS would not be available. Information received by the ABS is treated in strict confidence as required by the Census and Statistics Act 1905. RELATED PRODUCTS 11 Previous issues of this series containing consolidated data were issued on 23 August 1982 (containing estimates for the years 1977 to 1982); 8 December 1987 (containing estimates for the years 1981 to 1987); 21 July 1993 (containing estimates for the years 1992 to 1997); 27 March 2003 (containing estimates for the years 1997 to 2002). Time series spreadsheets of these data for each state and territory and Australia from June 1971 to June 2010 are available for free from the ABS web site in time series spreadsheets under cat. no. 3201.0. 12 Other ABS products which may be of interest to users include: ADDITIONAL STATISTICS AVAILABLE 13 As well as the statistics included in this and related publications, the ABS may have other relevant data available on request. Inquiries should be made to the National Information and Referral Service on 1300 135 070. 14 ABS products and publications are available free of charge from the ABS website <http://www.abs.gov.au>. Click on Statistics to gain access to the full range of ABS statistical and reference information. © Commonwealth of Australia 2013 Unless otherwise noted, content on this website is licensed under a Creative Commons Attribution 2.5 Australia Licence together with any terms, conditions and exclusions as set out in the website Copyright notice. For permission to do anything beyond the scope of this licence and copyright terms contact us.	v0
2024-06-03T18:26:15.484Z	2013-12-06T05:45:28.000Z	krwoiby2gbfatesijtb4k7l5i72rxshm	{ "content_type": "text/html", "provenance": "cccc-CC-MAIN-2013-48-0004.json.gz:14717", "uncompressed_offset": 208119833, "url": "www.abs.gov.au/AUSSTATS/abs%40.nsf/Lookup/Past%2BFuture%2BIssues1996?areaname=Victoria&issue=1996&prodno=96bcp2&tabname=Past+Future+Issues", "warc_date": "2014-01-03T03:19:42.000Z", "warc_filename": "<urn:uuid:111902af-34e2-4fd3-ab14-3018733c70c8>", "warc_url": "http://www.abs.gov.au/AUSSTATS/[email protected]/Lookup/Past+Future+Issues1996?OpenDocument&tabname=Past%20Future%20Issues&prodno=96bcp2&issue=1996&num=&view=&areaname=Victoria" }	cccc_CC-MAIN-2013-48	Australian Bureau of Statistics Celebrating the International Year of Statistics 2013 ABS Home > Census >1996 Census by Location Name 1996 Census Data : Victoria Latest ISSUE Released at 11:30 AM (CANBERRA TIME) 01/07/1997 CLASSIFICATIONS CODE: 96bcp2 Page tools: RSS FUTURE RELEASES • Next Issue: 2006 expected for release on Mar 2007 PAST RELEASES FIRST RELEASE • First Issue: 1996 © Commonwealth of Australia 2013 Unless otherwise noted, content on this website is licensed under a Creative Commons Attribution 2.5 Australia Licence together with any terms, conditions and exclusions as set out in the website Copyright notice. For permission to do anything beyond the scope of this licence and copyright terms contact us.	v0
2024-06-03T18:26:15.484Z	2013-12-06T05:44:12.000Z	k37e5vgh2nechwpo2cxjfd7h7xio77ka	{ "content_type": "text/html", "provenance": "cccc-CC-MAIN-2013-48-0004.json.gz:14719", "uncompressed_offset": 208141986, "url": "www.abs.gov.au/Ausstats/abs%40.nsf/Previousproducts/B01375EC69B80D71CA256C3200241832", "warc_date": "2014-01-03T03:19:42.000Z", "warc_filename": "<urn:uuid:111902af-34e2-4fd3-ab14-3018733c70c8>", "warc_url": "http://www.abs.gov.au/Ausstats/[email protected]/Previousproducts/B01375EC69B80D71CA256C3200241832?opendocument" }	cccc_CC-MAIN-2013-48	Australian Bureau of Statistics Celebrating the International Year of Statistics 2013 ABS Home > Statistics > By Release Date 1384.6 - Statistics - Tasmania, 2005 Previous ISSUE Released at 11:30 AM (CANBERRA TIME) 13/09/2002 Page tools: Print Page Print All RSS Search this Product Tasmania is served by three major acute health facilities: • Royal Hobart Hospital (incorporating the Repatriation General Hospital) • Launceston General Hospital • North West Regional Hospital, Burnie. A network of smaller district hospitals and multipurpose centres also provide a high standard of local care. In the private sector, there were ten hospitals at October 2003: Hobart: • Hobart Clinic at Rokeby • Hobart Day Surgery • Calvary (incorporating the Calvary campus in Lenah Valley and the St John's campus in South Hobart) • Hobart Private Hospital (incorporating St Helen's campus). Launceston: • St Luke's • St Vincent's • Launceston Eye Clinic North-west: • North West Private • Mersey Community • Rosebery Community. (Source: Department of Health and Human Services.) This section contains the following subsection : Hospital services Previous PageNext Page © Commonwealth of Australia 2013 Unless otherwise noted, content on this website is licensed under a Creative Commons Attribution 2.5 Australia Licence together with any terms, conditions and exclusions as set out in the website Copyright notice. For permission to do anything beyond the scope of this licence and copyright terms contact us.	v0
2024-06-03T18:26:15.484Z	2013-12-06T05:40:36.000Z	7onw6fff6owh6vcpqruocb3kinayex2j	{ "content_type": "text/html", "provenance": "cccc-CC-MAIN-2013-48-0004.json.gz:14726", "uncompressed_offset": 232711986, "url": "www.awm.gov.au/collection/P06418.002", "warc_date": "2014-01-03T03:19:42.000Z", "warc_filename": "<urn:uuid:111902af-34e2-4fd3-ab14-3018733c70c8>", "warc_url": "http://www.awm.gov.au/collection/P06418.002" }	cccc_CC-MAIN-2013-48	Image copyright: Copyright expired - public domain This image is in the Public Domain ID number P06418.002 Photographer Cruden, James Charles Object type Colour - Toned black & white print Date made 1915 Collection Photograph Description Hand coloured studio portrait of 1318 Private (Pte) Errol Sydney (Sidney) Watkins of Waverley, NSW. Enlisting in the AIF in February 1915, Pte Watkins was an original member of the 17th Battalion who served on Gallipoli and the Western Front as a stretcher-bearer. According to his Red Cross Wounded and Missing Bureau file Watkins went out on a patrol after the counter-attack at Lagnicourt on 15 April 1917 to collect the wounded from the German positions. Watkins responded to repeated calls for stretcher-bearers believing they were wounded Australians, but was last seen surrounded by a group of Germans who had been calling out in english. Repeated attempts were made by the Red Cross to determine whether he was a prisoner of war in Germany, but discovered after the war that Watkins had been shot in the stomach and died of wounds at Rumancourt on 15 April, age 21. Permalink: http://www.awm.gov.au/collection/P06418.002	v0
2024-06-03T18:26:15.484Z	2013-12-06T05:39:25.000Z	mxaa2lg2ejxo7q6rtucltaxrml72hu5b	{ "content_type": "text/html", "provenance": "cccc-CC-MAIN-2013-48-0004.json.gz:14743", "uncompressed_offset": 302806939, "url": "www.diagnosticpathology.org/content/8/1/109", "warc_date": "2014-01-03T03:19:42.000Z", "warc_filename": "<urn:uuid:111902af-34e2-4fd3-ab14-3018733c70c8>", "warc_url": "http://www.diagnosticpathology.org/content/8/1/109" }	cccc_CC-MAIN-2013-48	Email updates Keep up to date with the latest news and content from Diagnostic Pathology and BioMed Central. Research Podocalyxin-like protein expression in primary colorectal cancer and synchronous lymph node metastases Anna H Larsson12*, Björn Nodin1, Ingvar Syk3, Ingrid Palmquist3, Mathias Uhlén45, Jakob Eberhard12 and Karin Jirström1 Author Affiliations 1 Department of Clinical Sciences, Division of Pathology, Lund University, Skåne University Hospital, SE-221 85 Lund, Sweden 2 Department of Clinical Sciences, Division of Oncology, Lund University, Skåne University Hospital, 221 85 Lund, Sweden 3 Department of Clinical Sciences, Division of Surgery, Lund University, Skåne University Hospital, 205 02 Malmö, Sweden 4 Science for Life Laboratory, AlbaNova University Center, Royal Institute of Technology, 106 91 Stockholm, Sweden 5 School of Biotechnology, AlbaNova University Center, Royal Institute of Technology, 106 91 Stockholm, Sweden For all author emails, please log on. Diagnostic Pathology 2013, 8:109 doi:10.1186/1746-1596-8-109 The electronic version of this article is the complete one and can be found online at: http://www.diagnosticpathology.org/content/8/1/109 Received:9 April 2013 Accepted:25 June 2013 Published:2 July 2013 © 2013 Larsson et al.; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Abstract Aims Previous studies have shown that membranous expression of podocalyxin-like protein (PODXL) is associated with poor prognosis in colorectal cancer (CRC). In this study, we compared PODXL expression in primary CRC and synchronous lymph node metastases. We further analyzed whether its expression changed in rectal tumours after neoadjuvant radiation therapy. Methods and results The studied cohort consists of 73 consecutive patients from the South-Swedish Colorectal Cancer Biobank. Immunohistochemical PODXL expression was examined on full-face sections from all primary tumours and all 140 available lymph node metastases from 31 cases. Membranous PODXL expression was denoted in 18/73 (24,7%) primary tumours, with a high concordance between primary and metastatic lesions. While all negative primary tumours had negative metastases, some PODXL positive primaries had a varying proportion of positive and negative metastatic lymph nodes. PODXL expression was also found to be mainly unaltered in pre- and post-irradiation surgically resected tumour specimens in rectal cancer patients (n=16). Conclusions The findings in this study suggest that analysis of PODXL expression in the primary tumour is sufficient for its use as a prognostic and treatment predictive biomarker in CRC, also in patients with metastatic disease. Virtual slides The virtual slide(s) for this article can be found here: http://www.diagnosticpathology.diagnomx.eu/vs/9014177329634352 webcite Introduction Every year more than 1,2 million people worldwide are diagnosed with CRC and although CRC mortality is progressively declining, it still remains the second most common cause of cancer death in the Western world. Prognosis is mostly dependent on disease stage at diagnosis, however, outcome may vary considerably even within the same tumour stage. Thus, there is a great need for additional prognostic biomarkers to better identify patients with a high risk of developing metastases. Podocalyxin-like protein (PODXL) is a transmembrane glycoprotein with anti-adhesive properties, first identified in the kidney where it plays a vital role in maintaining filtration pathways [1]. PODXL is also expressed by vascular endothelial cells [1], platelets [2], and hematopoietic stem cells [3]. The role of PODXL in cancer was first described in testicular cancer [4]. Since then, PODXL has been found to be overexpressed in numerous cancer types and associated with a more aggressive tumour phenotype and poor outcome in breast [5], prostate [6], colorectal [7,8] ovarian [9] and bladder cancer [10]. The poor prognosis seems to be conferred by PODXL expression on the membrane of tumour cells, and predominantly at the invasive tumour front [7,11], further indicating an integral role for this protein in the progression of some tumours. Our previous studies have shown that PODXL is an independent predictor of poor prognosis in CRC and a possible future tool for selecting high risk patients for adjuvant treatment [7]. Given the potential clinical utility of PODXL, we conducted the present study to investigate the grade of concordance in terms of PODXL expression between primary colorectal tumours and corresponding lymph node metastases, and also the effect of neoadjuvant radiation therapy on PODXL expression in rectal cancer. Moreover, since previous studies were retrospective and based on analysis of tissue-microarrays (TMAs), a secondary objective was to examine whether analysis of full-face sections reveals a larger proportion of tumours with membranous PODXL expression. Materials and methods Patients The study cohort included all patients in the prospective South-Swedish Colorectal Cancer Biobank (STABB) who were surgically treated for primary CRC at Skåne University Hospital in Malmö, Sweden between January 1st and September 30th 2012 (n=74). One patient with complete histopathological response, i.e. abscence of tumour cells in the surgical specimen post-irradiation, was excluded from the study. Thirty-two (43,8%) of the remaining 73 patients had lymph node metastases and four (5,5%) had stage IV disease with liver metastases. Median age at diagnosis was 72 years (range 44–92 years). Twenty-one patients with rectal cancer received neoadjuvant radiation treatment. Eighteen of these patients were given 25 Gy and three patients received a long radiation therapy of 50,4 Gy combined with per oral capecitabine prior to surgery. Histopathological, clinical and treatment data were obtained from pathology and hospital records. Patient and tumour characteristics are summarized in Table 1. Table 1. PODXL expression and clinicopathological parameters of the cohort The present study was approved by the Ethics Committee at Lund University (ref. 210/473 and 2012/307). Written informed consent was obtained from each patient. Immunohistochemistry All tumours were histopathologically re-evaluated by a board certified pathologist (KJ). For each patient, one representative paraffin block was selected from the primary tumour, and when applicable, all corresponding metastases to lymph nodes (n=32). For rectal cancer patients who underwent neoadjuvant radiation therapy, diagnostic pre-irradiation biopsies were also analyzed for PODXL expression (n=16). For immunohistochemical analysis, full-face sections were automatically pre-treated using the PT-link system (DAKO, Glostrup, Denmark) and then stained in an Autostainer Plus (DAKO, Glostrup, Denmark) with the affinity-purified polyclonal anti-PODXL antibody HPA 2110 (Atlas Antibodies, Stockholm, Sweden, diluted 1:250). The specificity of this antibody, originally generated within the Human Protein Atlas (HPA) project, has been validated using Western blotting and protein arrays, and PODXL protein expression has been mapped by immunohistochemistry in 48 types of normal tissues and 20 common cancers (http://www.proteinatlas.org webcite). The same antibody was used to detect PODXL expression in CRC in our previous studies [7,8] and in studies on bladder [10], testicular [12] and pancreatic [11] cancer. Evaluation of PODXL staining As in previous studies, PODXL staining was recorded as negative (0), weak cytoplasmic positivity in any proportion of cells (1), moderate cytoplasmic positivity in any proportion (2), distinct membranous positivity in ≤ 50% of cells (3) and distinct membranous positivity in > 50% of cells (4) [7,8,10]. Overexpression of PODXL was considered if the tumour cells exhibited a distinct membranous staining in any proportion of the cells (3–4). Normal colorectal mucosa adjacent to the cancers functioned as negative control and tumour-associated vasculature as positive control. The staining was evaluated by two independent observers (AL and KJ) who were blinded to clinical and outcome data. Scoring differences were discussed in order to reach consensus. Statistics Spearman’s Rho and Chi-square tests were used for comparison of PODXL expression and relevant clinicopathological characteristics and to analyze the concordance between PODXL expression in primary tumour and metastases and between pre- and postirradiation tumour samples. A p-value of 0.05 was considered statistically significant. All statistical analyses were performed using SPSS version 20 (SPSS Inc, Chicago, IL). Results PODXL expression in primary tumours and its association with clinicopathological parameters Membranous PODXL expression was denoted in 18/73 (24,7%) primary tumours, Analysis of the relationship between PODXL expression in primary tumours and established clinicopathological parameters revealed a strong correlation between PODXL overexpression and low differentiation grade (p=0.020), presence of mucinous histology (p=0.010) and female gender (p<0.010). There were no statistically significant associations between PODXL expression and other clinicopathological parameters including age at diagnosis, tumour location, T-stage, N-stage and presence of vascular and neural invasion (Table 1). Concordance between PODXL expression in primary colorectal tumours and corresponding lymph node metastases PODXL expression could be evaluated in 31/32 (96,9%) patients with lymph node metastases. The level of concordance between primary colorectal tumours and related lymph node metastases was high (Table 2). In all cases with a negative primary tumour, the same status was observed in the lymph nodes. A discrepancy between positive primaries and a fraction of their corresponding lymph nodes was however noted in 7 (22,6%) cases. Sample immunohistochemical images of one discrepant case is shown in Figure 1. In one case, the primary tumour had very few positive cells and the same was seen in one of the lymph nodes, while the other two lymph nodes were negative. Considering the median value of PODXL expression in the lymph nodes for each patient, the concordance of PODXL expression between primary CRCs and lymph node metastases was 93,5% and the correlation was statistically significant (p<0.001). Table 2. Concordance between PODXL expression in primary colorectal tumours and corresponding lymph node metastases Figure 1. Immunohistochemical sample images from one case with positive membranous PODXL staining in the primary tumour (A), and corresponding positive (B,C) and negative (D) lymph node metastases. PODXL expression in rectal tumours pre- and post-irradiation PODXL expression could be evaluated in 16/21 (76,2%) rectal biopsies pre-irradiation. Two (12,5%) were PODXL positive and 14 (87,5%) PODXL negative. A discrepancy between PODXL expression in tumours before and after radiation therapy was noted in two cases (Table 3). In both discrepant cases, positive conversion (negative in the pre-irradiation biopsy and positive in the post-irradiation tumour) was observed. Notably, 5/6 (83,3%) of the patients with PODXL positive rectal tumours in the cohort were considered high-risk patients and therefore received neoadjuvant radiation therapy. Sample immunohistochemical images are shown in Figure 2. Table 3. Concordance between PODXL expression in rectal tumour samples pre- and post-irradiation therapy Figure 2. Immunohistochemical sample images from one rectal cancer case with positive membranous PODXL staining in the pre-irradiation biopsy (A), surgical resection specimen of primary tumour post-irradiation (B) and lymph node metastasis (C). Discussion When identifying new prognostic biomarkers it is of great importance to decide which tumour site to examine, as the expression might differ in primary tumour and metastases. In this study we have analyzed PODXL expression in 31 primary tumours and a total number of 140 corresponding lymph node metastases, thus providing a thorough characterization of PODXL expression in both settings. Moreover, we have examined the potential effect of radiation therapy on PODXL expression in rectal cancer patients. PODXL has previously been found to correlate with a poor prognosis in CRC [7,8]. So far, all results are derived from studies based on TMAs with retrospectively collected tumour samples. In this study, we used full-face sections, one from each case, to determine PODXL expression in 73 CRC patients. Our results indicate that by use of full-face section analysis, a larger proportion of tumours are identified as being PODXL positive, i.e. having membranous expression, compared to TMA-based analyses (24,7% vs 8-13%) [7,8]. These findings are not unexpected, since PODXL is, in the vast majority of cases, overexpressed in a heterogenous fashion, preferrably at the invasive tumour front. Therefore, use of the TMA-technique will most likely lead to an underestimation of positive cases. Moreover, no tumour in this cohort had membranous staining in more than 50% of the tumour cells (i.e. category 4), which may be explained by the size of the cohort, but could also be attributed to the tumour area selected for sampling. The number of cases denoted as having > 50% cells with membranous PODXL ex-pression in previous studies is however negligible, further supporting that using a cutoff based on the presence or absence of membranous staining should be sufficient for prognostication purposes. Even if recognition of membranous PODXL expression is fairly straightforward, and the mere presence rather than the quantity seems to be of prognostic importance, it would however be of interest to compare visual scoring and automated analysis in future studies [13,14]. For characterization of key molecular alterations and expression of investigative biomarkers in tumours from large patient cohorts, whether retrospectively or prospectively defined, the TMA-technology is indispensable [15]. For prospective biomarker studies and in clinical use, however, analysis of full-face sections should be the most convenient and applicable method. Prognostic biomarkers in CRC are routinely analyzed in the primary tumor, whereas tumor cells in lymph node metastases are not characterized. Previous studies on KRAS expression have shown a discrepancy between the primary tumour and corresponding lymph node metastases [16,17], whereas the expression of other biomarkers, e.g. ER and HER-2 in breast cancer have been demonstrated to be highly concordant [18]. Of note, while most studies related to the concordance between primary and metastatic lesions have only examined a few lymph nodes (typically two per patient), we have in this study strived to examine all metastatic lymph nodes. Although there was a discordance of PODXL expression between primary tumours and lymph node metastases in some cases, this was limited to a few cases with PODXL positive primaries where a clonal distribution of PODXL expression was observed in the metastatic lymph nodes. These results reflect the fact that the small proportion of cells in a positive primary tumour displaying membranous PODXL expression are highly prone to metastasize. The excellent concordance between primary tumour and lymph node metastases demonstrate that assessment of the primary tumour is sufficient to determine if a patient has a PODXL positive tumour. The expression of PODXL in lymph node metastases can however provide prognostic information when no primary tumour is available for analysis. Moreover, in future studies, it would be of interest to perform in-depth analyses of other molecular characteristics, and drivers of the metastatic phenotype, that may differ between PODXL negative and positive lymph node metastases in individual cases. The significant associations between PODXL expression and several unfavourable clinicopathological characteristics (e.g. TNM stage) that have been demonstrated in our previous studies [7,8], did not reach statistical significance in this study, most likely due to the small sample size. Nevertheless, despite the small number of patients, a statistically significant relationship between PODXL expression and differentiation grade and mucinous histology was seen. Moreover, there was an overweight of PODXL positive tumours among patients who received adjuvant treatment, an indirect measurement of more aggressive tumours. The significant association of PODXL expression with female gender has not been observed in previous studies and is likely attributable to the small size of the cohort. It is well known that approximately half of the patients with CRC stage III disease will relapse, and that adjuvant chemotherapy reduces the risk of recurrence with 20-30%. Our previous study has shown that patients with PODXL positive tumours within this group benefit from adjuvant chemotherapy irrespective of treatment regime [7]. While the majority of patients with stage III disease in this study received adjuvant treatment, a few patients were not considered candidates for chemotherapy due to old age or comorbidity. In cases of doubt whether adjuvant treatment should be given, assessment of PODXL expression may be a useful prognostic tool. Moreover, the finding of a higher proportion of PODXL positive tumours in full-face sections is of particular clinical relevance in stage II disease, where it is of uttermost importance to identify patients with high-risk disease who would benefit from adjuvant treatment. Previous studies have shown that adjuvant chemotherapy could improve survival for this group of patients, but that the incremental benefits are small [19]. Therefore, further prognostic tools are needed to better guide treatment decisions in this patient category. As PODXL expression has been demonstrated to have a prognostic value in patients with stage II disease in retrospective analysis [7] this association warrants further study in the prospective setting. In biomarker studies it is important to consider the effect of neoadjuvant treatment on biomarker expression. In this study we found an excellent concordance between PODXL expression in rectal tumours before and after neoadjuvant irradiation, suggesting that PODXL expression is not affected by radiation therapy. In conclusion, the results from this study suggest that PODXL expression in CRC is concordant in primary tumours and corresponding lymph node metastases in individual patients, and also remains unaffected by neoadjuvant radiation therapy. The results further support the clinical utility of PODXL as a biomarker for risk assessment in CRC, even in cases where no primary tumour is available for analysis, and irrespective of histopathological response to neoadjuvant treatment. Competing interests A patent has been filed related to the use of PODXL as a prognostic biomarker in CRC. Authors’ contributions AL performed statistical analysis, carried out the functional studies and drafted the manuscript. BN constructed the TMAs. IS and IP assisted with data collection. MU participated in the design of the study and provided technical assistance. JE helped with clinical advice. KJ conceived of the study, participated in its design and coordination and helped to draft the manuscript. All authors read and approved the final manuscript. Acknowledgments This study was supported by grants from the Knut and Alice Wallenberg Foundation, the Swedish Cancer Society, the Gunnar Nilsson Cancer Foundation, Region Skåne and the Research Funds of Skåne University Hospital. References 1. Kerjaschki D, Sharkey DJ, Farquhar MG: Identification and characterization of podocalyxin–the major sialoprotein of the renal glomerular epithelial cell. J Cell Biol 1984, 98(4):1591-1596. PubMed Abstract \| Publisher Full Text \| PubMed Central Full Text 2. Miettinen A, Solin ML, Reivinen J, Juvonen E, Vaisanen R, Holthofer H: Podocalyxin in rat platelets and megakaryocytes. Am J Pathol 1999, 154(3):813-822. PubMed Abstract \| Publisher Full Text \| PubMed Central Full Text 3. McNagny KM, Pettersson I, Rossi F, Flamme I, Shevchenko A, Mann M, Graf T: Thrombomucin, a novel cell surface protein that defines thrombocytes and multipotent hematopoietic progenitors. J Cell Biol 1997, 138(6):1395-1407. PubMed Abstract \| Publisher Full Text \| PubMed Central Full Text 4. Schopperle WM, Kershaw DB, DeWolf WC: Human embryonal carcinoma tumor antigen, Gp200/GCTM-2, is podocalyxin. Biochem Biophys Res Commun 2003, 300(2):285-290. PubMed Abstract \| Publisher Full Text 5. Somasiri A, Nielsen JS, Makretsov N, McCoy ML, Prentice L, Gilks CB, Chia SK, Gelmon KA, Kershaw DB, Huntsman DG, et al.: Overexpression of the anti-adhesin podocalyxin is an independent predictor of breast cancer progression. Cancer Res 2004, 64(15):5068-5073. PubMed Abstract \| Publisher Full Text 6. Casey G, Neville PJ, Liu X, Plummer SJ, Cicek MS, Krumroy LM, Curran AP, McGreevy MR, Catalona WJ, Klein EA, et al.: Podocalyxin variants and risk of prostate cancer and tumor aggressiveness. Hum Mol Genet 2006, 15(5):735-741. PubMed Abstract \| Publisher Full Text 7. Larsson A, Johansson ME, Wangefjord S, Gaber A, Nodin B, Kucharzewska P, Welinder C, Belting M, Eberhard J, Johnsson A, et al.: Overexpression of podocalyxin-like protein is an independent factor of poor prognosis in colorectal cancer. Br J Cancer 2011, 105(5):666-672. PubMed Abstract \| Publisher Full Text \| PubMed Central Full Text 8. Larsson A, Fridberg M, Gaber A, Nodin B, Leveen P, Jonsson G, Uhlen M, Birgisson H, Jirstrom K: Validation of podocalyxin-like protein as a biomarker of poor prognosis in colorectal cancer. BMC Cancer 2012, 12:282. PubMed Abstract \| BioMed Central Full Text \| PubMed Central Full Text 9. Cipollone JA, Graves ML, Kobel M, Kalloger SE, Poon T, Gilks CB, McNagny KM, Roskelley CD: The anti-adhesive mucin podocalyxin may help initiate the transperitoneal metastasis of high grade serous ovarian carcinoma. Clin Exp Metastasis 2012, 29(3):239-252. PubMed Abstract \| Publisher Full Text 10. Boman K, Larsson AH, Segersten U, Kuteeva E, Johannesson H, Nodin B, Eberhard J, Uhlen M, Malmstrom PU, Jirstrom K: Membranous expression of podocalyxin-like protein is an independent factor of poor prognosis in urothelial bladder cancer. Br J Cancer 2013, 108(11):2321-2328. PubMed Abstract \| Publisher Full Text 11. Dallas MR, Chen SH, Streppel MM, Sharma S, Maitra A, Konstantopoulos K: Sialofucosylated podocalyxin is a functional E- and L-selectin ligand expressed by metastatic pancreatic cancer cells. Am J Physiol Cell Physiol 2012, 303(6):C616-C624. PubMed Abstract \| Publisher Full Text 12. Cheung HH, Davis AJ, Lee TL, Pang AL, Nagrani S, Rennert OM, Chan WY: Methylation of an intronic region regulates miR-199a in testicular tumor malignancy. Oncogene 2011, 30(31):3404-3415. PubMed Abstract \| Publisher Full Text \| PubMed Central Full Text 13. Laurinaviciene A, Dasevicius D, Ostapenko V, Jarmalaite S, Lazutka J, Laurinavicius A: Membrane connectivity estimated by digital image analysis of HER2 immunohistochemistry is concordant with visual scoring and fluorescence in situ hybridization results: algorithm evaluation on breast cancer tissue microarrays. Diagn Pathol 2011, 6:87. PubMed Abstract \| BioMed Central Full Text \| PubMed Central Full Text 14. Rizzardi AE, Johnson AT, Vogel RI, Pambuccian SE, Henriksen J, Skubitz AP, Metzger GJ, Schmechel SC: Quantitative comparison of immunohistochemical staining measured by digital image analysis versus pathologist visual scoring. Diagn Pathol 2012, 7:42. PubMed Abstract \| BioMed Central Full Text \| PubMed Central Full Text 15. Torhorst J, Bucher C, Kononen J, Haas P, Zuber M, Kochli OR, Mross F, Dieterich H, Moch H, Mihatsch M, et al.: Tissue microarrays for rapid linking of molecular changes to clinical endpoints. Am J Pathol 2001, 159(6):2249-2256. PubMed Abstract \| Publisher Full Text \| PubMed Central Full Text 16. Han CB, Li F, Ma JT, Zou HW: Concordant KRAS mutations in primary and metastatic colorectal cancer tissue specimens: a meta-analysis and systematic review. Cancer Invest 2012, 30(10):741-747. PubMed Abstract \| Publisher Full Text 17. Miranda C, Nucifora M, Molinari F, Conca E, Anania MC, Bordoni A, Saletti P, Mazzucchelli L, Pilotti S, Pierotti MA, et al.: KRAS and BRAF mutations predict primary resistance to imatinib in gastrointestinal stromal tumors. Clinical cancer research: an official journal of the American Association for Cancer Research 2012, 18(6):1769-1776. Publisher Full Text 18. Falck AK, Ferno M, Bendahl PO, Ryden L: Does analysis of biomarkers in tumor cells in lymph node metastases give additional prognostic information in primary breast cancer? World J Surg 2010, 34(7):1434-1441. PubMed Abstract \| Publisher Full Text 19. Gray R, Barnwell J, McConkey C, Hills RK, Williams NS, Kerr DJ: Adjuvant chemotherapy versus observation in patients with colorectal cancer: a randomised study. Lancet 2007, 370(9604):2020-2029. PubMed Abstract \| Publisher Full Text	v0
2024-06-03T18:26:15.484Z	2013-12-06T05:42:04.000Z	wqc26aivjdbaxttfzth3aii3njgovp23	{ "content_type": "text/html", "provenance": "cccc-CC-MAIN-2013-48-0004.json.gz:14744", "uncompressed_offset": 320609130, "url": "www.eoearth.org/view/article/51cbf0897896bb431f6a1ff3/?topic=64180", "warc_date": "2014-01-03T03:19:42.000Z", "warc_filename": "<urn:uuid:111902af-34e2-4fd3-ab14-3018733c70c8>", "warc_url": "http://www.eoearth.org/view/article/51cbf0897896bb431f6a1ff3/?topic=64180" }	cccc_CC-MAIN-2013-48	Data on the Deepwater Horizon disaster Data assessing the leak from the Macondo well February 21, 2011, 3:19 pm NASA’s Aqua satellite captured this image of the Gulf of Mexico on April 25, 2010, using its Moderate Resolution Imaging Spectroradiometer (MODIS) instrument. The silvery swirling oil slick is highly visible.Credit: NASA Data on the Deepwater Horizon main page Department of Energy Data on Collection to the Surface These documents contain data describing the quantities of oil and gas recovered on the surface from the Riser Insertion Tube Tool, the Choke Line and the Lower Marine Riser Package Top Hat #4. • Combined Total Amount of Oil and Gas Recovered Daily from the Top Hat and Choke Line oil recovery systems, (.xls) (.ods) - Updated through 12:00 AM on July 16, 2010. • Visual Breakout of the Cummulative Barrels of Oil Recovered by the Discoverer Enterprise, Q4000 and HP1, (.doc) - Updated through 12:00 AM on July 16, 2010. • Oil and Gas Recovery Data from the Riser Insertion Tube, (.xls) (.ods) - From May 17 until the Riser Insertion Tube was disconnected on May 24 in preparation for cutting off the riser. • Oil and Gas Flow Data from the Top Hat and from the Choke Line, (.xls) (.ods) - Updated through 12:00 AM on July 10, 2010. Skytruth Extent of Slick • Extent of Deepwater Horizon oil slick in the Gulf of Mexico (.xls) - as determined from NASA/MODIS satellite images Data on the Deepwater Horizon main page Glossary Citation Nomack, M. (2011). Data assessing the leak from the Macondo well. Retrieved from http://www.eoearth.org/view/article/51cbf0897896bb431f6a1ff3	v0
2024-06-03T18:26:15.484Z	2013-12-06T05:54:12.000Z	vv4y57w5nhsfvd7wtjv6bsknmqwqgct2	{ "content_type": "text/html", "provenance": "cccc-CC-MAIN-2013-48-0004.json.gz:14749", "uncompressed_offset": 360711933, "url": "www.grandtheftwiki.com/index.php?mobileaction=toggle_view_mobile&title=Category_talk%3AStreet_Gangs", "warc_date": "2014-01-03T03:19:42.000Z", "warc_filename": "<urn:uuid:111902af-34e2-4fd3-ab14-3018733c70c8>", "warc_url": "http://www.grandtheftwiki.com/index.php?title=Category_talk:Street_Gangs&mobileaction=toggle_view_mobile" }	cccc_CC-MAIN-2013-48	Category talk:Street Gangs From Grand Theft Wiki Jump to: navigation, search This page is missing a few gangs, such as M.O.B and the Hustlers in GTA4, i don't know how to add though. Ess-Tee 08:31, 25 May 2009 (UTC) To add a page into a category, go to the page you want to add (such as M.O.B.) and add: [[Category:Street Gangs]] at the end. It won't show up as a normal link, instead it will simply add that page to this category. See Help:Categories for more info. Gboyers talk 09:29, 25 May 2009 (UTC)	v0
2024-06-03T18:26:15.484Z	2013-12-06T05:42:16.000Z	2httpkg2575vxbj35q3dosd42fxfumi6	{ "content_type": "application/xhtml+xml", "provenance": "cccc-CC-MAIN-2013-48-0004.json.gz:14753", "uncompressed_offset": 369296696, "url": "www.hindawi.com/journals/edri/2012/265293/ref/", "warc_date": "2014-01-03T03:19:42.000Z", "warc_filename": "<urn:uuid:111902af-34e2-4fd3-ab14-3018733c70c8>", "warc_url": "http://www.hindawi.com/journals/edri/2012/265293/ref/" }	cccc_CC-MAIN-2013-48	About this Journal Submit a Manuscript Table of Contents Education Research International Volume 2012 (2012), Article ID 265293, 6 pages http://dx.doi.org/10.1155/2012/265293 Research Article The Study of Teacher Efficacy in Hong Kong Sub-Degree Sector Li Ka Shing Institute of Professional and Continuing Education, Open University of Hong Kong, 4/F, Shun Tak Centre, 168 Connaught Road Central, Hong Kong Received 15 October 2012; Revised 15 November 2012; Accepted 19 November 2012 Academic Editor: Hoi Yan Cheung Copyright © 2012 Wai-Hung Lam. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Linked References 1. University Grants Committee (UGC), “Aspirations for the higher education system in Hong Kong,” Report of the University Grants Committee, UGC, Hong Kong, 2010, http://www.ugc.edu.hk/eng/ugc/publication/report/her2010/her2010.htm. 2. Information Portal for Accredited Post-secondary Programme (IPASS), “Statistics on full-time accredited self-financing post-secondary programmes and students,” IPASS, Hong Kong, 2012, http://www.ipass.gov.hk/edb/index.php/en/home/statheader/stat. 3. B. Joyce and B. Showers, Student Achievement Through Staff Development, Association for Supervision and Curriculum Development, Alexandria, Va, USA, 2002. 4. H. Y. Cheung, “Teacher efficacy: a comparative study of Hong Kong and Shanghai primary in-service teachers,” Australian Educational Researcher, vol. 35, no. 1, pp. 103–123, 2008. View at Scopus 5. H. Y. Cheung, “The measurement of teacher efficacy: Hong Kong primary in-service teachers,” Journal of Education for Teaching, vol. 32, no. 4, pp. 435–451, 2006. View at Publisher · View at Google Scholar · View at Scopus 6. R. Marzano, What Works in Schools: Translating Research in Action, Association for Supervision and Curriculum Department, Alexandria, Va, USA, 2003. 7. M. Tschannen-Moran and A. W. Hoy, “Teacher efficacy: capturing an elusive construct,” Teaching and Teacher Education, vol. 17, no. 7, pp. 783–805, 2001. View at Publisher · View at Google Scholar · View at Scopus 8. D. Armor, P. Conroy-Oseguera, M. Cox et al., “Analysis of the school preferred reading programs in selected Los Angeles minority schools,” Tech. Rep. R-2007-LAUSD, Rand Corporation, Santa Monica, Calif, USA, 1976, ERIC Document Reproduction Service No. 130 243. 9. J. B. Rotter, “Generalized expectancies for internal versus external control of reinforcement,” Psychological Monographs, vol. 80, no. 1, pp. 1–28, 1966. View at Scopus 10. G. Barnes, “Self-efficacy and teaching effectiveness,” Journal of String Research, vol. 1, pp. 627–643, 2000. 11. L. C. Duffin, B. F. French, and H. Patrick, “A confirmatory factor analysis of pre-service teacher scores from the teachers' sense of efficacy scale,” Teaching and Teacher Education, vol. 28, pp. 827–834, 2012. View at Publisher · View at Google Scholar 12. A. Bandura, “Self-efficacy: toward a unifying theory of behavioral change,” Psychological Review, vol. 84, no. 2, pp. 191–215, 1977. View at Publisher · View at Google Scholar · View at Scopus 13. D. Stipek, Motivation to Learn: Integrating Theory and Practice, Allyn and Bacon, Boston, Mass, USA, 4th edition, 2002. 14. A. E. Woolfolk, Educational Psychology, Allyn and Bacon, Boston, Mass, USA, 11th edition, 2010. 15. A. B. Dellinger, J. J. Bobbett, D. F. Olivier, and C. D. Ellett, “Measuring teachers' self-efficacy beliefs: development and use of the TEBS-Self,” Teaching and Teacher Education, vol. 24, no. 3, pp. 751–766, 2008. View at Publisher · View at Google Scholar · View at Scopus 16. E. M. Skaalvik and S. Skaalvik, “Dimensions of teacher self-efficacy and relations with strain factors, perceived collective teacher efficacy, and teacher burnout,” Journal of Educational Psychology, vol. 99, no. 3, pp. 611–625, 2007. View at Publisher · View at Google Scholar · View at Scopus 17. C. A. Wolters and S. G. Daugherty, “Goal structures and teachers' sense of efficacy: their relation and association to teaching experience and academic level,” Journal of Educational Psychology, vol. 99, no. 1, pp. 181–193, 2007. View at Publisher · View at Google Scholar · View at Scopus 18. D. M. Szal, “The relationship of administrative behaviors and characteristics with teachers' general and personal efficacy,” National Social Science Journal, vol. 35, no. 1, pp. 145–152, 2010. 19. H. L. Lin and J. Gorrell, “Exploratory analysis of pre-service teacher efficacy in Taiwan,” Teaching and Teacher Education, vol. 17, no. 5, pp. 623–635, 2001. View at Publisher · View at Google Scholar · View at Scopus 20. R. M. Klassen, V. M. C. Tze, S. M. Betts, and K. A. Gordon, “Teacher efficacy research 1998–2009: signs of progress or unfulfilled promise?” Educational Psychology Review, vol. 23, no. 1, pp. 21–43, 2011. View at Publisher · View at Google Scholar · View at Scopus 21. G. J. Visser-Wijnveen, A. S. Stes, and P. V. Petegem, “Development and validation of a questionnaire measuring teachers' motivations for teaching in higher education,” Higher Education, vol. 64, pp. 421–436, 2012. 22. K. E. Dunn and G. C. Rakes, “Teaching teachers: an investigation of beliefs in teacher education students,” Learning Environments Research, vol. 14, no. 1, pp. 39–58, 2011. View at Publisher · View at Google Scholar · View at Scopus 23. F. F. Fuller, “Concerns of teachers: a developmental conceptualization,” American Education Research Journal, vol. 6, pp. 207–226, 1969. 24. M. McKinney, T. Sexton, and M. J. Meyerson, “Validating the efficacy-based change model,” Teaching and Teacher Education, vol. 15, no. 5, pp. 471–485, 1999. View at Scopus 25. M. Tschannen-Moran, A. W. Hoy, and W. K. Hoy, “Teacher efficacy: its meaning and measure,” Review of Educational Research, vol. 68, no. 2, pp. 202–248, 1998. View at Scopus 26. B. Weiner, “A cognitive (attribution)-emotion-action model of motivated behavior: an analysis of judgements of help-giving,” Journal of Personality and Social Psychology, vol. 39, pp. 186–200, 1980. View at Publisher · View at Google Scholar 27. J. A. Ross, “The antecedents and consequences of teacher efficacy,” in Advances in Research on Teaching, J. Brophy, Ed., vol. 7, pp. 49–74, JAI Press, Greenwich, Conn, USA, 1998. 28. P. Wilson and G. C. I. Tan, “Singapore teachers' Personal and General Efficacy for teaching primary social studies,” International Research in Geographical and Environmental Education, vol. 13, no. 3, pp. 209–222, 2004. View at Scopus 29. M. J. de la Torre Cruz and P. F. Casanova Arias, “Comparative analysis of expectancies of efficacy in in-service and prospective teachers,” Teaching and Teacher Education, vol. 23, no. 5, pp. 641–652, 2007. View at Publisher · View at Google Scholar · View at Scopus 30. M. C. Tejeda-Delgado, “Teacher efficacy, tolerance, gender, and years of experience and special education referrals,” International Journal of Special Education, vol. 24, no. 1, pp. 112–119, 2009. View at Scopus 31. L. S. Yeo, R. P. Ang, W. H. Chong, V. S. Huan, and C. L. Quek, “Teacher efficacy in the context of teaching low achieving students,” Current Psychology, vol. 27, no. 3, pp. 192–204, 2008. View at Publisher · View at Google Scholar · View at Scopus 32. W. K. Hoy and A. E. Woolfolk, “Teachers' sense of efficacy and the organizational health of schools,” The Elementary School Journal, vol. 93, pp. 356–372, 1993. 33. A. Bandura, Guide for Constructing Self-Efficacy Scales, Stanford University, Standford, Calif, USA, 1990. 34. S. Gibson and M. H. Dembo, “Teacher efficacy: a construct validation,” Journal of Educational Psychology, vol. 76, no. 4, pp. 569–582, 1984. View at Publisher · View at Google Scholar · View at Scopus 35. N. Tournaki and D. M. Podell, “The impact of student characteristics and teacher efficacy on teachers' predictions of student success,” Teaching and Teacher Education, vol. 21, no. 3, pp. 299–314, 2005. View at Publisher · View at Google Scholar · View at Scopus 36. E. Pas, C. P. Bradshaw, and P. A. Hershfeldt, “Teacher- and school-level predictors of teacher efficacy and burnout: identifying potential areas of support,” Journal of School Psychology, vol. 50, no. 1, pp. 129–145, 2012. View at Publisher · View at Google Scholar 37. C. Maslach and S. E. Jackson, “The measurement of experienced burnout,” Journal of Occupational Behavior, vol. 2, pp. 99–113, 1981. 38. J. A. Ross, J. B. Cousins, and T. Gadalla, “Within-teacher predictors of teacher efficacy,” Teaching and Teacher Education, vol. 12, no. 4, pp. 385–400, 1996. View at Publisher · View at Google Scholar · View at Scopus 39. L. Ingvarson, M. Meiers, and A. Beavis, “Factors affecting the impact of professional development programs on teachers' knowledge, practice, student outcomes & efficacy,” Education Policy Analysis Archives, vol. 13, pp. 1–28, 2005. View at Scopus	v0
2024-06-03T18:26:15.484Z	2013-12-06T05:42:54.000Z	v5nymgroeqbwrubxpqw45fcxi4osgkxu	{ "content_type": "application/xhtml+xml", "provenance": "cccc-CC-MAIN-2013-48-0004.json.gz:14754", "uncompressed_offset": 369308759, "url": "www.hindawi.com/journals/jobe/2012/505274/", "warc_date": "2014-01-03T03:19:42.000Z", "warc_filename": "<urn:uuid:111902af-34e2-4fd3-ab14-3018733c70c8>", "warc_url": "http://www.hindawi.com/journals/jobe/2012/505274/" }	cccc_CC-MAIN-2013-48	About this Journal Submit a Manuscript Table of Contents Journal of Obesity Volume 2012 (2012), Article ID 505274, 9 pages http://dx.doi.org/10.1155/2012/505274 Review Article Obesity and Pulmonary Hypertension: A Review of Pathophysiologic Mechanisms 1Section of Cardiology, Heart and Vascular Center, Dartmouth-Hitchcock Medical Center, Lebanon, NH 03756, USA 2Department of Medicine, Geisel School of Medicine at Dartmouth, Hanover, NH 03755, USA Received 3 March 2012; Accepted 18 July 2012 Academic Editor: David Allison Copyright © 2012 Scott E. Friedman and Bruce W. Andrus. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Abstract Pulmonary hypertension (PH) is a potentially life-threatening condition arising from a wide variety of pathophysiologic mechanisms. Effective treatment requires a systematic diagnostic approach to identify all reversible mechanisms. Many of these mechanisms are relevant to those afflicted with obesity. The unique mechanisms of PH in the obese include obstructive sleep apnea, obesity hypoventilation syndrome, anorexigen use, cardiomyopathy of obesity, and pulmonary thromboembolic disease. Novel mechanisms of PH in the obese include endothelial dysfunction and hyperuricemia. A wide range of effective therapies exist to mitigate the disability of PH in the obese. 1. Educational Objectives of the Review Obesity and pulmonary hypertension (PH) are two conditions that frequently coexist in clinical practice. In this paper, we will discuss (1) the general approach to the evaluation of pulmonary hypertension, (2) the prevalence of PH in the obese, (3) the mechanisms by which obesity leads to PH, and (4) the evaluation and treatment of PH in the obese. 2. Pulmonary Hypertension 2.1. Definition Pulmonary hypertension is formally defined by a mean pulmonary artery pressure exceeding 25 mm Hg on right heart catheterization. However, because of its noninvasive nature, echocardiography is commonly used to screen for PH and provides estimates of peak pulmonary artery systolic pressure (PASP). Unfortunately, there is no reliable echocardiographic method of determining mean pulmonary artery pressure. Rather, echocardiographically determined pulmonary artery systolic pressures greater than 40 mm Hg are considered abnormal. A study correlating echocardiographic and invasive hemodynamic findings reported that a PASP greater than 45 mm Hg had 97% specificity for pulmonary hypertension [1]. Notably, the sensitivity was only 47%, highlighting the limitation of echo in excluding pulmonary hypertension. The decision to proceed to invasive evaluation depends on the clinical suspicion, the importance of making the diagnosis, and the risk of the invasive procedure. 2.2. Clinical Symptoms and Signs Patients with pulmonary hypertension present with symptoms of dyspnea on exertion, fatigue, chest pain, syncope, palpitations, and lower extremity edema [2]. Common exam findings include a sternal lift, loud P2, right-sided S4, a murmur of tricuspid regurgitation with giant v waves, and a pulsatile liver [2]. In advanced PH, patients become dyspneic at rest and hypoxic due to severely impaired diffusion capacity. They are prone to chest pain related to RV myocardial oxygen demand outstripping supply and exertional syncope related to failure of the RV to eject against its elevated afterload. Progressive lower extremity edema, liver failure, and ascites also occur due to chronically elevated RA pressure. 2.3. Prevalence of PH in the General Population Pulmonary arterial hypertension (PAH), often termed primary pulmonary hypertension, is a relatively rare condition. A French registry estimates the prevalence of PAH at 15 per million adults. Idiopathic PAH is the most common form of PAH and is more common in women [3]. The prevalence of PH is significantly greater when secondary forms of PH are considered. A survey of residents in Olmstead County, Minnesota found that 25% had an echo-based estimate of PASP exceeding 30 mm Hg [4]. Additionally, the authors found that PA pressure increased with age. 2.4. Classification Though sometimes referred to as a specific disease, pulmonary hypertension is simply an objective finding, akin to an opacity on a chest radiograph, with a wide variety of underlying causes. Effective treatment requires a more specific diagnosis. In an effort to incorporate evolving evidence, the classification system of PH has been repeatedly updated since the first WHO conference in 1973 [5]. The most recent classification was established at the 4th WHO World Symposium in 2008 at Dana Point, California. In this schema, PH is divided into 5 primary categories (Table 1) [6]. They include Group I (pulmonary arterial hypertension), Group II (owing to left heart disease), Group III (owing to lung disease or hypoxemia), Group IV (chronic thromboembolic pulmonary hypertension), and Group V (unclear or multifactorial mechanisms). Group I is distinct as the group which benefits from specific pulmonary vascular remodeling agents including phosphodiesterase 5 inhibitors, endothelin antagonists, and prostacyclin analogs. Group I includes idiopathic PAH, familial PAH, and PAH associated with connective tissue disease, HIV infection, portal hypertension, congenital heart disease, schistosomiasis, chronic hemolytic anemia, pulmonary venoocclusive disease, and pulmonary capillary hemangiomatosis. Table 1: Dana Point clinical classification of pulmonary hypertension (2008). 2.5. Prognosis Despite modern therapy, the prognosis of PAH is poor with a 1-year mortality of 15% [7]. Adverse prognostic markers include a 6-minute walk test less than 300 meters, right atrial pressure greater than 20 mmHg, right ventricular enlargement or dysfunction, cardiac index less than 2 L/min/m2, elevated BNP, and scleroderma spectrum etiology [2]. 2.6. Treatment Optimal treatment hinges on an accurate and specific diagnosis. As noted above, the drugs developed for PAH have been established as safe and efficacious only for PAH (WHO Group I) and may precipitate sudden decompensation in WHO Group II (PH owing to left heart failure). For WHO Groups II–V, the treatment of PH is generally aimed at the underlying disorder supplemented by the treatment of hypoxemia and the judicious use of diuretics and digoxin [8]. 3. Coexistence of Obesity and Pulmonary Hypertension 3.1. Prevalence of Obesity Data from the 2007-2008 National Health and Nutrition Examination (NHANES) reveal that over two-thirds of the US adult population is overweight or obese [9]. Tragically, these individuals carry a disproportionate burden of many chronic illness including diabetes, hypertension, coronary disease, heart failure, arthritis, and gall bladder disease [10]. 3.2. Prevalence of PH in the Obese There is limited data on the prevalence of PH in the obese. A retrospective single center study reported that 5% of otherwise healthy individuals with a BMI > 30 kg/m2 had moderate or severe pulmonary hypertension (PASP greater than 50 mm Hg on echocardiogram) [11]. The inclusion of lesser severity PH would likely greatly increase the prevalence. A single center showed that 38% of patients with primary PH were obese and 48% of patients with severe secondary PH were obese [12]. Finally, a positive relationship between BMI and RV dysfunction (a sequella of chronic pulmonary hypertension) has been described after controlling for age, insulin, and mean arterial pressure [13]. Multiple mechanisms link obesity to pulmonary hypertension and more than one may simultaneously operate in an individual patient. Several investigators have suggested a synergistic effect of multiple factors by demonstrating pulmonary hypertension out of proportion to what would be expected based on any of the individual mediators [14, 15]. In the following section, we review the evidence linking obesity and its comorbidities to pulmonary hypertension. 4. Specific Pathophysiologic Mechanisms 4.1. Obstructive Sleep Apnea Obstructive sleep apnea (OSA) is characterized by obstructive episodes associated with signs of disturbed sleep (e.g. snoring and restlessness) and daytime somnolence. The prevalence of symptomatic obstructive sleep apnea in a middle-aged population is 4-5% [16, 17]. Sleep-disordered breathing, defined as >5 apneic episodes per hour, is frequent, occurring in nearly one in five adults. Obesity is the strongest risk factor for OSA; this is evidenced by the 40% prevalence of OSA in the obese [18]. Obstructive sleep apnea was formally recognized as a cause of PH when the WHO added OSA to the group III classification of PH in 2009 [6]. The prevalence of PH in patients with OSA varies from 17% to nearly 50% [17, 1921]. Definitions of PH and the method of measuring PA pressure (echocardiogram versus right heart catheterization) have varied between studies, and these variations contribute to the wide range in the reported prevalence of PH in patients with OSA. The largest data set with invasive measurement of pulmonary artery pressures demonstrates a 17% incidence of PH in 220 consecutively enrolled OSA patients [22]. Obstructive sleep apnea leads to repetitive nocturnal hypoxemia, hypercapnia, acidosis, increased sympathetic tone, and wide swings of intrathoracic pressure. Endothelial dependent vasoreactivity is also diminished by OSA [23]. These processes lead to pulmonary artery hypoxic vasoconstriction and subsequent pulmonary arteriolar remodeling. Animal models have clearly demonstrated that brief, repetitive exposure to hypoxemia over a duration of just a few weeks is sufficient to cause pulmonary arteriolar remodeling and right ventricular hypertrophy [24, 25]. In isolation, OSA typically causes only mild PH that does not require specific treatment aimed at PH [14, 21, 26, 27]. However, OSA patients often present with more severe degrees of PH when they have comorbid conditions contributing to hypoxemia. These conditions include diastolic heart failure (often due to obesity of cardiomyopathy), restrictive lung disease, COPD, obesity hypoventilation syndrome, and residence at a moderately high altitude [15, 26, 28, 29]. Obstructive sleep apnea mediated PH has downstream effects on the right ventricle. This has been demonstrated in echocardiographic studies showing severe OSA is linked to right ventricular hypertrophy and diminished right ventricular contractility [3032]. While subtle changes in RV morphology and function are common in the obese and those with OSA, end stage right heart failure, cor pulmonale, is not typically caused by OSA alone [13]. The strongest evidence for OSA as an independent cause of PH comes from studies showing that treatment of OSA with continuous positive airway pressure (CPAP) lowers pulmonary artery pressures. CPAP ameliorates PH by correcting hypoxia and acidosis, lowering sympathetic tone and improving endothelial function [33, 34]. Arias et al. used a placebo-controlled, crossover design in randomizing OSA patients and normal controls to CPAP or sham CPAP for 12 weeks [29]. Effective CPAP resulted in a statistically significantly drop in pulmonary artery systolic pressure. In an earlier study, six months of CPAP therapy in patients with OSA and PH yielded a small, but statistically significant 3 mm Hg drop in mean PA pressures. The drop in PA pressure with treatment of OSA strongly points to OSA as an independent and causative mediator of PH. However, most patients in these studies had only mild PH. Further, CPAP resulted in a relatively small, albeit statistically significant, drop in PA pressures. Further study is needed to determine if CPAP leads to clinically relevant improvements in functional status or outcome in PH patients with OSA. In sum, OSA has emerged as an independent risk factor for PH. Treatment of OSA with CPAP modestly improves pulmonary artery pressures. Isolated OSA typically results in only mild PH, but when OSA is combined with a second cause of hypoxemia, PH can be moderate or severe. 4.2. Obesity Hypoventilation Syndrome Obesity hypoventilation syndrome (OHS) is defined by chronic hypoventilation and hypoxemia in the obese patient with sleep-disordered breathing. The prevalence of OHS and its severity are linearly related to BMI. Obesity hypoventilation syndrome is very rare at BMI less than 30 kg/m2 but occurs in 31% of patients with BMI > 35 kg/m2 [35]. By definition, OHS is associated with diurnal hypoxemia in contrast to the almost exclusively nocturnal hypoxemia seen in OSA. Pulmonary hypertension is more frequent and more severe in OHS as compared to OSA. Pulmonary hypertension occurs in approximately 50% of OHS patients, as compared to approximately 20% of OSA patients [17, 36, 37]. The diurnal hypoxemia, hypercapnia, and acidosis associated with OHS are mediators of PH. Secondary contributors to PH in patients with OHS are restrictive lung disease related to severe obesity and the wide intrathoracic pressure shifts in the respiratory cycle due to increased upper airway resistance. Upper airway obstruction results in profound negative intrathoracic pressures during inspiration, up to −70 mm Hg. These negative intrathoracic pressures augment RV filling causing a leftward shift of the intraventricular septum which impedes LV filling and thus elevates pulmonary venous pressures and lowers LV stroke volume. This mechanism accounts for the presence of pulsus paradoxus in patients with OHS and severe lung disease. The pulmonary vascular beds initial response to hypoxemia is vasoconstriction at the pulmonary arteriolar and capillary level. With relief of the hypoxemia this vasoconstriction is reversible. However with chronic hypoxemia, as seen in OHS, pulmonary artery remodeling occurs, and over time the pulmonary arterial hypertension transitions from a process of vasoconstriction to one of endothelial dysfunction, arterial wall thickening, and fibrosis. At this point the PH becomes much more difficult to reverse. As mentioned previously, OHS is associated with more severe PH than is OSA. A small study examining 26 patients with OHS compared to the same number of patients with OSA showed the OSH patients were significantly more likely to suffer cor pulmonale (odds ratio of 9, CI 1.4–57.1) [38]. Treatment of OHS with CPAP is effective in remedying hypoxemia and hypercapnia [28]. As such, it can be presumed that CPAP will improve PH in patients who have reversible pulmonary hypertension, meaning patients who have not developed pulmonary arteriolar remodeling as a result of the chronic hypoxia. Several small nonrandomized studies suggest CPAP does improve PH [39]. Bariatric surgery and tracheostomy are effective treatments for OHS which improve hypoxemia and hypercapnia [37, 40, 41]. The effect of these treatments on PH has not been explicitly studied. 4.3. Anorexigen Use There have been two epidemics of WHO group I (primary) pulmonary hypertension related to anorexigen use. The first occurred in the late 1960s and was associated with the amphetamine analogue aminorex. This drug was strongly linked to primary pulmonary hypertension; the odds ratio for development of primary PH in patients exposed to this drug was in excess of 1000 [42]. The drug was withdrawn from the market in 1973. The methamphetamine analogues fenfluramine and dexfenfluramine were linked to PH in the International Primary Pulmonary Hypertension Study (IPPS) published in 1996. In this study, use of anorectic drugs (primarily fenfluramine and dexfenfluramine) was associated with a sixfold increase in the risk of primary PH [43]. The IPPS data showed the duration of anorexigen use was directly related to the risk of PH. Further studies have confirmed the association of aminorex, fenfluramine, and dexfenfluramine with PH. The PH associated with anorexigen use is not typically reversible with removal of the drug. The course of PH associated with anorexigen use is akin to that of the broader population with primary PH [44]. Fenfluramine and dexfenfluramine are also associated with acquired cardiac valvular pathology and cardiac fibrosis and were withdrawn from the market in 1997. The mechanisms by which these anorexigens precipitate PH are emerging. Aminorex, fenfluramine, and dexfenfluramine all inhibit a specific membrane potassium channel. The inhibition of this potassium current leads to opening of an L-type calcium channel which has been shown to cause vasoconstriction of the pulmonary arterioles [42]. A second mechanism linking PH to these drugs involves excess serotonin. These anorexigens increase 5-HT release from platelets. 5-HT, a precursor of serotonin, is a pulmonary vasoconstrictor and mediator of smooth muscle proliferation. Levels of 5-HT are elevated in all Group I PH patients, not just those who have anorexigen exposure [45]. A “serotonin hypothesis” of pulmonary arterial hypertension has evolved based on the lessons learned from the anorexigens and is an area of active research [45, 46]. There are sporadic case reports of phentermine mediated primary PH; interestingly this drug is shown to inhibit reuptake of 5-HT in a rabbit model. However, to date there is no substantive link between this drug and PH, and this drug remains on the market. 4.4. Cardiomyopathy of Obesity Obesity is a well-established risk factor for the development of heart failure with obesity, increasing the risk of incident congestive heart failure by two-fold or more [47, 48]. The cardiomyopathy of obesity is a clinical syndrome characterized by eccentric ventricular hypertrophy (dilation without wall thickening) and diastolic heart failure in severely obese patients [49]. The chronically elevated left ventricular filling pressures associated with left ventricular failure can lead to “secondary” PH. When PH develops due to this mechanism, it is classified as WHO group II. Initially, elevated left ventricular diastolic pressure is transmitted into the pulmonary venous system elevating pulmonary venous pressure which results in only mild PH, which is typically reversible. However, over time chronically elevated pulmonary venous pressures lead to pulmonary arteriolar remodeling and fixed elevated pulmonary vascular resistance [50]. There are two primary mechanisms postulated to explain the cardiomyopathy of obesity. First, triglyceride excess and mishandling lead to their deposition in myocardial cells, which, in turn, leads to myocardial cell apoptosis and fibrosis [51, 52]. Obese Zucker diabetic fatty rats develop left ventricular dilation and reduced contractility due to steatosis-induced apoptosis of myocardial cells [53]. Further, sulfonylurea therapy lowers myocardial triglyceride levels in these rats and prevents deterioration in myocardial function. Obese diabetic patients have increased myocardial uptake and utilization of nonesterified fatty acids with concomitant decrease in myocardial glucose uptake [54]. These metabolic alterations result in triglyceride and free fatty acid deposition in the myocardium. Myocardial steatosis, visualized on cardiac MRI, is an independent predictor of left ventricular diastolic dysfunction [51]. There is evidence suggesting that the myocardial steatosis process is similar to the more commonly recognized hepatic steatosis, “fatty liver.” In fact, elevated liver triglyceride content in type II diabetics is associated with a shift in myocardial metabolism away from glucose towards fatty acids and resultant diastolic dysfunction [55]. Other contributors to myocardial dysfunction in this condition include insulin resistance, elevated sympathetic tone, activation of the renin angiotensin axis, and endothelial dysfunction [56]. The second mechanism by which the obesity of cardiomyopathy begets PH begins with the physiologic response to the excess volume load placed on the left ventricle in severely obese patients. Intravascular volume expands with obesity. Metabolically active fat requires blood flow leading to higher cardiac output. The increased volume load on the heart also leads to eccentric left ventricular hypertrophy [57]. This change in ventricular morphology is adaptive in its initial stages. Eccentric ventricular hypertrophy is seen with other chronic volume load states such as aortic insufficiency, mitral regurgitation, and atrial septal defects. However, over time the left ventricular dilation becomes pathologic. The initial functional abnormalities are impaired left ventricular diastolic filling and subtle changes in ventricular contractility [13, 58, 59]. Diastolic dysfunction leads to elevated left atrial filling pressures which are transmitted to the pulmonary venous system. Long standing elevation in pulmonary venous pressures leads to secondary changes in pulmonary vascular resistance leading to pulmonary hypertension. There is interplay between OSA, metabolic syndrome, and elevated left ventricular filling in the genesis of PH in some obese patients. This is evidenced by a study showing the majority of OSA patients with coexisting PH also had elevated left ventricular filling pressures [15, 27]. There appears to be an overlap syndrome where OSA, diastolic heart failure, and metabolic syndrome combine to produce PH out of proportion to what would be expected from any of the individual conditions [15, 27, 29]. Other contributors to left ventricular myocardial dysfunction in the obese include insulin resistance, elevated sympathetic tone, activation of the renin angiotensin axis, and endothelial dysfunction [56]. The most effective and durable treatment for cardiomyopathy of obesity is weight loss [56]. Weight loss by any means, including diet, exercise, and bariatric surgery, has been shown to improve ventricular function in patients with cardiomyopathy of obesity [56, 60, 61]. Weight loss of only 5 pounds improves left ventricular contractility, diastolic function, and endothelial function [61]. The means by which weight loss is achieved seems to impact the improvement in cardiac function. Wirth and Kroger found that weight loss achieved through diet and exercise resulted in more significant regression of eccentric hypertrophy than did weight loss achieved with diet alone [60]. The effects of pharmacologically induced weight loss on the cardiomyopathy of obesity have not been well documented. There is little other proven treatment for cardiomyopathy of obesity [56]. 4.5. Chronic Thromboembolic Disease Chronic thromboembolic pulmonary hypertension (CTEPH), WHO group IV, occurs in approximately 4% of patients surviving an acute PE [62]. The prevalence of the CTEPH in the general population and in the obese is not well characterized [63]. Obesity and insulin resistance are independent risk factors for both deep venous thrombosis and pulmonary embolism [6466]. Thus, it seems reasonable to speculate that the obese shoulder a disproportionate burden of CTEPH. Sedentary lifestyle and chronic low grade inflammation are long recognized links between obesity and venous thrombi. Obstructive sleep apnea leads to a prothrombotic state via up regulation of platelet aggregation, increased clotting factor activity, and endothelial dysfunction [6769]. In the acute setting, pulmonary embolus causes PH through the hemodynamic effects of the embolus lodging in the pulmonary arterial tree. Chronically, there is distortion of the pulmonary vessels due to parenchymal changes and smooth muscle hypertrophy. 4.6. Novel Mechanisms The role of obesity-induced endothelial dysfunction and oxidative stress in pulmonary hypertension is under active investigation. Insulin resistance is an independent risk factor for PH [70, 71]. Obesity, insulin resistance, and sleep apnea have all been shown to impair endothelial function [33, 66, 70, 72, 73]. These conditions activate vasoconstrictive agents, such as endothelin, and decrease vasodilators, such as nitric oxide which likely accounts for their association with PH. Obesity and its comorbidities are also associated with increased oxidative stress through lipid peroxidation, production of reactive oxygen species, and overexpression of xanthine oxidase [74]. Isolated pulmonary arteries of insulin resistant rats show diminished acetylcholine-mediated nitric oxide release, as well as upregulation of NADPH oxidase, 5-HT, and cycloxygenase-2 proteins [7577]. Interestingly, in animal models, insulin resistance coupled with moderate hypoxia results in PH and right ventricular hypertrophy while neither insulin resistance nor hypoxemia alone induces PH or right ventricular hypertrophy [78]. Treatment with insulin sensitizing agents can reverse PH and attenuate pulmonary artery remodeling in insulin-resistant rodents [79, 80]. In humans, treatment of OSA with CPAP both lowers PA pressures and improves measures of endothelial function [23, 81, 82]. Insulin-sensitizing drugs improve endothelial function in adults with type II diabetes but the significance of these findings for the pulmonary vasculature has not been defined [8386]. Hyperuricemia is common in both primary and secondary forms of pulmonary hypertension, and the severity of PH correlates with levels of uric acid [87]. Zharikov et al. have proposed that hyperuricemia is a pathologic mediator of PH rather than a secondary phenomenon [88]. Chronic hyperuricemia is associated with increased levels of endothelin, diminished nitric oxide production and diminished flow mediated dilation, all markers of endothelial dysfunction [89, 90]. Diabetes, obesity, and metabolic syndrome may lead to pulmonary hypertension through a mechanism involving hyperuricemia. Lowering uric acid levels to treat PH has not been fully investigated. 5. Evaluation and Treatment of Pulmonary Hypertension in the Obese 5.1. Diagnostic Approach In this paper, we have highlighted the pathophysiologic mechanisms of pulmonary hypertension in the obese. However, patients with obesity may have any of the recognized forms of pulmonary hypertension mentioned in the classification system previously and should be evaluated in the same systematic fashion as nonobese patients. Due to the numerous and diverse conditions which may underlie pulmonary hypertension, the diagnostic evaluation is extensive. Depending on the proximity of a pulmonary hypertension center, a generalist physician may choose to obtain these studies locally prior to referring the patient. After a careful history, exam, chest X-ray, ECG, and transthoracic echocardiography, the essential tests include a V/Q scan, PFTs, overnight oximetry, HIV screening, antinuclear antibodies, liver function tests, a 6-minute walk test, and a right heart catheterization (extended to left heart catheterization if there is doubt about the veracity of the PCWP and coronary angiography if there is uncertainty about the presence of obstructive coronary disease contributing to dyspnea and exercise intolerance) [2]. Additional studies may be necessary based on these findings, but these studies will generally allow classification and guide subsequent treatment decisions. Relevant to obesity, right heart access from an arm vein and left heart access from the radial artery may be preferred. 5.2. Staging of Disease In addition to determining the etiology of the PH, staging is required to tailor the intensity of therapy. This generally includes a judgment regarding functional class (I–IV), the 6-minute walk distance (in meters), consideration of invasive hemodynamics (RA pressure, mean PA pressure, PVR, and cardiac output), and presence of RV dilation and systolic dysfunction by echocardiography. 5.3. Treatment A detailed discussion of the treatment of pulmonary hypertension is beyond the scope of this paper, but specific medical therapy is generally limited to those with WHO Group I pulmonary hypertension (pulmonary arterial hypertension) [91]. Drugs from 3 pharmacologic classes (phospodiesterase-5 inhibitors, endothelin receptor antagonists, and prostanoids) delivered by oral, inhaled, continuous subcutaneous, and continuous intravenous routes are approved by the FDA for treatment of pulmonary arterial hypertension. These agents have been shown to improve symptoms and functional capacity, but evidence of mortality benefit is limited to IV epoprostenol [92]. The medical treatment of Groups II–V has not been the subject of many published clinical trials to date, but in general, Group I agents have not been effective in Groups II–IV [93]. In Group II (left heart failure), treatment is generally directed at the underlying cause of the left heart failure and reducing pulmonary venous pressure. Specific to obesity, therapy directed at improving diastolic function is paramount. As noted previously, weight loss by lifestyle and surgical means has been shown to improve diastolic function [60, 61]. A recent small study has suggested that sildenafil may be effective in the treatment of pulmonary hypertension associated with heart failure with preserved LV function [94]. This needs to be confirmed in a larger trial before widespread adoption. In Group III (chronic lung disease), issues specifically relevant to the obese include treatment of obstructive sleep apnea with weight loss and CPAP and treatment of obesity hypoventilation syndrome with consideration of tracheostomy. In Group IV (chronic thromboembolic disease), evaluation for pulmonary endarterectomy at a specialized center should be considered [95]. 6. Conclusion Pulmonary hypertension should be considered in the evaluation of dyspnea in patients with obesity. If elevated pulmonary pressures are documented by echocardiography, further investigations are needed to refine the diagnosis and guide the choice of therapy. Patients with obesity may suffer from any of the etiologies which affect nonobese patients but are at increased risk for obstructive sleep apnea, obesity hypoventilation syndrome, cardiomyopathy of obesity, restrictive lung disease, chronic thromboembolism, and anorexigen-related pulmonary hypertension. In addition, there may be additional mechanisms which are still under investigation. Optimal treatment hinges on an accurate and specific diagnosis. Drugs approved by the FDA for treatment of PH are limited to Group I PH. Weight loss by a variety of means has been shown to be effective in reducing pulmonary artery pressure and improving cardiovascular function. Abbreviations BMI:Body mass index CPAP:Continuous positive airway pressure CTEPH:Chronic thromboembolic pulmonary hypertension ECG:Electrocardiogram OHS:Obesity hypoventilation syndrome OSA:Obstructive sleep apnea PAH:Pulmonary arterial hypertension PCWP:Pulmonary capillary wedge pressure PH:Pulmonary hypertension PVH:Pulmonary venous hypertension V/Q:Ventilation and perfusion scintigraphy. References 1. D. Mukerjee, D. S. George, C. Knight et al., “Echocardiography and pulmonary function as screening tests for pulmonary arterial hypertension in systemic sclerosis,” Rheumatology, vol. 43, no. 4, pp. 461–466, 2004. View at Publisher · View at Google Scholar · View at Scopus 2. V. V. McLaughlin, S. L. Archer, D. B. Badesch et al., “ACCF/AHA 2009 expert consensus document on pulmonary hypertension a report of the american college of cardiology foundation task force on expert consensus documents and the american heart association developed in collaboration with the american college of chest physicians; american thoracic society, inc.; and the pulmonary hypertension association,” Journal of the American College of Cardiology, vol. 53, no. 17, pp. 1573–1619, 2009. View at Publisher · View at Google Scholar · View at Scopus 3. M. Humbert, O. Sitbon, A. Chaouat et al., “Pulmonary arterial hypertension in France: results from a national registry,” American Journal of Respiratory and Critical Care Medicine, vol. 173, no. 9, pp. 1023–1030, 2006. View at Publisher · View at Google Scholar · View at Scopus 4. C. S. Lam, B. A. Borlaug, G. C. Kane, F. T. Enders, R. J. Rodeheffer, and M. M. Redfield, “Age-associated increases in pulmonary artery systolic pressure in the general population,” Circulation, vol. 119, no. 20, pp. 2663–2670, 2009. View at Publisher · View at Google Scholar · View at Scopus 5. S. Hatano and R. Strasser, Eds., “Primary pulmonary hypertension,” World Heath Organization, Geneva, Switzerland, 1975. 6. G. Simonneau, I. M. Robbins, M. Beghetti et al., “Updated clinical classification of pulmonary hypertension,” Journal of the American College of Cardiology, vol. 54, no. 1, supplement, pp. S43–S54, 2009. View at Publisher · View at Google Scholar · View at Scopus 7. T. Thenappan, S. J. Shah, S. Rich, and M. Gomberg-Maitland, “A USA-based registry for pulmonary arterial hypertension: 1982–2006,” European Respiratory Journal, vol. 30, no. 6, pp. 1103–1110, 2007. View at Publisher · View at Google Scholar · View at Scopus 8. M. M. Hoeper, J. A. Barberà, R. N. Channick et al., “Diagnosis, assessment, and treatment of non-pulmonary arterial hypertension pulmonary hypertension,” Journal of the American College of Cardiology, vol. 54, no. 1, supplement, pp. S85–S96, 2009. View at Publisher · View at Google Scholar · View at Scopus 9. C. L. Ogden, M. D. Carroll, B. K. Kit, and K. M. Flegal, “Prevalence of obesity and trends in body mass index among US children and adolescents, 1999–2010,” The Journal of the American Medical Association, vol. 307, no. 5, pp. 483–490, 2012. 10. A. E. Field, E. H. Coakley, A. Must et al., “Impact of overweight on the risk of developing common chronic diseases during a 10-year period,” Archives of Internal Medicine, vol. 161, no. 13, pp. 1581–1586, 2001. View at Scopus 11. B. M. McQuillan, M. H. Picard, M. Leavitt, and A. E. Weyman, “Clinical correlates and reference intervals for pulmonary artery systolic pressure among echocardiographically normal subjects,” Circulation, vol. 104, no. 23, pp. 2797–2802, 2001. View at Scopus 12. A. Taraseviciute and N. F. Voelkel, “Severe pulmonary hypertension in postmenopausal obese women,” European Journal of Medical Research, vol. 11, no. 5, pp. 198–202, 2006. View at Scopus 13. C. Y. Wong, T. O'Moore-Sullivan, R. Leano, C. Hukins, C. Jenkins, and T. H. Marwick, “Association of subclinical right ventricular dysfunction with obesity,” Journal of the American College of Cardiology, vol. 47, no. 3, pp. 611–616, 2006. View at Publisher · View at Google Scholar · View at Scopus 14. C. S. Dela Cruz and R. A. Matthay, “Role of obesity in cardiomyopathy and pulmonary hypertension,” Clinics in Chest Medicine, vol. 30, no. 3, pp. 509–523, 2009. View at Publisher · View at Google Scholar · View at Scopus 15. C. C. Leung, V. Moondra, E. Catherwood, and B. W. Andrus, “Prevalence and risk factors of pulmonary hypertension in patients with elevated pulmonary venous pressure and preserved ejection fraction,” American Journal of Cardiology, vol. 106, no. 2, pp. 284–286, 2010. View at Publisher · View at Google Scholar · View at Scopus 16. V. K. Somers, D. P. White, R. Amin, et al., “Sleep apnea and cardiovascular disease: An American Heart Association/american college of cardiology foundation scientific statement from the american heart association council for high blood pressure research professional education committee, council on clinical cardiology, stroke council, and council on cardiovascular nursing. in collaboration with the national heart, lung, and blood institute national center on sleep disorders research (National Institutes of Health),” Circulation, vol. 118, no. 10, pp. 1080–1111, 2008. 17. C. W. Atwood Jr., D. McCrory, J. G. Garcia, S. H. Abman, and G. S. Ahearn, “Pulmonary artery hypertension and sleep-disordered breathing: ACCP evidence-based clinical practice guidelines,” Chest, vol. 126, no. 1, supplement, pp. 72S–77S, 2004. View at Publisher · View at Google Scholar · View at Scopus 18. A. N. Vgontzas, T. L. Tan, E. O. Bixler, L. F. Martin, D. Shubert, and A. Kales, “Sleep apnea and sleep disruption in obese patients,” Archives of Internal Medicine, vol. 154, no. 15, pp. 1705–1711, 1994. View at Publisher · View at Google Scholar · View at Scopus 19. E. Bady, A. Achkar, S. Pascal, E. Orvoen-Frija, and J. P. Laaban, “Pulmonary arterial hypertension in patients with sleep apnoea syndrome,” Thorax, vol. 55, no. 11, pp. 934–939, 2000. View at Publisher · View at Google Scholar · View at Scopus 20. D. Sajkov, T. Wang, N. A. Saunders, A. J. Bune, A. M. Neill, and R. D. McEvoy, “Daytime pulmonary hemodynamics in patients with obstructive sleep apnea without lung disease,” American Journal of Respiratory and Critical Care Medicine, vol. 159, no. 5, part 1, pp. 1518–1526, 1999. View at Scopus 21. D. Sajkov and R. D. McEvoy, “Obstructive sleep apnea and pulmonary hypertension,” Progress in Cardiovascular Diseases, vol. 51, no. 5, pp. 363–370, 2009. View at Publisher · View at Google Scholar · View at Scopus 22. A. Chaouat, E. Weitzenblum, J. Krieger, M. Oswald, and R. Kessler, “Pulmonary hemodynamics in the obstructive sleep apnea syndrome. Results in 220 consecutive patients,” Chest, vol. 109, no. 2, pp. 380–386, 1996. View at Scopus 23. M. Kato, P. Roberts-Thomson, B. G. Phillips et al., “Impairment of endothelium-dependent vasodilation of resistance vessels in patients with obstructive sleep apnea,” Circulation, vol. 102, no. 21, pp. 2607–2610, 2000. View at Scopus 24. M. J. Campen, L. A. Shimoda, and C. P. O'Donnell, “Acute and chronic cardiovascular effects of intermittent hypoxia in C57BL/6J mice,” Journal of Applied Physiology, vol. 99, no. 5, pp. 2028–2035, 2005. View at Publisher · View at Google Scholar · View at Scopus 25. M. McGuire and A. Bradford, “Chronic intermittent hypercapnic hypoxia increases pulmonary arterial pressure and haematocrit in rats,” European Respiratory Journal, vol. 18, no. 2, pp. 279–285, 2001. View at Publisher · View at Google Scholar · View at Scopus 26. M. Valencia-Flores, V. Rebollar, V. Santiago et al., “Prevalence of pulmonary hypertension and its association with respiratory disturbances in obese patients living at moderately high altitude,” International Journal of Obesity, vol. 28, no. 9, pp. 1174–1180, 2004. View at Publisher · View at Google Scholar · View at Scopus 27. O. A. Minai, B. Ricaurte, R. Kaw et al., “Frequency and impact of pulmonary hypertension in patients with obstructive sleep apnea syndrome,” American Journal of Cardiology, vol. 104, no. 9, pp. 1300–1306, 2009. View at Publisher · View at Google Scholar · View at Scopus 28. B. Mokhlesi, “Obesity hypoventilation syndrome: a state-of-the-art review,” Respiratory Care, vol. 55, no. 10, pp. 1347–1362, 2010. View at Scopus 29. M. A. Arias, F. García-Río, A. Alonso-Fernández, I. Martínez, and J. Villamor, “Pulmonary hypertension in obstructive sleep apnoea: effects of continuous positive airway pressure: a randomized, controlled cross-over study,” European Heart Journal, vol. 27, no. 9, pp. 1106–1113, 2006. View at Publisher · View at Google Scholar · View at Scopus 30. U. C. Guidry, L. A. Mendes, J. C. Evans et al., “Echocardiographic features of the right heart in sleep-disordered breathing: The Framingham Heart Study,” American Journal of Respiratory and Critical Care Medicine, vol. 164, no. 6, pp. 933–938, 2001. View at Scopus 31. N. Dursunoǧlu, D. Dursunoǧlu, and M. Kiliç, “Impact of obstructive sleep apnea on right ventricular global function: sleep apnea and myocardial performance index,” Respiration, vol. 72, no. 3, pp. 278–284, 2005. View at Publisher · View at Google Scholar · View at Scopus 32. A. Romero-Corral, V. K. Somers, P. A. Pellikka et al., “Decreased right and left ventricular myocardial performance in obstructive sleep apnea,” Chest, vol. 132, no. 6, pp. 1863–1870, 2007. View at Publisher · View at Google Scholar · View at Scopus 33. R. Budhiraja, S. Parthasarathy, and S. F. Quan, “Endothelial dysfunction in obstructive sleep apnea,” Journal of Clinical Sleep Medicine, vol. 3, no. 4, pp. 409–415, 2007. View at Scopus 34. A. A. El-Solh, M. E. Akinnusi, B. Moitheennazima, L. Ayyar, and S. Relia, “Endothelial function in patients with post-CPAP residual sleepiness,” Journal of Clinical Sleep Medicine, vol. 6, no. 3, pp. 251–255, 2010. View at Scopus 35. S. Nowbar, K. M. Burkart, R. Gonzales et al., “Obesity-associated hypoventilation in hospitalized patients: prevalence, effects, and outcome,” American Journal of Medicine, vol. 116, no. 1, pp. 1–7, 2004. View at Publisher · View at Google Scholar · View at Scopus 36. R. Kessler, A. Chaouat, E. Weitzenblum et al., “Pulmonary hypertension in the obstructive sleep apnoea syndrome: prevalence, causes and therapeutic consequences,” European Respiratory Journal, vol. 9, no. 4, pp. 787–794, 1996. View at Publisher · View at Google Scholar · View at Scopus 37. H. J. Sugerman, P. L. Baron, R. P. Fairman, C. R. Evans, and G. W. Vetrovec, “Hemodynamic dysfunction in obesity hypoventilation syndrome and the effects of treatment with surgically induced weight loss,” Annals of Surgery, vol. 207, no. 5, pp. 604–613, 1988. View at Scopus 38. G. Berg, K. Delaive, J. Manfreda, R. Walld, and M. H. Kryger, “The use of health-care resources in obesity-hypoventilation syndrome,” Chest, vol. 120, no. 2, pp. 377–383, 2001. View at Publisher · View at Google Scholar · View at Scopus 39. J. F. Masa, B. R. Celli, J. A. Riesco, M. Hernández, J. Sánchez de Cos, and C. Disdier, “The obesity hypoventilation syndrome can be treated with noninvasive mechanical ventilation,” Chest, vol. 119, no. 4, pp. 1102–1107, 2001. View at Publisher · View at Google Scholar · View at Scopus 40. K. L. Haines, L. G. Nelson, R. Gonzalez et al., “Objective evidence that bariatric surgery improves obesity-related obstructive sleep apnea,” Surgery, vol. 141, no. 3, pp. 354–358, 2007. View at Publisher · View at Google Scholar · View at Scopus 41. H. J. Sugerman, R. P. Fairman, R. K. Sood, K. Engle, L. Wolfe, and J. M. Kellum, “Long-term effects of gastric surgery for treating respiratory insufficiency of obesity,” American Journal of Clinical Nutrition, vol. 55, no. 2, supplement, pp. 597S–601S, 1992. View at Scopus 42. E. D. Michelakis and E. K. Weir, “Anorectic drugs and pulmonary hypertension from the bedside to the bench,” American Journal of the Medical Sciences, vol. 321, no. 4, pp. 292–299, 2001. View at Scopus 43. L. Abenhaim, Y. Moride, F. Brenot et al., “Appetite-suppressant drugs and the risk of primary pulmonary hypertension. International Primary Pulmonary Hypertension Study Group,” The New England Journal of Medicine, vol. 335, no. 9, pp. 609–616, 1996. View at Publisher · View at Google Scholar · View at Scopus 44. R. Souza, M. Humbert, B. Sztrymf et al., “Pulmonary arterial hypertension associated with fenfluramine exposure: report of 109 cases,” European Respiratory Journal, vol. 31, no. 2, pp. 343–348, 2008. View at Publisher · View at Google Scholar · View at Scopus 45. M. R. MacLean, “Pulmonary hypertension, anorexigens and 5-HT: pharmacological synergism in action?” Trends in Pharmacological Sciences, vol. 20, no. 12, pp. 490–495, 1999. View at Publisher · View at Google Scholar · View at Scopus 46. M. R. MacLean and Y. Dempsie, “Serotonin and pulmonary hypertension-from bench to bedside?” Current Opinion in Pharmacology, vol. 9, no. 3, pp. 281–286, 2009. View at Publisher · View at Google Scholar · View at Scopus 47. S. A. Hunt, “American College of Cardiology, American Heart Association Task Force on Practice Guidelines (Writing Committee to Update the 2001 Guidelines for the Evaluation and Management of Heart Failure). ACC/AHA 2005 guideline update for the diagnosis and management of chronic heart failure in the adult: a report of the american college of Cardiology/American heart association task force on practice guidelines (writing committee to update the 2001 guidelines for the evaluation and management of heart failure),” Journal of the American College of Cardiology, vol. 46, no. 6, pp. e1–e82, 2005. 48. S. Kenchaiah, J. C. Evans, D. Levy et al., “Obesity and the risk of heart failure,” The New England Journal of Medicine, vol. 347, no. 5, pp. 305–313, 2002. View at Publisher · View at Google Scholar · View at Scopus 49. C. Y. Wong, T. O'Moore-Sullivan, R. Leano, N. Byrne, E. Beller, and T. H. Marwick, “Alterations of left ventricular myocardial characteristics associated with obesity,” Circulation, vol. 110, no. 19, pp. 3081–3087, 2004. View at Publisher · View at Google Scholar · View at Scopus 50. V. F. Segers, D. L. Brutsaert, and G. W. De Keulenaer, “Pulmonary hypertension and right heart failure in heart failure with preserved left ventricular ejection fraction: pathophysiology and natural history,” Current Opinion in Cardiology, vol. 27, no. 3, pp. 273–280, 2012. 51. L. J. Rijzewijk, R. W. van der Meer, J. W. Smit et al., “Myocardial steatosis is an independent predictor of diastolic dysfunction in type 2 diabetes mellitus,” Journal of the American College of Cardiology, vol. 52, no. 22, pp. 1793–1799, 2008. View at Publisher · View at Google Scholar · View at Scopus 52. C. Wong and T. H. Marwick, “Obesity cardiomyopathy: pathogenesis and pathophysiology,” Nature Clinical Practice Cardiovascular Medicine, vol. 4, no. 8, pp. 436–443, 2007. 53. Y. T. Zhou, P. Grayburn, A. Karim et al., “Lipotoxic heart disease in obese rats: implications for human obesity,” Proceedings of the National Academy of Sciences of the United States of America, vol. 97, no. 4, pp. 1784–1789, 2000. View at Publisher · View at Google Scholar · View at Scopus 54. L. J. Rijzewijk, R. W. van der Meer, H. J. Lamb et al., “Altered myocardial substrate metabolism and decreased diastolic function in nonischemic human diabetic cardiomyopathy: studies with cardiac positron emission tomography and magnetic resonance imaging,” Journal of the American College of Cardiology, vol. 54, no. 16, pp. 1524–1532, 2009. View at Scopus 55. L. J. Rijzewijk, J. T. Jonker, R. W. van der Meer et al., “Effects of hepatic triglyceride content on myocardial metabolism in type 2 diabetes,” Journal of the American College of Cardiology, vol. 56, no. 3, pp. 225–233, 2010. View at Publisher · View at Google Scholar · View at Scopus 56. C. Wong and T. H. Marwick, “Obesity cardiomyopathy: diagnosis and therapeutic implications,” Nature Clinical Practice Cardiovascular Medicine, vol. 4, no. 9, pp. 480–490, 2007. 57. M. A. Alpert, “Obesity cardiomyopathy: pathophysiology and evolution of the clinical syndrome,” American Journal of the Medical Sciences, vol. 321, no. 4, pp. 225–236, 2001. View at Scopus 58. B. D. Powell, M. M. Redfield, K. A. Bybee, W. K. Freeman, and C. S. Rihal, “Association of obesity with left ventricular remodeling and diastolic dysfunction in patients without coronary artery disease,” American Journal of Cardiology, vol. 98, no. 1, pp. 116–120, 2006. View at Publisher · View at Google Scholar · View at Scopus 59. L. R. Peterson, A. D. Waggoner, K. B. Schechtman et al., “Alterations in left ventricular structure and function in young healthy obese women: assessment by echocardiography and tissue Doppler imaging,” Journal of the American College of Cardiology, vol. 43, no. 8, pp. 1399–1404, 2004. View at Publisher · View at Google Scholar · View at Scopus 60. A. Wirth and H. Kroger, “Improvement of left ventricular morphology and function in obese subjects following a diet and exercise program,” International Journal of Obesity, vol. 19, no. 1, pp. 61–66, 1995. View at Scopus 61. C. Y. Wong, N. M. Byrne, T. O'Moore-Sullivan, A. P. Hills, J. B. Prins, and T. H. Marwick, “Effect of weight loss due to lifestyle intervention on subclinical cardiovascular dysfunction in obesity (body mass index >30 kg/m2),” American Journal of Cardiology, vol. 98, no. 12, pp. 1593–1598, 2006. View at Publisher · View at Google Scholar · View at Scopus 62. V. Pengo, A. W. Lensing, M. H. Prins et al., “Incidence of chronic thromboembolic pulmonary hypertension after pulmonary embolism,” The New England Journal of Medicine, vol. 350, no. 22, pp. 2257–2264, 2004. View at Publisher · View at Google Scholar · View at Scopus 63. V. F. Tapson, H. Decousus, M. Pini et al., “Venous thromboembolism prophylaxis in acutely ill hospitalized medical patients: findings from the International Medical Prevention Registry on Venous Thromboembolism,” Chest, vol. 132, no. 3, pp. 936–945, 2007. View at Publisher · View at Google Scholar · View at Scopus 64. S. Z. Goldhaber, “Epidemiology of pulmonary embolism,” Seminars in Vascular Medicine, vol. 1, no. 2, pp. 139–146, 2001. View at Scopus 65. S. Z. Goldhaber, D. D. Savage, R. J. Garrison, et al., “Risk factors for pulmonary embolism. The Framingham Study,” American Journal of Medicine, vol. 74, no. 6, pp. 1023–1028, 1983. View at Scopus 66. M. R. Movahed, M. Hashemzadeh, and M. M. Jamal, “The prevalence of pulmonary embolism and pulmonary hypertension in patients with type II diabetes mellitus,” Chest, vol. 128, no. 5, pp. 3568–3571, 2005. View at Publisher · View at Google Scholar · View at Scopus 67. G. Bokinsky, M. Miller, K. Ault, P. Husband, and J. Mitchell, “Spontaneous platelet activation and aggregation during obstructive sleep apnea and its response to therapy with nasal continuous positive airway pressure: a preliminary investigation,” Chest, vol. 108, no. 3, pp. 625–630, 1995. View at Scopus 68. C. Rangemark, J. A. Hedner, J. T. Carlson, G. Gleerup, and K. Winther, “Platelet function and fibrinolytic activity in hypertensive and normotensive sleep apnea patients,” Sleep, vol. 18, no. 3, pp. 188–194, 1995. View at Scopus 69. R. D. Rosenberg and W. C. Aird, “Vascular-bed-specific hemo stasis and hypercoagulable states,” The New England Journal of Medicine, vol. 340, no. 20, pp. 1555–1564, 1999. View at Publisher · View at Google Scholar · View at Scopus 70. R. T. Zamanian, G. Hansmann, S. Snook et al., “Insulin resistance in pulmonary arterial hypertension,” European Respiratory Journal, vol. 33, no. 2, pp. 318–324, 2009. View at Publisher · View at Google Scholar · View at Scopus 71. B. Fouty, “Diabetes and the pulmonary circulation,” American Journal of Physiology, vol. 295, no. 5, pp. L725–L726, 2008. View at Publisher · View at Google Scholar · View at Scopus 72. J. T. Carlson, C. Rångemark, and J. A. Hedner, “Attenuated endothelium-dependent vascular relaxation in patients with sleep apnoea,” Journal of Hypertension, vol. 14, no. 5, pp. 577–584, 1996. View at Publisher · View at Google Scholar · View at Scopus 73. A. T. Murugan and G. Sharma, “Obesity and respiratory diseases,” Chronic Respiratory Disease, vol. 5, no. 4, pp. 233–242, 2008. View at Publisher · View at Google Scholar · View at Scopus 74. K. Ramar and S. M. Caples, “Vascular changes, cardiovascular disease and obstructive sleep apnea,” Future Cardiology, vol. 7, no. 2, pp. 241–249, 2011. View at Publisher · View at Google Scholar · View at Scopus 75. J. G. Lopez-Lopez, J. Moral-Sanz, G. Frazziano et al., “Type 1 diabetes-induced hyper-responsiveness to 5-hydroxytryptamine in rat pulmonary arteries via oxidative stress and induction of cyclooxygenase-2,” Journal of Pharmacology and Experimental Therapeutics, vol. 338, no. 1, pp. 400–407, 2011. View at Publisher · View at Google Scholar · View at Scopus 76. J. Moral-Sanz, C. Menendez, L. Moreno, E. Moreno, A. Cogolludo, and F. Perez-Vizcaino, “Pulmonary arterial dysfunction in insulin resistant obese Zucker rats,” Respiratory Research, vol. 12, article 51, 2011. View at Publisher · View at Google Scholar · View at Scopus 77. J. G. Lopez-Lopez, J. Moral-Sanz, G. Frazziano et al., “Diabetes induces pulmonary artery endothelial dysfunction by NADPH oxidase induction,” American Journal of Physiology, vol. 295, no. 5, pp. L727–L732, 2008. View at Publisher · View at Google Scholar · View at Scopus 78. J. Moral-Sanz, J. G. Lopez-Lopez, C. Menendez, et al., “Different patterns of pulmonary vascular disease induced by type 1 diabetes and moderate hypoxia in rats,” Experimental Physiology, vol. 97, no. 5, pp. 676–686, 2012. 79. J. T. Crossno Jr., C. V. Garat, J. E. Reusch et al., “Rosiglitazone attenuates hypoxia-induced pulmonary arterial remodeling,” American Journal of Physiology, vol. 292, no. 4, pp. L885–L897, 2007. View at Publisher · View at Google Scholar · View at Scopus 80. G. Hansmann, R. A. Wagner, S. Schellong et al., “Pulmonary arterial hypertension is linked to insulin resistance and reversed by peroxisome proliferator-activated receptor-γ activation,” Circulation, vol. 115, no. 10, pp. 1275–1284, 2007. View at Publisher · View at Google Scholar · View at Scopus 81. M. Alchanatis, G. Tourkohoriti, S. Kakouros, E. Kosmas, S. Podaras, and J. B. Jordanoglou, “Daytime pulmonary hypertension in patients with obstructive sleep apnea: the effect of continuous positive airway pressure on pulmonary hemodynamics,” Respiration, vol. 68, no. 6, pp. 566–572, 2001. View at Publisher · View at Google Scholar · View at Scopus 82. R. Wolk, T. Kara, and V. K. Somers, “Sleep-disordered breathing and cardiovascular disease,” Circulation, vol. 108, no. 1, pp. 9–12, 2003. View at Publisher · View at Google Scholar · View at Scopus 83. J. Joya-Galeana, M. Fernandez, A. Cervera et al., “Effects of insulin and oral anti-diabetic agents on glucose metabolism, vascular dysfunction and skeletal muscle inflammation in type 2 diabetic subjects,” Diabetes/Metabolism Research and Reviews, vol. 27, no. 4, pp. 373–382, 2011. View at Publisher · View at Google Scholar · View at Scopus 84. H. Kitahara, Y. Kobayashi, Y. Iwata, Y. Fujimoto, and I. Komuro, “Effect of pioglitazone on endothelial dysfunction after sirolimus-eluting stent implantation,” American Journal of Cardiology, vol. 108, no. 2, pp. 214–219, 2011. View at Publisher · View at Google Scholar · View at Scopus 85. K. K. Naka, K. Papathanassiou, A. Bechlioulis, et al., “Rosiglitazone improves endothelial function in patients with type 2 diabetes treated with insulin,” Diabetes and Vascular Disease Research, vol. 8, no. 3, pp. 195–201, 2011. 86. S. Azhar, “Peroxisome proliferator-activated receptors, metabolic syndrome and cardiovascular disease,” Future Cardiology, vol. 6, no. 5, pp. 657–691, 2010. View at Publisher · View at Google Scholar · View at Scopus 87. M. A. Voelkel, K. M. Wynne, D. B. Badesch, B. M. Groves, and N. F. Voelkel, “Hyperuricemia in severe pulmonary hypertension,” Chest, vol. 117, no. 1, pp. 19–24, 2000. View at Scopus 88. S. I. Zharikov, E. R. Swenson, M. Lanaspa, E. R. Block, J. M. Patel, and R. J. Johnson, “Could uric acid be a modifiable risk factor in subjects with pulmonary hypertension?” Medical Hypotheses, vol. 74, no. 6, pp. 1069–1074, 2010. View at Publisher · View at Google Scholar · View at Scopus 89. G. Mercuro, C. Vitale, E. Cerquetani et al., “Effect of hyperuricemia upon endothelial function in patients at increased cardiovascular risk,” American Journal of Cardiology, vol. 94, no. 7, pp. 932–935, 2004. View at Publisher · View at Google Scholar · View at Scopus 90. S. Zharikov, K. Krotova, H. Hu et al., “Uric acid decreases NO production and increases arginase activity in cultured pulmonary artery endothelial cells,” American Journal of Physiology, vol. 295, no. 5, pp. C1183–C1190, 2008. View at Publisher · View at Google Scholar · View at Scopus 91. R. J. Barst, J. S. Gibbs, H. A. Ghofrani et al., “Updated evidence-based treatment algorithm in pulmonary arterial hypertension,” Journal of the American College of Cardiology, vol. 54, no. 1, supplement, pp. S78–S84, 2009. View at Publisher · View at Google Scholar · View at Scopus 92. R. J. Barst, L. J. Rubin, W. A. Long et al., “A comparison of continuous intravenous epoprostenol (prostacyclin) with conventional therapy for primary pulmonary hypertension,” The New England Journal of Medicine, vol. 334, no. 5, pp. 296–302, 1996. View at Scopus 93. M. M. Hoeper, J. A. Barberà, R. N. Channick et al., “Diagnosis, assessment, and treatment of non-pulmonary arterial hypertension pulmonary hypertension,” Journal of the American College of Cardiology, vol. 54, no. 1, supplement, pp. S85–S96, 2009. View at Publisher · View at Google Scholar · View at Scopus 94. M. Guazzi, M. Vicenzi, R. Arena, and M. D. Guazzi, “Pulmonary hypertension in heart failure with preserved ejection fraction: a target of phosphodiesterase-5 inhibition in a 1-year study,” Circulation, vol. 124, no. 2, pp. 164–174, 2011. View at Publisher · View at Google Scholar · View at Scopus 95. C. J. Archibald, W. R. Auger, P. F. Fedullo et al., “Long-term outcome after pulmonary thromboendarterectomy,” American Journal of Respiratory and Critical Care Medicine, vol. 160, no. 2, pp. 523–528, 1999. View at Scopus	v0
2024-06-03T18:26:15.484Z	2013-12-06T05:53:16.000Z	x7rql7jiuffleyqxqvfiv3qwd5agwxz6	{ "content_type": "application/xhtml+xml", "provenance": "cccc-CC-MAIN-2013-48-0004.json.gz:14755", "uncompressed_offset": 369337405, "url": "www.hindawi.com/journals/jos/2012/128352/", "warc_date": "2014-01-03T03:19:42.000Z", "warc_filename": "<urn:uuid:111902af-34e2-4fd3-ab14-3018733c70c8>", "warc_url": "http://www.hindawi.com/journals/jos/2012/128352/" }	cccc_CC-MAIN-2013-48	About this Journal Submit a Manuscript Table of Contents Journal of Osteoporosis Volume 2012 (2012), Article ID 128352, 4 pages http://dx.doi.org/10.1155/2012/128352 Clinical Study Normocalcemic versus Hypercalcemic Primary Hyperparathyroidism: More Stone than Bone? Division of Endocrinology and Diabetes, Agamenon Magalhães Hospital, Brazilian Ministry of Health (MS/SUS), University of Pernambuco Medical School, 52021-380 Recife, PE, Brazil Received 1 November 2011; Revised 2 January 2012; Accepted 14 January 2012 Academic Editor: Carmelo E. Fiore Copyright © 2012 L. M. Amaral et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Abstract Introduction. Normocalcemic primary hyperparathyroidism (NPHPT) is considered a variant of the more frequent form of the disease characterized by normal serum calcium levels with high PTH. The higher prevalence of renal stones in patients with HPTP and the well established association with bone disorders show the importance of studies on how to manage asymptomatic patients. Objective. To compare the clinical and laboratory data between the normocalcemic and mild hypercalcemic forms of PHPT. Methods. We retrospectively evaluated 70 patients with PHPT, 33 normocalcemic and 37 mild hypercalcemic. Results. The frequency of nephrolithiasis was 18.2% in normocalcemic patients and 18.9% in the hypercalcemic ones (). Fifteen percent of normocalcemic patients had a previous history of fractures compared to 10.8% of hypercalcemic patients, although there was no statistically significant difference (). Conclusion. Our data confirms a high prevalence of urolithiasis in normocalcemic primary hyperparathyroidism, but with the preservation of cortical bone. This finding supports the hypothesis that this disease is not an idle condition and needs treatment. 1. Introduction Primary hyperparathyroidism (PHPT) is a disease characterized by elevated or inappropriately normal parathyroid hormone (PTH) levels due to excessive secretion by one or more parathyroid glands. The classical form of the disease is characterized by hypercalcemia, kidney stones, and severe bone disease [1]. The routine measurement of serum calcium as a screening tool has led to a sharp increase in the incidence of a new presentation of the disease, namely, asymptomatic PHPT, whose demonstration of bone involvement depends exclusively on the bone densitometry data [24]. The association with kidney disease, nephrocalcinosis, and nephrolithiasis is well established in the HPTP and has been reported in several studies. Suh et al. found a prevalence of 7% in 271 individuals with the disorder and 1.6% in 500 healthy patients evaluated by sonography. The risk of hospitalization due to urolithiasis is increased for patients with HPTP even ten years after parathyroidectomy [5, 6]. Currently a new phenotype has arisen, in which normocalcemia is observed, despite persistently high levels of PTH. In this situation, a thorough search for causes of secondary hyperparathyroidism, particularly vitamin D deficiency, is imperative [79]. The demonstration of normocalcemic PHPT is even more difficult as there are no guidelines for routine PTH measurement, as HPTP is most frequently identified during the investigation of reduced bone density [9, 10]. 2. Patients and Methods We retrospectively reviewed the medical records of 70 patients with PHPT from our institution, who were divided into two groups: 33 patients with normal serum calcium levels and 37 with hypercalcemia (serum calcium ≥ 10.2 mg/dL). The following clinical data were obtained: gender, age, weight, height, and BMI. The diagnostic criteria for NPHPT were as follows: apart from normal serum calcium and high PTH levels, serum 25OHD levels above 30 ng/mL, absence of bisphosphonates, thiazide diuretics, anticonvulsants or lithium use, glomerular filtration rate greater than 60 mL/min, using the formula Modification of Diet in Renal Disease (MDRD), and the absence of other metabolic bone diseases or gastrointestinal diseases associated with malabsorption or liver disease. All patients had a urinary Ca/Cr ratio of less than 240 mg/g Cr, demonstrating the absence of hypercalciuria. Serum calcium was determined using the Johnson and Johnson VITROS 950 system (Rochester, NY, USA) with reference value 8.4 to 10.2 mg/dL, serum 25-hydroxyvitamin D using the DiaSorin LIAISON competitive chemiluminescent immunoassay (Stillwater, MN, USA) 10% coefficient of variation, with the following reference values: normal: 30 to 60 ng/mL), serum PTH using the chemiluminescence method, Immulite 2000 (SIEMENS, Llanberis, Gwynedd, UK), with intra- and interassay coefficients of variation of 4.2 to 5.7% and 6.3 to 6.8%, respectively, and serum C-telopeptide when using the electrochemiluminescence assay, Elecsys systems, Roche Diagnostics, Mannheim, Germany, reference value 50–450 pg/mL. Bone mineral density (BMD) and T-score were evaluated at the lumbar spine (L1–L4), femoral neck, and distal radius (Lunar Corporation Madison, Wisconsin, USA). The correction of serum calcium levels in relation to albumin was performed using the following formula: corrected calcium = calcium found + (4-serum albumin) × 0.8. Patients who had clinical manifestations of nephrolithiasis were evaluated by ultrasound, and the results of the examinations were obtained from the medical records. Bone fractures were investigated by radiography. The study was approved by the Ethics in Research Committee of Agamenon Magalhães Hospital. 3. Statistical Analysis Pearson’s chi-square test or Fisher’s exact test and the Student’s -test with equal or unequal variances were used for comparisons. Verification of the hypothesis of equal variances was performed using Levene’s test, and the level of significance used in interpreting the statistical test was 5%. 4. Results Baseline characteristics are shown in Table 1. The prevalence of nephrolithiasis in the normocalcemic group was 18.2% and 18.9% in the hypercalcemic group (). Fifteen percent of normocalcemic patients had a previous history of fractures compared to 10.8% of hypercalcemic patients, although there was no statistically significant difference () Table 2. Table 1: Baseline characteristics of study patients. Table 2: History of fracture and kidney stones in normocalcemic and hypercalcemic PHPT. In both groups, the bone mineral density in the lumbar spine was 0.95 ± 0.24 g/cm² ( score: −1.3), femoral neck 0.76 ± 0.15 g/cm² ( score: −1.75), and distal radius 0.54 ± 0.15 g/cm² ( score: −1.96). LS BMD was normocalcemic 0.95 ± 0.22 g/cm² versus hypercalcemic 0.95 ± 0.26 g/cm², and FN BMD: normocalcemic 0.73 ± 0.15 g/cm² versus hypercalcemic 0.79 ± 0.19 g/cm², . Patients with normocalcemia had BMD values in the distal radius significantly higher than the hypercalcemic patients (), as shown in Table 3. Table 3: Bone mineral density in normocalcemic and hypercalcemic PHPT. 5. Discussion In the present study we found a high prevalence of kidney stones in NPHPT, suggesting that the normocalcemia condition does not mean that the patient is without clinical manifestations. In relation to a history of fractures, we found a similar occurrence in the two groups with 15.2% in the normocalcemic and 10.8% in the hypercalcemic. We also observed that the bone mineral density in the distal radius was more preserved in the normocalcemic group than in the hypercalcemic group, although there were no significant differences in the lumbar spine and femoral neck. Few studies have addressed the issue of NPHPT. Lundgren et al., in a sample of 109 patients, found that 17 (16%) had normal levels of calcium with elevated PTH characterizing NPHPT [11]. In our institution, Marques et al. found a prevalence of NPHPT of 8.9% in a population of 156 postmenopausal women with osteoporosis [8]. These data suggest that it is not a rare condition and therefore needs to be investigated in all patients with reduced bone mineral density. In contrast, in a population-based survey conducted in Sweden, the prevalence of NPHPT, in postmenopausal women was 0.6% [11]. The incidence of kidney stones and fractures has also been documented in small studies. Lowe et al. [9], in a series of 37 normocalcemic patients, found a frequency of nephrolithiasis of 14%, which is comparable with our findings, and a history of fracture of 11% [9]. Marques et al. showed an occurrence of kidney stones of 28.6% in osteoporotic women with NPHPT in contrast to 0.7% in noncarriers. For clinical fractures they found a 21.4% prevalence in NPHPT compared with 16.2% in those not affected [8]. Our study showed a preservation of cortical bone in patients with the normocalcemic form of the disease, and this is in agreement with the findings of Lowe et al., who showed a deterioration, particularly in LS BMD [9]. Patients with NPHPT may present PTH resistance in target tissues. One study showed that after an oral calcium load, normocalcemic subjects had an inadequate suppression of PTH compared with hypercalcemic subjects. The high frequency of kidney stones and fractures in normocalcemic primary hyperparathyroidism could be explained by the possible lower renal and bone sensitivity to the biological effects of PTH, although this hypothesis needs further investigation [12]. Gomes et al. stated that another possibility could be the presence of non-1–84 PTH circulating molecules, such as a 7–84 PTH fragment, blocking the calcemic effect of 1–84 PTH and preventing hypercalcemia [13]. Our data suggests that NPHPT may not be an idle condition as it may progress to complication regardless of the development of hypercalcemia. Controversies regarding the suggestion that NPHPT should be treated, since the disease can lead to a deterioration in bone mineral density, fractures, and kidney stones. Thus, the routine determination of PTH could detect these individuals early on in an attempt to prevent an unfavorable clinical course. There is no consensus about when to treat patients with HPTPN, but if there is progression to clinical complications such as urolithiasis, bone mass loss, or fractures, surgery is indicated [4]. Finally, a new phenotype of NPHPT was recently described in a population-based survey MrOS (Osteoporosis Fractures in Men). Using less rigid criteria for the diagnosis of NPHPT (GFR > 40 mL/min and serum 25OHD < 20 mg/mL), the authors found a 0.7% prevalence of the disease that was associated with a significantly higher LS BMD in comparison with the elderly men without NPHPT [14]. 6. Conclusion Our findings revealed a high prevalence of urolithiasis in normocalcemic primary hyperparathyroidism, but with preservation of the cortical bone, corroborating the belief that the disease is not an indolent condition and needs to be not only investigated but also treated when complications are diagnosed. References 1. S. J. Silverberg and J. P. Bilezikian, “Primary hyperparathyroidism,” Endocrinology, pp. 1075–1093, 2001. 2. S. J. Silverberg, E. Shane, L. De La Cruz et al., “Skeletal disease in primary hyperparathyroidism,” Journal of Bone and Mineral Research, vol. 4, no. 3, pp. 283–291, 1989. View at Scopus 3. S. J. Silverberg, F. G. Locker, and J. P. Bilezikian, “Vertebral osteopenia: a new indication for surgery in primary hyperparathyroidism,” Journal of Clinical Endocrinology and Metabolism, vol. 81, no. 11, pp. 4007–4012, 1996. View at Publisher · View at Google Scholar · View at Scopus 4. S. J. Silverberg, E. M. Lewiecki, L. Mosekilde, M. Peacock, and M. R. Rubin, “Presentation of asymptomatic primary hyperparathyroidism. Proceedings of the 3rd International Workshop,” Journal of Clinical Endocrinology and Metabolism, vol. 94, no. 2, pp. 351–365, 2009. View at Publisher · View at Google Scholar · View at PubMed · View at Scopus 5. L. Rejnmark, P. Vestergaard, and L. Mosekilde, “Nephrolithiasis and renal calcifications in primary hyperparathyroidism,” Journal of Clinical Endocrinology and Metabolism, vol. 96, no. 8, pp. 2377–2385, 2011. View at Publisher · View at Google Scholar · View at PubMed 6. J. M. Suh, J. J. Cronan, and J. M. Monchik, “Primary hyperparathyroidism: is there an increased prevalence of renal stone disease?” American Journal of Roentgenology, vol. 191, no. 3, pp. 908–911, 2008. View at Publisher · View at Google Scholar · View at PubMed · View at Scopus 7. J. P. Bilezikian and S. J. Silverberg, “Normocalcemic primary hyperparathyroidism,” Arquivos Brasileiros de Endocrinologia e Metabologia, vol. 54, no. 2, pp. 106–109, 2010. View at Scopus 8. T. F. Marques, R. Vasconcelos, E. Diniz, D. Rêgo, L. Griz, and F. Bandeira, “Normocalcemic primary hyperparathyroidism in clinical practice: an indolent condition or a silent threat?” Arquivos Brasileiros de Endocrinologia e Metabologia, vol. 55, no. 5, pp. 314–317, 2011. View at Publisher · View at Google Scholar 9. H. Lowe, D. J. McMahon, M. R. Rubin, J. P. Bilezikian, and S. J. Silverberg, “Normocalcemic primary hyperparathyroidism: Further characterization of a new clinical phenotype,” Journal of Clinical Endocrinology and Metabolism, vol. 92, no. 8, pp. 3001–3005, 2007. View at Publisher · View at Google Scholar · View at PubMed · View at Scopus 10. S. J. Silverberg and J. P. Bilezikian, ““Incipient” primary hyperparathyroidism: a “Forme Fruste” of an old disease,” Journal of Clinical Endocrinology and Metabolism, vol. 88, no. 11, pp. 5348–5352, 2003. View at Publisher · View at Google Scholar · View at Scopus 11. E. Lundgren, J. Rastad, E. Thurfjell, G. Åkerström, and S. Ljunghall, “Population-based screening for primary hyperparathyroidism with serum calcium and parathyroid hormone values in menopausal women,” Surgery, vol. 121, no. 3, pp. 287–294, 1997. View at Publisher · View at Google Scholar · View at Scopus 12. G. Maruani, A. Hertig, M. Paillard, and P. Houillier, “Normocalcemic primary hyperparathyroidism: evidence for a generalized target-tissue resistance to parathyroid hormone,” Journal of Clinical Endocrinology and Metabolism, vol. 88, no. 10, pp. 4641–4648, 2003. View at Publisher · View at Google Scholar · View at Scopus 13. S. A. Gomes, A. Lage, M. Lazaretti-Castro, J. G. H. Vieira, and I. P. Heilberg, “Response to an oral calcium load in nephrolithiasis patients with fluctuating parathyroid hormone and ionized calcium levels,” Brazilian Journal of Medical and Biological Research, vol. 37, no. 9, pp. 1379–1388, 2004. View at Scopus 14. N. Cusano, P. Wang, S. Cremers, et al., “Asymptomatic normocalcemic primary hyperparathyroidism: characterization of a new phenotype of normocalcemic primary hyperparathyroidism,” Journal of Bone and Mineral Research, vol. 26, supplement 1, abstract 290, 2011.	v0
2024-06-03T18:26:15.484Z	2013-12-06T05:50:52.000Z	yjcxbshnf6op72tjbuxfxvublavqpgl3	{ "content_type": "text/html", "provenance": "cccc-CC-MAIN-2013-48-0004.json.gz:14762", "uncompressed_offset": 414278914, "url": "www.libreoffice.org/download/?lang=sl&type=deb-x86_64&version=4.1.1", "warc_date": "2014-01-03T03:19:42.000Z", "warc_filename": "<urn:uuid:111902af-34e2-4fd3-ab14-3018733c70c8>", "warc_url": "http://www.libreoffice.org/download/?type=deb-x86_64&version=4.1.1&lang=sl" }	cccc_CC-MAIN-2013-48	The free office suite Download LibreOffice For commercial support around LibreOffice see our list of certified partners. Selected: LibreOffice Linux - deb (x86_64), version 4.1.1, Slovenian This version of LibreOffice is prepared with care and presented with pride by the LibreOffice community. PLEASE NOTE that, since this is the very second version in the series, make sure to read the release notes (under "Handy resources"). No regular installation files are available. Please change your selection or pick one from the additional downloads below. If you're looking for old versions, please visit our download archive. • Source code LibreOffice is an open source project and you can therefore download the source code to build your own installer.	v0
2024-06-03T18:26:15.484Z	2013-12-06T05:38:30.000Z	tsykbvaql6fhypwhgzsezqk3at64ya2p	{ "content_type": "text/html", "provenance": "cccc-CC-MAIN-2013-48-0004.json.gz:14765", "uncompressed_offset": 431643840, "url": "www.mdpi.com/1424-8220/9/6/4323", "warc_date": "2014-01-03T03:19:42.000Z", "warc_filename": "<urn:uuid:111902af-34e2-4fd3-ab14-3018733c70c8>", "warc_url": "http://www.mdpi.com/1424-8220/9/6/4323" }	cccc_CC-MAIN-2013-48	Sensors 2009, 9(6), 4323-4365; doi:10.3390/s90604323 Review Solid State Gas Sensor Research in Germany – a Status Report 1 Functional Materials Laboratory, University of Bayreuth, 95440 Bayreuth, Germany 2 Siemens AG, Corporate Technology, CT PS 6, 81730 München, Germany 3 Kurt-Schwabe Research Institute Meinsberg, 04720 Ziegra-Knobelsdorf, Germany 4 Institute of Physical Chemistry, University of Tübingen, 72076 Tübingen, Germany * Author to whom correspondence should be addressed. Received: 25 March 2009; in revised form: 4 May 2009 / Accepted: 26 May 2009 / Published: 3 June 2009 (This article belongs to the Special Issue State-of-the-Art Sensors Technology in Germany) Download PDF Full-Text [1911 KB, uploaded 3 June 2009 17:51 CEST] Abstract: This status report overviews activities of the German gas sensor research community. It highlights recent progress in the field of potentiometric, amperometric, conductometric, impedimetric, and field effect-based gas sensors. It is shown that besides step-by-step improvements of conventional principles, e.g. by the application of novel materials, novel principles turned out to enable new markets. In the field of mixed potential gas sensors, novel materials allow for selective detection of combustion exhaust components. The same goal can be reached by using zeolites for impedimetric gas sensors. Operando spectroscopy is a powerful tool to learn about the mechanisms in n-type and in p-type conductometric sensors and to design knowledge-based improved sensor devices. Novel deposition methods are applied to gain direct access to the material morphology as well as to obtain dense thick metal oxide films without high temperature steps. Since conductometric and impedimetric sensors have the disadvantage that a current has to pass the gas sensitive film, film morphology, electrode materials, and geometrical issues affect the sensor signal. Therefore, one tries to measure directly the Fermi level position either by measuring the gas-dependent Seebeck coefficient at high temperatures or at room temperature by applying a modified miniaturized Kelvin probe method, where surface adsorption-based work function changes drive the drain-source current of a field effect transistor. Keywords: impedance spectroscopy; mixed potential; SnO2; Ga2O3; Kelvin probe; operando Article Statistics Click here to load and display the download statistics. Cite This Article MDPI and ACS Style Moos, R.; Sahner, K.; Fleischer, M.; Guth, U.; Barsan, N.; Weimar, U. Solid State Gas Sensor Research in Germany – a Status Report. Sensors 2009, 9, 4323-4365. AMA Style Moos R, Sahner K, Fleischer M, Guth U, Barsan N, Weimar U. Solid State Gas Sensor Research in Germany – a Status Report. Sensors. 2009; 9(6):4323-4365. Chicago/Turabian Style Moos, Ralf; Sahner, Kathy; Fleischer, Maximilian; Guth, Ulrich; Barsan, Nicolae; Weimar, Udo. 2009. "Solid State Gas Sensor Research in Germany – a Status Report." Sensors 9, no. 6: 4323-4365. Sensors EISSN 1424-8220 Published by MDPI AG, Basel, Switzerland RSS E-Mail Table of Contents Alert	v0
2024-06-03T18:26:15.484Z	2013-12-06T05:55:08.000Z	jrgnvkqiuaaxgui2n7jbkujzfojfgnp4	{ "content_type": "text/html", "provenance": "cccc-CC-MAIN-2013-48-0004.json.gz:14778", "uncompressed_offset": 471180154, "url": "www.openwetware.org/index.php?diff=654404&oldid=654403&title=BME103%3AW930_Group7", "warc_date": "2014-01-03T03:19:42.000Z", "warc_filename": "<urn:uuid:111902af-34e2-4fd3-ab14-3018733c70c8>", "warc_url": "http://www.openwetware.org/index.php?title=BME103:W930_Group7&diff=654404&oldid=654403" }	cccc_CC-MAIN-2013-48	BME103:W930 Group7 From OpenWetWare (Difference between revisions) Jump to: navigation, search (Research and Development) (Research and Development) Line 219: Line 219: The NCBI database is used to isolate the sequence used and determine specific primers.<br> The NCBI database is used to isolate the sequence used and determine specific primers.<br> - (BONUS points: Use a program like Powerpoint, Word, Illustrator, Microsoft Paint, etc. to illustrate how primers bind to the cancer DNA template, and how Taq polymerases amplify the DNA. Screen-captures from the OpenPCR tutorial might be useful. Be sure to credit the source if you borrow images.) + + + BONUS: [[Image:PCRgraphic.jpg]] [[Image:PCRgraphic.jpg]] + + Source: + + Guruatma, Khalsa. (2010, April 12). Mama Ji's Molecular Kitchen. ASU - Ask A Biologist. Retrieved November 14, 2012 from http://askabiologist.asu.edu/pcr-polymerase-chain-reaction + <br><br> <br><br> Revision as of 03:50, 14 November 2012 BME 103 Fall 2012 Home People Lab Write-Up 1 Lab Write-Up 2 Lab Write-Up 3 Course Logistics For Instructors Photos Wiki Editing Help Contents OUR TEAM Name: Jake Turner PCR Machine Engineer Name: Tyler Allen PCR Machine Engineer, Graphic Designer Name: Khalil Pathan Experimental Protocol Planner Name: Pahul Singh Experimental Protocol Planner Name: Frea Mehta Research and Development Specialist Name: Paul Song Research and Development Specialist <gflash>560 315 http://www.youtube.com/embed/x5yPkxCLads?rel=0</gflash> LAB 1 WRITE-UP Initial Machine Testing The Original Design This is a solidworks rendering of the OpenPCR machine. The OpenPCR is an affordable alternative to costly clinical machines used to amplify particular DNA sequences. This interfaces with any computer with the proper software downloaded and the process of thermal cycling to conduct a variety of tests. This could be anything from paternity tests to test for genetic markings of cancer. Experimenting With the Connections When we unplugged the display (part 3) from the power supply (part 6), the machine did not have power. The blue display screen did not turn on and appeared completely black. When we unplugged the white wire that connects the power supply (part 6) to the heat block (part 2), the machine temperature on the display screen appeared incorrectly. Part 6 is responsible for recording the the internal temperature of the machine throughout the test. Test Run Our first Open PCR test was conducted on Wednesday, October 24, 2012. While running our open PCR test, we experienced nothing but problems. We set the cycles to the appropriate temperatures and time intervals; the Initial cycle on 95°C for 30 seconds, the Denaturing cycle on 95°C for 30 seconds, the Annealing cycle on 55°C for 30 seconds, the Extending cycle on 72°C for 30 seconds, the final cycle on 72°C for 180 seconds, and the final hold at 20°C. Initially, our open PCR appeared to be running correctly for the desired two hour time interval. However, due to a cycling error, our timer extended to nearly three hours. Not only did our test exceed the desired time interval, but our time would not wind down. Our test constantly moved up and down between the times of two hours thirty minutes and two hours and fifty minutes. When our time got close to two thirty, more time would be added to our test. Also, our laptop was experiencing errors. Our laptop received an application error notice multiple times, each time disrupting our process. As a result of these complications, when the two hours elapsed we only reached step seventeen of thirty. We were forced to prematurely end our test. Therefore, we could not receive sufficient results. Improving The OpenPCR One way to improve on the quality and production of the Open PCR machine is to maximize the number of loading wells and shorten the cycle time. The Open PCR machine takes too long to test only 16 samples of DNA. Also, the latch to get to the loading wells served as a hassle. It was tough to open while being careful with the expensive machine at the same time. If you are using the Open PCR as a learning tool, as we have, the machine should be transparent or constructed to be easily disassembled so students can get a better view of the job and responsibility each part completes. However, the machine is constructed with some positive qualities. The machine is affordable, and it is light weight and compact making it easily transportable. The bright glowing screen can easily be read, and the test runs very quietly. While the machine is testing, no extra work needs to be done. It is very easy to start the test and patiently wait for it to end. Protocols Polymerase Chain Reaction 1. Workings of Polymerase Chain Reaction Within a polymerase chain reaction everything is controlled by temperature. The high temperature(95 C) causes melting of DNA templates and primers by disrupting the hydrogen bonds. Next is annealing. The temperature is dropped down to 65 temporarily(20 seconds) to allow a piece of DNA to bind to your product from the initial step. The polymerase binds to the DNA template and DNA synthesis begins. Next is elongation, the DNA polymerase synthesizes a new DNA strand. This process is repeated to replicate numerous strands of DNA. 2. Steps to amplifying DNA 1. Heat denaturation- a. Heat the reactant , which causes melting of the DNA b. A DNA molecule sequence is targeted which is then separated into two strands c. Separation is because of hydrogen bonds breaking 2. Primer annealing a. Then you lower the temperature to 65 which allows a piece of the DNA to bind to the initial step product. b. Each strand of DNA molecule becomes annealed with an oligonucleotide primer complementary to either end of the target sequence. 3. Primers extension a. DNA polymerase is added and complementary strands are synthesized at 65-75 C b. Causes synthesis of a new strand in the direction of 5 to 3 direction 3. The components of the PCR master mix are as follows: - nonrecombinant modified form of Taq DNA polymerase - dNTPs - 3mM MgCl2 - reaction buffers - pH 8.5 - ( allows for a better amplification of the DNA) - 400μM dATP - 400μM dGTP - 400μM dCTP - 400μM dTTP 4. Table representing reagent and volume used Reagent Volume Template DNA (20ng) .2 µL 10 µM forward primer 1.0 µL 10 µM reverse primer 1.0 µL GoTaq master mix 50.0 µL dH20 47.8 µL Total volume 100.0 µL 5. Sample Description: Patient 1 ID: 91562 Patient 2 ID: 25235 (see table above for listed volumes of each reagent) Flourimeter Measurements Steps to set up Fluorimeter: 1. Remove all contents from the black box. 2. After removing the lid, flip the box upside down. 3. One side of the box will detach. Fold this side up and create a cave like opening (as seen above). 4. Place the Fluorometer device within the upside down box. 5. Lastly, place the smartphone in the black stand with the camera facing into the box. Steps to saving images: 1. Obtain a computer and install the ImageJ software. 2. After taking the pictures needed, connect the smartphone to the computer with a USB cable. 3. Once connected, open the folder containing the smartphone (found in My Computer or Devices). 4. Create a folder on the desktop (this will be used to temporarily store the pictures). 5. Copy and paste the pictures form the smartphone folder (DCIM) to the desktop one. 6. Open the ImageJ software and click File and the Open. 7. From this Open menu, select the preferred picture from the folder on the desktop containing the pictures. This will transfer the data into ImageJ Research and Development Specific Cancer Marker Detection - The Underlying Technology PCR produces amplification in the presence of cancer SNP by creating around 100 billion copies of certain sequences found in the DNA. This process can take only a couple hours. During the process, Primers are added to the extracted DNA, where it attaches to the ends of specific DNA segments. Nucleotides are added so that they can create new copies of the DNA. Finally, DNA polymerase is added and works to make new DNA copies by attaching matching nucleotides. With increased temperatures, the double helix of the target sequence separates. Primers attach onto targeted regions on the separated strands and the polymerase attaches free floating nucleotides on the new strands. The process of separating and reattaching of the targeted sequence is repeated and in the end, around a billion of DNA present will be those of the DNA segments that has been targeted and contains the SNP. The gene we are looking at is rs17879961, a gene that indicates susceptibility to breast and colorectal cancer. It is located on chromosome 22 and codes for a cell-cycle regulatory kinase responsible for DNA repair processes in BRCA1, a gene that is responsible for breast cancer. In normal patients, the gene sequence is as follows: GGAAGTGGGTCCTAAAAACTCTTACA[T]TGCATACATAGAAGATCACAGTGGC But in patients susceptible to cancer, the gene sequence undergoes a slight change: GGAAGTGGGTCCTAAAAACTCTTACA[C]TGCATACATAGAAGATCACAGTGGC This is a change from an ATT codon to an ACT, a switch from isoleucine to threonine. The NCBI database is used to isolate the sequence used and determine specific primers. BONUS: Source: Guruatma, Khalsa. (2010, April 12). Mama Ji's Molecular Kitchen. ASU - Ask A Biologist. Retrieved November 14, 2012 from http://askabiologist.asu.edu/pcr-polymerase-chain-reaction Results Sample Integrated Density DNA μg/mL Conclusion PCR: Negative Control 267793 0 Negative PCR: Positive Control 27409968 2 Positive PCR: Patient 1 ID 91562, rep 1 3511064 0.238984 Negative PCR: Patient 1 ID 91562, rep 2 15099598 1.09290 Positive PCR: Patient 1 ID 91562, rep 3 8451848 0.603051 Negative PCR: Patient 2 ID 25235, rep 1 17311845 1.25591 Positive PCR: Patient 2 ID 25235, rep 2 9289657 0.200563 Negative PCR: Patient 2 ID 25235, rep 3 28825322 2.10429 Positive KEY • Sample = Sample denotes the sample of DNA used in a given trial. Each sample represents one extraction of DNA from one of two patients. The multiple trials per patient guarantee accurate results that a single trial could not, for example false positives and false negatives can impact the results and multiple trials will somewhat eliminate the error of one trial. • Integrated Density = • DNA μg/mL = To calculate the concentration of DNA, we created a calibration curve using the given concentrations of DNA for the negative and positive control samples - 0 μg/mL and 2 μg/mL, respectively. This yielded the equation y = (X-267793)/(13571087.5) where y = the concentration of DNA in μg/mL and X = the integrated density for a given sample. • Conclusion = DNA concentrations of over 1 μg/mL yielded positive results; if the concentration was less than 1 μg/mL, the sample yielded negative results Personal tools	v0
2024-06-03T18:26:15.484Z	2013-12-06T05:57:27.000Z	e4mrkohlalv6bwl33bm7qsvakguxludk	{ "content_type": "text/html", "provenance": "cccc-CC-MAIN-2013-48-0004.json.gz:14780", "uncompressed_offset": 471211452, "url": "www.openwetware.org/index.php?diff=692368&oldid=692367&title=User%3ACatherine_Koenigsknecht%2FNotebook%2FExperimental_Biological_Chemistry%2F2013%2F04%2F16", "warc_date": "2014-01-03T03:19:42.000Z", "warc_filename": "<urn:uuid:111902af-34e2-4fd3-ab14-3018733c70c8>", "warc_url": "http://www.openwetware.org/index.php?title=User:Catherine_Koenigsknecht/Notebook/Experimental_Biological_Chemistry/2013/04/16&diff=692368&oldid=692367" }	cccc_CC-MAIN-2013-48	User:Catherine Koenigsknecht/Notebook/Experimental Biological Chemistry/2013/04/16 From OpenWetWare (Difference between revisions) Jump to: navigation, search (Objective) (Description) Line 16: Line 16: ==Description== ==Description== - # + Cuvette Mixture with Inhibitor + [[Image:CuvetteSolnInhibitorHisto.png]] + + Cuvette Mixture no Inhibitor + [[Image:CuvetteMixtureNoInhibitor.png]] + + *Inhibitors Ran today: + #4-Acetoxybenozic Acid [ZINC + #3',4',5,5',7-pentahydroxyflavone + #3,6,2',4',5-pentahydroxyflavone + #Datiscetin ==Data== ==Data== Revision as of 13:44, 17 April 2013 Biomaterials Design Lab Main project page Previous entry Next entry Entry title Objective • Using solutions made last week run [40uM] Adenosine with [50 uM] varying inhibitors • Three Runs of each solution: Average taken and error bars calculated • Produce histogram Description • Cuvette Mixture with Inhibitor • Cuvette Mixture no Inhibitor • Inhibitors Ran today: 1. 4-Acetoxybenozic Acid [ZINC 2. 3',4',5,5',7-pentahydroxyflavone 3. 3,6,2',4',5-pentahydroxyflavone 4. Datiscetin Data • Add data and results here... Notes This area is for any observations or conclusions that you would like to note. Use categories like tags. Change the "Course" category to the one corresponding to your course. The "Miscellaneous" tag can be used for particular experiments, as instructed by your professor. Please be sure to change or delete this tag as required so that the categories remain well organized. Personal tools	v0
2024-06-03T18:26:15.484Z	2013-12-06T05:57:02.000Z	wj2ml6dgzguvwgrdzrfkiatxlsdqyaie	{ "content_type": "text/html", "provenance": "cccc-CC-MAIN-2013-48-0004.json.gz:14793", "uncompressed_offset": 612084293, "url": "www.werelate.org/wiki/Place:Snoqualmie%2C_King%2C_Washington%2C_United_States", "warc_date": "2014-01-03T03:19:42.000Z", "warc_filename": "<urn:uuid:111902af-34e2-4fd3-ab14-3018733c70c8>", "warc_url": "http://www.werelate.org/wiki/Place:Snoqualmie%2C_King%2C_Washington%2C_United_States" }	cccc_CC-MAIN-2013-48	Place:Snoqualmie, King, Washington, United States Watchers NameSnoqualmie Alt namesSnoqualmesource: USGS, GNIS Digital Gazetteer (1994) GNIS53018798 TypeCity Coordinates47.533°N 121.844°W Located inKing, Washington, United States source: Getty Thesaurus of Geographic Names the text in this section is copied from an article in Wikipedia Snoqualmie is a city next to Snoqualmie Falls in King County, Washington. The city is home to the Northwest Railway Museum. The population was of 10,670 at the 2010 census. Movie actress Ella Raines was born in Snoqualmie Falls, a mill town across the Snoqualmie River that is now part of Snoqualmie, on August 6, 1920. Many of the exterior shots for David Lynch's Twin Peaks television series and movie were filmed in Snoqualmie and in the neighboring towns of North Bend and Fall City. History the text in this section is copied from an article in Wikipedia The second written record of the exploration of the Snoqualmie Valley comes from the notes of Samuel Hancock, who ventured up-river with the Snoqualmie tribe in 1851 in search of coal. Near the current location of Meadowbrook Bridge, Hancock was told by his guides that the land was known as "Hyas Kloshe Illahee", or "good/productive land". Hancock took this useful information back with him to the area now known as Tacoma. During the 1850s, tensions were very high between the native populations and the new settlers claiming the land as their own. In 1856, in response to these tensions, Fort Alden was built in the area that would become Snoqualmie. No alliances were made between the tribes in the east and the tribes in the west, and Fort Alden was abandoned (along with other forts built around this time). The most successful early pioneer in the Valley was Jeremiah Borst, who arrived in the spring of 1858 on his way over the Cedar River trail from the eastern side of the mountains. He settled in the area that formerly held Fort Alden, and used his sales of pigs and apples in Seattle to buy out many of the surrounding land from other settlers. As successful as farming was, other settlers had different methods of working the land. The very first mill in Snoqualmie was established at the mouth of Tokul Creek around 1872 by Watson Allen. Within 5 years, there were 12 logging operations on the Snoqualmie River, providing lumber to the entire Seattle region. Within 15 years, logging and mill work was employing 140 men and sending millions of board feet of logs down the river. In 1882, the Hop Growers Association was founded by three Puget Sound partners, who used land purchased from Jeremiah Borst to create a farm that would eventually cover , of which was devoted solely to hops. This extremely successful venture (billed as "The Largest Hop Ranch in the World") would fall prey to a combination of market and pest factors, and fell into relative obscurity by the end of the 1890s. By the late 19th century, the Puget Sound region was growing, but bypassed by the major railways. In response, a group of Seattle entrepreneurs funded and built their own railway in an attempt to cross the Cascade mountains. The Seattle, Lake Shore & Eastern opened up the vast natural resources Snoqualmie valley to the markets of the world, and brought in tourists from around the world to enjoy the natural beauty of the area, and to marvel at the Falls. Of course, a by-product of this sudden massive increase in interest in the area was a marked increase in speculation. Originally, the area that would become North Bend was platted as "Snoqualmie" in February 1889 by Will Taylor. The area that is currently Snoqualmie was platted in August of that same year as "Snoqualmie Falls" by investors from Seattle. The oral history of the area places the first residents of Snoqualmie as Edmund and Louisa Kinsey, who established the first hotel, livery, general store, dance hall, post office, and meat market – in addition to helping build the very first church in the town. Two of their sons (out of six children) are most famous for their photography documenting the early timber works in the region. The first power plant at the Falls was built in the late 1890s by Charles Baker, one of the investors from Seattle who had assisted in the platting of the city. This development provided both power and jobs to the region, and a small company town grew up near the Falls to house the workers. More than 100 years later, Baker's original generators are still in use by Puget Sound Energy. The official vote for incorporation of "Snoqualmie Falls" as the City of Snoqualmie occurred in 1903. At the time, land prices had not decreased since initially set in 1889 — prices that did not reflect the financial reality of the region. In response to these high prices, people had created a large "squatting" community, building where they wanted regardless of land ownership or interests. The first challenge that the city council faced was lowering lot prices and migrating these buildings off of the public right-of way, establishing the basic layout of the town that exists to this day. In 1917, a new all-electric lumber mill (only the second ever in the U.S.) opened across the river from Snoqualmie, along with the company town associated with it, Snoqualmie Falls. For the first half of the century, the timber industry provided the city and Valley with a stable source of income and employment, even as World War I drew away workers and the Great Depression took its toll across the nation. This prosperity was moderated during the Depression, and with the changes in culture and mobility that took effect in the latter half of the century, Snoqualmie and the majority of the Valley fell into somewhat of a stagnant existence. The city was bypassed when US-10 was built across the Cascades (now Interstate-90), and this led to a shift in commerce to the east (into North Bend) and west (into the Bellevue/Issaquah areas). By the 1960s, the homes that had made up the company town of Snoqualmie Falls had been moved to other locations within the Valley, and the city's population had stabilized to a growth rate of roughly 11 people per year over the next 30 years (from 1,216 in 1960 to 1,546 in 1990). This slow growth cycle continued until the mid-1990s, when the City annexed of undeveloped land that became the site of the current "master-planned" community of Snoqualmie Ridge. The plan for this new community includes homes for more than 8,000 new residents, two retail centers, a business park, and the TPC Snoqualmie Ridge, a private, PGA Tour-sanctioned golf course. The resulting influx of new residents and businesses is an ongoing challenge for the city council, as they attempt to balance the desire to retain the rural and historical feel of "historic" Snoqualmie with the needs of a significantly larger population than has existed in the Valley in the past. The city's historic downtown is undergoing a major renovation to improve its infrastructure and make the area more attractive to visitors to the valley's many natural attractions. Research Tips This page uses content from the English Wikipedia. The original content was at Snoqualmie, Washington. The list of authors can be seen in the page history. As with WeRelate, the content of Wikipedia is available under the Creative Commons Attribution/Share-Alike License.	v0
2024-06-03T18:26:15.484Z	2013-12-06T05:52:28.000Z	3gsv4mdxhv2z63vjzx5jyjltdecmbrqh	{ "content_type": "text/html", "provenance": "cccc-CC-MAIN-2013-48-0004.json.gz:14833", "uncompressed_offset": 43168151, "url": "dallas.sbnation.com/texas-rangers/2012/9/3/3289541/rangers-vs-royals-stream-yu-darvish", "warc_date": "2014-01-03T03:20:01.000Z", "warc_filename": "<urn:uuid:20b28982-4b3d-4d75-9abe-b0f6c41e392a>", "warc_url": "http://dallas.sbnation.com/texas-rangers/2012/9/3/3289541/rangers-vs-royals-stream-yu-darvish" }	cccc_CC-MAIN-2013-48	Rangers Vs. Royals: Young Drives In Winning Run Texas won a dramatic extra-inning game over Kansas City on Thursday night, when Michael Young drove in Ian Kinsler in the top of the 10th for a 5-4 win. • Live 12 Total Updates since September 3, 2012 • Important 2 • Updates 11 • Articles 1 • All Updates 12 Rangers Vs. Royals Final Score: Texas Wins At Kansas City, 7-5 The Rangers defeated the Royals on Wednesday night, 7-5, bouncing back from a 6-3 loss the night before. Texas jumped on the scoreboard right away with three runs in the first inning thanks to a three-run blast by Adrian Beltre. Kansas City came back with an RBI double by Billy Butler, which scored Alcides Escobar. Salvador Perez cut the Rangers' lead to 3-2 with an RBI double of his own in the sixth inning, scoring Butler. Michael Young hit a solo home run for Texas, which started up a three-run seventh inning. Nelson Cruz brought in Beltre on an RBI single to right center field. Escobar brought in Jarrod Dyson in the ninth inning to threaten the Rangers' lead, but there wasn't enough to complete the rally. Ryan Dempster gave up two earned runs and struck out eight in his six innings of work. Check out Lone Star Ball and SB Nation Dallas for more on the Texas Rangers. For the Kansas City perspective, head to Royals Review and SB Nation Kansas City. Visit Baseball Nation for news and analysis around Major League Baseball. Continue MLB Standings: Rangers Remain AL's Finest Despite Loss To Royals The Texas Rangers (80-55) still own the best record in the American League and the third-best record in all of baseball despite Tuesday's night loss to the mediocre Kansas City Royals. The Rangers currently have a four-game lead on the second place Oakland Athletics (76-59) in the AL West with the A's dropping their two most recent games to the Los Angeles Angels (73-63). Furthermore, Texas also has a four-game lead on the AL's second-best teams, the Baltimore Orioles and the New York Yankees, who both own the same record as the A's. The Rangers have two more in Kansas City before heading to the Tampa Bay Friday to take on the Rays (75-61), who currently sit 1.5 games back in the wild card race. The A's have one more game with the Angels then head up to Seattle to take on the Mariners in a weekend series. For more information on Rangers baseball, head on over to Lone Star Ball. Continue X Log In Sign Up use Yahoo! or OpenID forgot? Forgot password? We'll email you a reset link. If you signed up using a 3rd party account like Facebook or Twitter, please login with it instead. Forgot password? Try another email? Almost done, Join SB Nation Dallas You must be a member of SB Nation Dallas to participate. We have our own Community Guidelines at SB Nation Dallas. You should read them. Join SB Nation Dallas You must be a member of SB Nation Dallas to participate. We have our own Community Guidelines at SB Nation Dallas. You should read them. Authenticating Great! Choose an available username to complete sign up. In order to provide our users with a better overall experience, we ask for more information from Facebook when using it to login so that we can learn more about our audience and provide you with the best possible experience. We do not store specific user data and the sharing of it is not required to login with Facebook.	v0
2024-06-03T18:26:15.484Z	2013-12-06T05:41:06.000Z	a5ua7ysty422oyqrap4lia4joxupy4u3	{ "content_type": "text/html", "provenance": "cccc-CC-MAIN-2013-48-0004.json.gz:14834", "uncompressed_offset": 44152398, "url": "daviswiki.org/Buying_a_Bike", "warc_date": "2014-01-03T03:20:01.000Z", "warc_filename": "<urn:uuid:20b28982-4b3d-4d75-9abe-b0f6c41e392a>", "warc_url": "http://daviswiki.org/Buying_a_Bike" }	cccc_CC-MAIN-2013-48	Buying a Bike Info Search: 1. New Bikes 2. Used Bikes 1. Places to find used bikes Tons of people ride bikes in this town. Not one of these people and want to join them? Pull up a chair and get ready to learn what you should look at when buying a bike Determine your needs. Are you planning on traveling to France to ride in their little race, or are you just tooling around town? New Bikes If you like that new seat smell, there are several stores in town that sell bikes. Shop around a bit, several of the stores will allow test rides, and all of them can offer helpful advice.!Bikes for sale, 3rd st., by JASH Used Bikes Buying a used bike offers several advantages. If you know nothing about bikes and are afraid of buying the wrong thing, bring a friend who does. They'll often be happy to help you find a bike. Places to find used bikes The Bike Auction is another way to obtain a bike. You may want to head over to the The Bike People Davis Bike Collective after you buy an auction bike, or if you just want to put one together for yourself. Pretty much all of the bicycle shops in town will do repairs for you. APEX Cycles & Service and the Davis Bike Exchange sell used bikes already cleaned up. If you want to browse the internet, there's always Craigslist, which has a forum for bikes for sale. See also Bike People and Green Bicycle Depot. Bike Forth usually has the parts necessary to rebuild an old bike. Also check out the "Bicycle Shop Alternatives" on the Bicycle Shops entry as well as the Renting a Bike entry. This is a Wiki Spot wiki. Wiki Spot is a 501(c)3 non-profit organization that helps communities collaborate via wikis.	v0
2024-06-03T18:26:15.484Z	2013-12-06T05:51:53.000Z	ye5uqavjyhhfx6quhxvgjfpkldt7hfb4	{ "content_type": "text/html", "provenance": "cccc-CC-MAIN-2013-48-0004.json.gz:14838", "uncompressed_offset": 56223215, "url": "dungeons.wikia.com/wiki/SRD:Divine_Druid_%28Divine_Ability%29?direction=prev&oldid=6119", "warc_date": "2014-01-03T03:20:01.000Z", "warc_filename": "<urn:uuid:20b28982-4b3d-4d75-9abe-b0f6c41e392a>", "warc_url": "http://dungeons.wikia.com/wiki/SRD:Divine_Druid_(Divine_Ability)?direction=prev&oldid=6119" }	cccc_CC-MAIN-2013-48	Wikia SRD:Divine Druid (Divine Ability) Talk0 9,519pages on this wiki Revision as of 19:40, January 17, 2008 by Dmilewski (Talk) (diff) ← Older revision \| Latest revision (diff) \| Newer revision → (diff) This material is published under the OGL Divine Druid Prerequisites: Druid level 20th. Benefit: While in a wild shape, the deity gains all the extraordinary and supernatural abilities of the creature whose form it adopts. In addition to animal forms, the deity can take the form of magical beasts or plant creatures. Some deities can assume additional forms. These are specified in the deity’s description. The deity can assume the form of any animal, magical beast, or plant creature from Fine to Colossal in size. Suggested Portfolio Elements: Nature. Back to Main PageSystem Reference DocumentDivine Abilities Advertisement \| Your ad here Around Wikia's network Random Wiki	v0
2024-06-03T18:26:15.484Z	2013-12-06T05:44:26.000Z	gavyccwjzu3skp5he2gppjkrt3kyqljh	{ "content_type": "text/html", "provenance": "cccc-CC-MAIN-2013-48-0004.json.gz:14842", "uncompressed_offset": 64502160, "url": "familysearch.org/learn/wiki/en/England,_Lancashire,_Church_of_England,_Church_Records_%28FamilySearch_Historical_Records%29", "warc_date": "2014-01-03T03:20:01.000Z", "warc_filename": "<urn:uuid:20b28982-4b3d-4d75-9abe-b0f6c41e392a>", "warc_url": "http://familysearch.org/learn/wiki/en/England,_Lancashire,_Church_of_England,_Church_Records_(FamilySearch_Historical_Records)" }	cccc_CC-MAIN-2013-48	England, Lancashire, Church of England, Church Records (FamilySearch Historical Records)Edit This Page From FamilySearch Wiki This article describes a collection of historical records scheduled to become available at FamilySearch.org. Contents Collection Time Period This collection covers records for the years 1530 through 1900. Record Description Baptisms (christenings), marriages, and burials were recorded on blank pages in a bound book called a register. The events of baptism, marriage, and burial were all recorded in one volume until 1754, when a law required that marriages be recorded in a separate book. Banns, or proclamations of “an intent” to marry, were recorded in yet another book. Starting in 1812, preprinted registers were introduced, and then separate registers were kept for baptisms, marriages, and burials. Before 1812, bishops’ transcripts were usually recorded on loose pieces of paper. Following that year, the transcripts were recorded on the same preprinted forms as parish registers. In 1537 the Church of England mandated that parishes begin keeping church registers by the next year (1538). These church registers continue to the present. Bishops’ transcripts, or copies of parish registers, were required beginning in 1598 and continued to the mid-1800s. The vast majority of the English population belonged to the Church of England. Only since the mid-19th century have other religious groups made headway. Record Content Church of England parish register baptism records usually contain: • Baptism date • Name of the child • Sex of the child • Legitimacy of the child • Marital status of the parents • Social class of the parents • Name of the father and often mother’s given name • May list the residence of the parents, especially after 1812 Church of England parish register marriage records usually contain: • Marriage date • Name of the bride and groom • Age of the bride and groom • May list names of parents or other relatives • Residence of the bride and groom • Marital status of individuals and couples • May list the dates that the marriage was announced (also called “banns published”). This normally took place on three separate occasions prior to the marriage and gave anyone with a valid reason a chance to object to the marriage. • After 1754 the full names of witnesses are also given. After 1837 the full names of the fathers are given. • May note if a spouse is single or widowed at the time of the marriage. Church of England parish register burial records usually contain: • Burial date • Name of the deceased. If the deceased is a child, the father’s name might be given. If the deceased is a married woman, the husband’s name might be given. • Age of the person • Residence of the deceased • May give the sex of the deceased • Residence of the deceased How to Use the Record Parish registers are one of the best sources for identifying individuals and connecting them to parents, spouses, and other generations. In July 1837 the government instituted the civil registration of births, marriages, and deaths. However, parish registers continue to play an important role because they are often more readily available than civil registers. Bishops’ transcripts are a backup source for parish registers that are missing or illegible. If possible, you may want to search both the parish registers and the bishops’ transcripts since one is a handwritten copy of the other and might contain differences. Baptism or christening records list the parents’ names, making it possible for you to connect your ancestor to an earlier generation. You may find a birth date listed or be able to approximate a birth date. After 1812 the baptismal records list a place of residence, making it easier to identify your family by where they lived. The records also list the father’s occupation, which makes it easier to identify your ancestor's family when more than one family with the same name lived in the parish. Marriage records sometimes state the residence for the bride and groom. You can use this information to look for their baptisms and to identify the children of this couple. Sometimes the groom’s occupation is listed, which could help you find more records about the groom. Marriage records after 1754 list the names of witnesses, who were often family members. These can help you identify your ancestor’s family. Signatures in the records might be used to identify a particular individual by the handwriting style. After 1812 and sometimes before, burial records include the age of the deceased. Use this age to approximate the person’s birth year and to find the baptismal record. If the deceased is a child, the parents’ names might be given. This information helps to extend your family another generation. The occupation of a deceased male might be given (especially after 1812) and can help identify your ancestor when there is more than one person by that name in the area. Knowing the occupation might also provide you the opportunity to find other records about your ancestor. Banns indicate the parish of residence of the bride and groom. This information often leads to the records of another parish. You can search for the baptisms of the bride and groom in the parishes of residence since these might also be the parishes where they were born. To search for a person in a Church of England parish register, you must know the following: • Where the person lived and the corresponding parish • When the person lived; if you do not know the time period, you must estimate it from what you know of more recent generations. A useful means of locating parishes prior to 1851 is England Jurisdictions 1851 Record History In 1530, King Henry VIII established the Church in England, also known as the Anglican Church, the State Church, or the Episcopal Church. A law passed in 1537 required ministers to record the baptisms, marriages, and burials that took place in their parishes. Priests recorded these events in registers and kept them at the parish level, which is the lowest level of authority in the Church of England. Within some parishes, chapelries were created to provide for the worship needs of the parishioner when the parish church was not easily accessible. Chapelries sometimes had the authority to perform baptisms, marriages, and burials, so they kept their own registers. Several parishes formed a deanery (presided over by a dean), several deaneries formed an archdeaconry (presided over by an archdeacon), and several archdeaconries formed a diocese (presided over by a bishop). Beginning in 1598, ministers were required to send copies of their registers to an archdeacon or bishop annually. These copies are referred to as bishops’ transcripts, or sometimes archdeacon transcripts. As a result, two copies of many parish registers exist from 1598 to about the mid-1800s. After civil registration began in 1837, the value of keeping bishops’ transcripts diminished, so by 1870 most parishes had stopped making them. Banns are proclamations of an intent to marry. After 1754 these banns were required to be read for three consecutive Sundays before a marriage so that anyone with reasons against the marriage could oppose it. Banns were read in both the bride’s parish and the groom’s parish. Most bishops’ transcripts of Church of England parish registers have been preserved. Many have also been copied to microfilm or microfiche. The condition of the records is relatively good considering their age and their storage conditions over the centuries. In 1598 ministers were required to copy their registers onto parchment. If the minister failed to make such a copy, the register for that parish and its records did not survive. During the Commonwealth period, 1649–1660, many parish registers disappeared, and many transcripts were not kept because ministers were deposed from their parishes. Why this Record Was Created Parish registers were created to record church events of baptism or christening, marriage, and burial. Baptismal entries usually list the person’s birth date, and burial entries list the death date. In the Church of England, baptism, which was also called christening, was performed soon after the birth of a child. Marriage in the church legally united a man and a woman for civil legal reasons and for the purpose of founding a religiously sanctified family. Burial is a function of the church to inter the deceased soon after death. Record Reliability Church of England parish registers are the most reliable and accurate family history source until July 1837, when the government instituted the civil registration of births, marriages, and deaths. Information in parish registers and Bishop's Transcripts can be verified against each other. There are often variations in Bishop's Transcripts of names and spellings. Bishop's Transcripts may also omit years or part of years and are incomplete according to Diocesan practice and preservation. Transcription is a human process and can include error. If you are searching a computer data base which has been indexed exactly as viewed it may be necessary to search on variants of the given name and surname. The transcriber may have faithfully rendered Thos. or a Latin spelling like Xpher and your search for Thomas or Christopher may not produce a search result. Parish register entries may not correspond with post 1837 Civil Registration certificates. The registration of Marriages involves a quarterly return from each authorised person (Registrar General approved) to the local Registry Office and each Registry Office in turn to form a National Index. The transcription of information from the event may not correspond to the original entry. Since Civil Birth registrations are only partial in the early decades of Civil registration parish registers may be the only source of record for infant birth and death in a period of high infant mortality rates. Related Websites Lancashire Record Office, Preston Related Wiki Articles England Church Records Quick Research Links - England Contributions to This Article We welcome user additions to FamilySearch Historical Records wiki articles. Guidelines are available to help you make changes. Thank you for any contributions you may provide. If you would like to get more involved join the WikiProject FamilySearch Records. Sources of Information for This Collection “England, Lancashire, Church of England, Church Records,” database, FamilySearch (http://familysearch.org/); from the Lancashire Record Office, Preston. FHL microfilm 56 reels, Family History Library Salt Lake City, Utah. Citing FamilySearch Historical Collections When you copy information from a record, you should also list where you found the information. This will help you or others to find the record again. It is also good to keep track of records where you did not find information, including the names of the people you looked for in the records. A suggested format for citing FamilySearch Historical Collections, including how to cite individual archives is found in the following link: How to Cite FamilySearch Collections Examples of Source Citations for a Record in This Collection • United States. Bureau of the Census. 12th census, 1900, digital images, From FamilySearch Internet (www.familysearch.org: September 29, 2006), Arizona Territory, Maricopa, Township 1, East Gila, Salt River Base and Meridian; sheet 9B, line 71 • Mexico, Distrito Federal, Catholic Church Records, 1886-1933, digital images, from FamilySearch Internet (www.familysearch.org: April 22, 2010), Baptism of Adolfo Fernandez Jimenez, 1 Feb. 1910, San Pedro Apóstol, Cuahimalpa, Distrito Federal, Mexico, film number 0227023 Need additional research help? Contact our research help specialists. Need wiki, indexing, or website help? Contact our product teams. Did you find this article helpful? You're invited to explain your rating on the discussion page (you must be signed in). • This page was last modified on 5 May 2012, at 12:37. • This page has been accessed 998 times.	v0
2024-06-03T18:26:15.484Z	2013-12-06T05:55:19.000Z	zddmjlbamw2kz7mloqwayo76jufmw5lb	{ "content_type": "text/html", "provenance": "cccc-CC-MAIN-2013-48-0004.json.gz:14843", "uncompressed_offset": 64519577, "url": "familysearch.org/learn/wiki/en/Kilrush_Civil_Parish,_County_Wexford", "warc_date": "2014-01-03T03:20:01.000Z", "warc_filename": "<urn:uuid:20b28982-4b3d-4d75-9abe-b0f6c41e392a>", "warc_url": "http://familysearch.org/learn/wiki/en/Kilrush_Civil_Parish,_County_Wexford" }	cccc_CC-MAIN-2013-48	Kilrush Civil Parish, County WexfordEdit This Page From FamilySearch Wiki Ireland Counties of Ireland County Wexford County Wexford Parishes Kilrush Civil Parish, County Wexford The following information is a starting point for records about the civil parish of Kilrush. The information is based on locations and records before 1922. Contents Historical Overview History Add a brief statement about historical background, including a Web site link if available. Localities List the names of townlands in this civil parish List the names of the surrounding parishes List the names and give a description of a district, poor law union, etc. Maps and gazetteers Add a Web site link for a map or gazetteer site, and/or add a printed source. Read more about maps and gazetteers. Records Cemeteries Add references to indexes to gravestones or monumental inscriptions. Census The purpose of a census was to gather information about people who lived in an area. While the government began census taking in 1821, only fragments exist before 1901. Censuses for 1901 and 1911 are available. Read more about the records in the Ireland Census article. Add information here about census substitutes that you know about. Church records Read general information about church records. Catholic Name(s) of ecclesiastical parish, records, availability, archive, online indexes, notes. Church of Ireland Name(s) of ecclesiastical parish, records, availability, archive, online indexes, notes. Presbyterian Name(s) of ecclesiastical parish, records, availability, archive, online indexes, notes. Methodist Name(s) of ecclesiastical parish, records, availability, archive, online indexes, notes. Society of Friends Name(s) of ecclesiastical parish, records, availability, archive, online indexes, notes. Others Name(s) of ecclesiastical parish, records, availability, archive, online indexes, notes. Civil Registration Government registration of births and deaths began in 1864. Registration of Protestant marriages began in 1845, with all marriages being registered by 1864. Go to the Ireland Civil Registration article to read more about these records. Land records The Registry of Deeds started in 1708. Land transactions were recorded, including immovable property passed on in a will and property given to a daughter at her marriage. Read more about these records in the Ireland Land and Property article. Probate records Probate dealt with the property of a deceased person. Read more about these records in the Ireland Probate Records article. Add information about probate records for this parish. School records Read more about these records in the Ireland Schools article. Add records for this parish. Tax records The valuation of property for tax purposes was started in the 1840s by Richard Griffith. A tax paid to the church, call Tithe Applotments, began in the 1820s. Read about these records in the Ireland Taxation and Ireland Land and Property articles. Add records for this parish that you know about. Web Sites Add a site for this civil parish. Further Reading Add sources here. Need additional research help? Contact our research help specialists. Need wiki, indexing, or website help? Contact our product teams. Did you find this article helpful? You're invited to explain your rating on the discussion page (you must be signed in). • This page was last modified on 4 December 2013, at 15:57. • This page has been accessed 315 times.	v0
2024-06-03T18:26:15.484Z	2013-12-06T05:50:13.000Z	ovvmzew5cvxhowyx3nhc4rtl6e4moqht	{ "content_type": "text/html", "provenance": "cccc-CC-MAIN-2013-48-0004.json.gz:14868", "uncompressed_offset": 99479623, "url": "joi.ito.com/weblog/2003/09/10/pictures-from-m-1.html", "warc_date": "2014-01-03T03:20:01.000Z", "warc_filename": "<urn:uuid:20b28982-4b3d-4d75-9abe-b0f6c41e392a>", "warc_url": "http://joi.ito.com/weblog/2003/09/10/pictures-from-m-1.html" }	cccc_CC-MAIN-2013-48	Just posted some pictures from my trip to Menorca. It was a "retreat" after the GLT summit for the lucky few of us who decided to accept Martin's gracious offer to join him at his farm on Menorca. Thanks again for your hospitality Martin and thanks to everyone else for the stimulating conversation. 1 TrackBacks Listed below are links to blogs that reference this entry: Pictures from Menorca. TrackBack URL for this entry: http://joi.ito.com/MT-4.35-en/mt-tb.cgi/979 About this Archive This page is an archive of recent entries in the Business and the Economy category. Books is the previous category. Computer and Network Risks is the next category. Find recent content on the main index. Monthly Archives	v0

Subsets and Splits

No community queries yet

The top public SQL queries from the community will appear here once available.