added
stringdate 2002-09-30 06:55:26
2023-01-01 16:16:21
| created
stringdate 1-01-01 00:00:00
2023-03-01 00:00:00
| id
stringlengths 4
9
| source
stringclasses 2
values | text
stringlengths 324
264k
| version
stringclasses 1
value |
|---|---|---|---|---|---|
2022-12-03T06:17:09.894Z
|
2022-11-25T00:00:00.000Z
|
254150358
|
s2ag/train
|
[Clinical application of laparoscopic sentinel lymph node mapping in early staged cervical cancer].
Objective: To investigate the application of sentinel lymph node biopsy (SLNB) in early-staged cervical cancer by laparoscopy. Methods: It was a prospective, single-arm, single-center clinical study. Seventy-eight cases of cervical cancer patients were collected from July 2015 to December 2018 at the Fourth Hospital of Hebei Medical University. All the patients were injected with tracer into the disease-free block of cervical tissue after anesthesia by the same surgeon who learned sentinel lymph node (SLN) mapping technique in Memorial Sloan-Kettering Cancer Center, and underwent SLN mapping followed by complete pelvic lymphadenectomy. Moreover, all the dissected lymph nodes were stained with hematoxylin eosin staining (HE) pathological examination. Besides, the negative SLN on hematoxylin-eosin staining were detected by immunohistochemistry cytokeratin staining micro-metastasis. To analyze the distribution, detection rate, false negative rate the sensitivity and negative predictive value of the SLN in early-staged cervical cancer by laparoscopy, and explore the value of SLN mapping in predicting the lymph nodes metastasis in early-staged cervical cancer. Results: The overall detection rate of SLN in cervical cancer was 99% (77/78), bilateral detection rate was 87% (68/78). The average of 12.4 lymph node (LN) and 3.6 SLN were dissected for each patients each side. SLN of cervical cancer were mainly distributed in the obturator space (61.5%, 343/558), followed by external iliac (23.5%, 131/558), common iliac (7.3%, 41/558), para-uterine (3.8%, 21/558), internal iliac (2.2%, 12/558), para abdominal aorta (1.1%, 6/558), and anterior sacral lymphatic drainage area (0.7%, 4/558). Fourteen cases of LN metastasis were found among all 78 cases. There were a total of 38 positive LN, including 26 SLN metastasis and 12 none sentinel LN metastasis. Through immunohistochemical staining and pathological ultra-staging, 1 SLN was found to be isolated tumor cells (ITC), and 5 SLNs were found to be micro-metastases (MIC), accounting for 23% (6/26) of positive SLN. SLN mapping with pathological ultra-staging improved the prediction of LN metastasis in cervical cancer (2/14). Metastatic SLN mainly distributed in the obturator space (65%, 17/26), peri-uterine region (12%, 3/26), common iliac region (15%, 4/26), and external iliac region (8%, 2/26). The consistency of the diagnosis of lymph node metastasis by SLN biopsy and postoperative retroperitoneal lymph node metastasis showed that the Kappa value was 1.000 (P<0.001), indicated that the metastasis status of SLN and retroperitoneal lymph node were completely consistent. The sensitivity, specificity, accuracy, false-negative rate, and negative predictive value of SLN biopsy in the diagnosis of lymph node metastasis were 100%, 100%, 100%, 0, and 100%, respectively. Conclusions: SLN in early-staged cervical cancer patients were mainly distributed in the obturator and external iliac space, pathalogical ultra-staging of SLN could improve the prediction of LN metastasis. Intraoperative SLN mapping is safe, feasible and could predict the state of retroperitoneal LN metastasis in early-staged cervical cancer. SLNB may replace systemic pelvic lymphadenectomy.
|
v2
|
2022-12-04T19:07:09.359Z
|
2022-11-25T00:00:00.000Z
|
254203246
|
s2ag/train
|
The Power Zeghdoudi Distribution: Properties, Estimation, and Applications to Real Right-Censored Data
A new two-parameter power Zeghdoudi distribution (PZD) is suggested as a modification of the Zeghdoudi distribution using the power transformation method. As a result, the PZD may have increasing, decreasing, and unimodal probability density function and decreasing mean residual life function. In addition, other properties are presented, such as moments, order statistics, reliability measures, Bonferroni and Lorenz curves, Gini index, stochastic ordering, mean and median deviations, and quantile function. Following this, a section is devoted to the related model parameters which are estimated using the maximum likelihood estimation method, the weighted least squares and least squares methods, the maximum product of spacing method, the Cramer–von Mises method, and the right-tail and left-tail Anderson–Darling methods, and the Nikulin–Rao–Robson test statistic is considered. A simulation study is conducted to assess these methods and to investigate the distribution properties with right-censored data. The applicability of the proposed model is studied based on three real data sets of failure times, bladder cancer patients, and glass fiber data with a comparison with such competitors as the gamma, xgamma, Lomax, Darna, power Darna, power Lindley, and exponentiated power Lindley models. According to several established criteria, the comparative findings are overwhelmingly favorable to the suggested model.
|
v2
|
2022-12-07T17:36:34.592Z
|
2022-11-25T00:00:00.000Z
|
254304709
|
s2orc/train
|
Acute kidney injury due to bilateral malignant ureteral obstruction: Is there an optimal mode of drainage?
There is a well-known relationship between malignancy and impairment of kidney functions, either in the form of acute kidney injury or chronic kidney disease. In the former, however, bilateral malignant ureteral obstruction is a surgically correctable factor of this complex pathology. It warrants urgent drainage of the kidneys in emergency settings. However, there are multiple controversies and debates about the optimal mode of drainage of the bilaterally obstructed kidneys in these patients. This review addressed most of the concerns and provided a comprehensive presentation of this topic from the recent literature. Also, we provided different perspectives on the management of the bilateral obstructed kidneys due to malignancy. Despite the frequent trials for improving the success rates and functions of ureteral stents, placement of a percutaneous nephrostomy tube remains the most recommended tool of drainage due to bilateral ureteral obstruction, especially in patients with advanced malignancy. However, the disturbance of the quality of life of those patients remains a major unresolved concern. Beside the unfavorable prognostic potential of the underlying malignancy and the various risk stratification models that have been proposed, the response of the kidney to initial drainage can be anticipated and evaluated by multiple renal prognostic factors, including increased urine output, serum creatinine trajectory, and time-to-nadir serum creatinine after drainage.
INTRODUCTION
Acute kidney injury (AKI) is defined as an increase in serum creatinine (SCr) of ≥ 0.3 mg/dL (≥ 26.5 μmol/l) within 48 h or ≥ 1.5 times from the baseline within 7 d [1,2]. Classically, this biochemical definition is practically translated into a rapid deterioration of kidney functions within hours or days. It is a reversible pathology when properly managed in a timely manner. According to the positional relationship between the original pathology and the kidney of the affected patient, AKI has classically been classified into prerenal (hypovolemic), renal (intrinsic), and postrenal (obstructive; Po-AKI) AKI[2-4]. The latter class represents a urological emergency when the patient presents with disturbed kidney functions, such as an elevated SCr level. The underlying pathology of Po-AKI is the obstruction of the two kidneys or one kidney in patients with a solitary functioning kidney.
The obstruction can occur at any point along the course of the ureters. This obstruction can be caused by either benign causes such as urolithiasis or malignant causes such as bladder cancer. Kidney obstruction with elevated function warrants drainage of the kidneys as fast as possible. Methods of drainage include placement of ureteral stents or percutaneous nephrostomy (PCN) tubes. Currently, there has been no consensus on the optimal mode of drainage (method and laterality) in these cases [5,6]. Malignant ureteral obstruction (MUO) represents a more complex entity than the benign ureteral obstruction (BUO) in the field of AKI because the former has a mechanical factor (the obstruction) and a metabolic factor (the malignancy).
These variables have generated many controversies on the different aspects of the management of patients with AKI due to malignant bilaterally obstructed kidneys (BOKs). They may affect the decisionmaking for the mode of drainage, uncertainty of renal responses after drainage, benefits in the management of the underlying disease, and effects on patient quality of life (QoL) with the different methods of drainage [6][7][8]. In this commentary review, we addressed these different aspects in patients with Po-AKI due to MUO. The relevant recent literature from the last two decades was reviewed for the available approaches of drainage of BOKs in patients with MUO. The scope of the review was to clarify the efficiency of these approaches and the differences and similarities between them.
DESCRIPTION OF SUMMARIZED LITERATURE
The relevant findings from the literature are summarized as relevant findings per study (Table 1) and as a comparison of the technical and practical characteristics ( [25,27,28]. In 2010, the first prospective study was published within the time frame of this review [29]. Between 2011 and 2015, we included four retrospective studies [30][31][32][33], and only one of them had a comparative design [32]. Also, between 2016 and 2019, only four studies were reviewed [34-37], but they included two comparative studies [36,37] and one prospective study [34]. Furthermore, we included three studies published in 2020 [8,38,39], one comparative study in 2021 [40], and three studies in 2022 [5,41,42]. Table 1 included only four prospective studies [5,29,34,40], one large data base study [8], and two multicenter studies [39,40]. Regarding the comparative data presented in Table 2, they were formulated from the studies listed in Table 1
Etiological classification of Po-AKI
Po-AKI is caused by urinary tract obstruction, when this obstruction affects the both functioning kidneys, a solitary kidney, or an only-functioning kidney. Relative to the origin of the obstructing pathology, the mechanism and causes of ureteral obstruction are classified into extraluminal compression, stenosis due to a mural pathology, and intraluminal lodgments. The three most common causes of renal obstruction in adults are urinary stones, malignancy, and iatrogenic benign strictures [6,7]. Hence, these causes are either malignant or benign pathologies. The benign causes include urinary
Pathophysiological mechanisms of Po-AKI with MUO
Obstruction-based mechanisms: There are multiple intrinsic pathophysiological mechanisms of AKI with BOKs, including hemodynamic instability, microcirculatory disorders (such as endothelial dysfunction and microvascular thrombosis), inflammation, tubular cell injury, renal venous congestion, tubular obstruction, and auto-immune processes [53]. Reductions in renal blood flow represent a common pathologic pathway for decreasing the glomerular filtration rate in all these mechanisms [54]. However, the most likely explanation is that one adopting an occurrence of alterations in the glomerulotubular dysfunction due to urine flow obstruction [55]. In the early hours of obstruction of the kidney, the intraluminal pressure is transferred to the renal tubules and to Bowman's space [55]. The transferred pressure results in a decreased filtration pressure in the glomerular capillary walls. After 2-3 h of obstruction, a prostaglandin-mediated myogenic change in the afferent arterioles increases the renal blood flow, which normalizes within 5 h. After 1 d, the renal and intraglomerular blood flow decreases as a result of the intrarenal production of thromboxane A2 and angiotensin II. These products are strong vasoconstrictors of the afferent and efferent arterioles and contribute to the reduction of the glomerular filtration rate [55]. Thromboxane A2 and angiotensin II cause contraction of the mesangial cells, decreasing the glomerular surface area that is used for filtration. After 2 d, increased thromboxane A2 reduces kidney plasma by 60%. With persistence of obstruction, more losses occur in the tubular brush epithelia and renal blood flow [56]. In addition, alterations in physiological sodium and water reabsorption are noted. Sodium absorption increases in the proximal tubules, but this increase is associated with a more significant decrease in sodium absorption in the juxtaglomerular nephrons. Furthermore, there is a reduction in the medullary ability to concentrate urine to only 350-400 mOsm[51,55,57]. This decrease in tonicity results in a drop in water absorption in the descending part of the loop of Henle. Metabolic acidosis and hyperkalemia are common in Po-AKI due to many factors, representing a failure of renal acidification. This occurs with the inability to excrete potassium and hydrogen, which is explained by distal renal tubular acidosis and Na-K-ATPase failure, resulting in hyperkalemia[51].
Malignancy-based pathophysiological mechanisms:
There is a well-established relationship between malignancy and impairment of renal functions. These intimate relationships have led to the evolution of a new branch of nephrology that is concerned with associations of cancer with the renal diseases. It is not only malignancy that affects kidney function by ureteral obstruction, but also various nephropathies are associated with its hematopoietic, chemotherapeutic and immunotherapeutic effects of different types of malignancy. These nephropathies manifest clinically as proteinuria, hematuria, hypertension, and cancer related-chronic kidney disease[58 -60].
AKI in patients with malignancy is relatively common. According to a study conducted on 37000 malignancy patients over a 5-year period, 27% of those patients developed AKI, and 7.6% of them developed severe AKI requiring dialysis. Also, the risk of AKI within the first year after a cancer diagnosis can be more than 18% in malignancy patients [51,61]. The non-obstructive causes of AKI in patients with malignancy include sepsis due to low immunity and bad general conditions, direct kidney injury due to the primary malignancy, metabolic disturbances, and nephrotoxic effects of chemotherapies. In turn, AKI increases the risk of toxic effects from systemic chemotherapy, threatening their continuation [62].
The development of ureteral obstruction in the course of any malignancy is considered a sign of disease progression and reduces the median survival to < 1 year[21,24,34]. MUO is a bad event that is usually associated with advanced, and often, incurable stages of malignancy. Further, it is a definitive cause of urosepsis, acute pain, and uremic syndrome. Unilateral or bilateral MUO is due to extrinsic compression or direct infiltration by a local primary tumor or retroperitoneal lymphadenopathy. It may occur in patients with a previously diagnosed malignancy up to 84%. The median patient age at MUO diagnosis is usually high (Table 1), and the median time for development of MUO after the diagnosis of primary malignancy is variable [5,23]. In comparison, the obstruction-based mechanisms seem to have a more favorable prognosis than the malignancy-based mechanisms. The effect of the benign mechanisms is usually unifactorial and reversible by a prompt drainage of the kidneys. In contrast, the malignancybased mechanisms are virtually multifactorial and irreversible in most instances [62]. Hence, MUO is a modifiable risk factor of morbidity and mortality in patients with Po-AKI due to malignancy. Drainage of the obstructed kidneys can prevent the major sequelae of the obstruction-based mechanisms, promptly reversing the acute deteriorations of renal functions within days or weeks [5].
CLINICAL PRESENTATION
In Po-AKI, the clinical presentation includes the general manifestations of uremia and manifestations of urinary tract obstruction. The latter may include loin pain secondary to stretching of the urinary collecting system and hematuria caused by the obstructing malignancy [63]. Decrease in urine output is a common presentation, but it is not specific to Po-AKI [41,51]. Patients with Po-AKI may present with loin tenderness and fever when obstruction is associated with infection[51,57]. November 25, 2022 Volume 11 Issue 6
DIAGNOSIS
The initial laboratory evaluation should include measurement of blood gases and electrolyte levels, SCr, blood urea nitrogen, and complete blood count. Urinalysis may be requested in cases with a preserved urine output. Then, AKI could be diagnosed and staged according to KDIGO guidelines. In Po-AKI, the hallmark of diagnosis is the presence of hydronephrosis on abdominal ultrasonography (US) or computed tomography [41]. Hydronephrosis can easily be demonstrated by the grey scale US where pelvicalyceal dilatation is recognized with or without disappearance of the renal papillae [51]. After 3 to 4 wk of obstruction, diffuse thinning of the renal cortex and the medullary tissue is mostly recognizable. Moreover, Doppler US can evaluate the blood perfusion of the kidneys themselves by measuring the resistive index and ureteral obstruction by evaluation of the ureteral jets. The absence or decreased frequency of ureteral jets may indicate urinary obstruction. The severity of ureteric obstruction can be determined by evaluating all jet dynamics, including velocity, duration, and frequency [64]. However, computed tomography is still the most diagnostic tool of Po-AKI due to benign and malignant causes [5].
Initial measures of management
While the management of the prerenal and renal types of AKI is mainly supportive in nature, drainage of BOKs is the cornerstone of management of Po-AKI. However, the initial conservative management of patients with Po-AKI is mostly similar to that of the other types. It consists of resuscitation and correction of the metabolic imbalances [41]. However, temporary drainage of BOKs is a mandatory and principal intervention, keeping the correction of the underlying cause to a time after recovery from AKI. A urethral catheter placement can be performed in cases of bladder outlet obstruction such as benign prostatic hyperplasia, but PCN or double-J stent (JJ) are the usual methods in the cases of ureteral obstruction [2,4,65]. Then, the broad-line goals of management are to correct the biochemical abnormalities such as severe metabolic acidosis and hyperkalemia, prevent further injury or progression to chronic kidney disease, and treat the underlying pathology [65]. The management of hyperkalemia includes prevention of the life-threatening cardiac arrhythmias by administering calcium-based salts, support of shifting potassium into the cells, and enhancement of elimination of potassium through cation exchange resins [65,66].
Despite their fundamental roles, these pharmacological and conservative interventions may have a lower effect in the management of Po-AKI than in the management of the other types, relative to the role of drainage [51,57]. Renal replacement therapy is considered in specific circumstances, such as the progression of complications in the severe cases with pulmonary edema, persistent hyperkalemia, and disturbed consciousness. This therapy is mostly in the form of intermittent hemodialysis, but peritoneal dialysis may be performed in a few circumstances [41,51,67].
Regarding the practical aspect of prioritizing dialysis over drainage, there is a perspective that underscores whether the degree of elevation of SCr alone is an indicator to resort to dialysis before drainage [41]. It can be preferable to drain one or both kidneys whenever the patient can withstand the intervention for placement of a PCN[5]. This might augment the chances of recovery with the conservative management and in those patients who may still warrant temporary dialysis after drainage. Despite the drainage efficacy, dialysis could also play an important role in the management of those patients, especially when drainage is not preferable, such as in patients with a very poor prognosis [52,68].
Drainage of BOKs
Currently, there is no consensus or well-established guidelines addressing the proper drainage of MUO, leading to wide variations in the practice patterns and preferences[5, 69,70]. However, relieving MUO prevents death from progressive renal failure and possibly prolongs the patient survival[20,24]. There are two modalities for drainage of the kidneys with MUO: PCN and JJ. Both methods can cause considerable morbidity and reduce a patient's health-related QoL. There are multiple studies that compared both of them and their impact on QoL in MUO because those patients are usually in late stages and their QoL is already impaired [9,71]. The use of JJ for drainage of BOKs has many challenges, including higher invasiveness, need of anesthesia, liability of obstruction, and impossible placement due to complete obliteration of the ureteral lumen. These limitations are potentially present with antegrade and retrograde placement [72,73]. These challenges led to the development of the JJ characteristics, ranging from the new materials to the pressure-based capabilities. JJ has different types, ranging from the conventional polymeric stents to the malignancy-specifically designed stents. Among the latter, there are 3 important types that have gained popularity in recent years and are used in MUO: tandem ureteric stent; metallic stent; and metal-mesh ureteral stents. Many studies have concluded very high rates of stent failure in MUO because the tumor or lymphadenopathy compresses the ureter against the indwelling stent, persistently obliterating the tube lumen and limiting the extraluminal flow [74,75].
Also, the ureteral stent promotes mucous production from the urothelium and leads to urothelial sloughing. The lumen of a ureteral stent can become occluded with this debris [76][77][78].
Metallic ureteral stents gained superiority over the conventional JJ as they have a low occlusion rate, high success rate (60%) at 1 year, and low failure rate (15.4%) [79]. Considering that the median survival time with extrinsic MUO is about 1 year[24,34], there is a high possibility that metallic stent replacement is unnecessary during a patient's life. Tandem ureteric stent consists of a side-by-side ureteric stents within the ureter and can resist obstruction by providing a space in between the two stents that is difficult to compress. It has a success rate of approximately 87% at 2 years [80]. It has a range of exchange from 6 mo to 1 year [76,80]. Success rates ranged from 88% for the Allium stent to 65% for the Memokath 051. Resonance stent demonstrated the lowest migration rate (1%). Uventa showed the lowest obstruction rate (6%). A comparative study conducted by Chen et al [81] reported that metallic stents have longer indwelling time and are superior to conventional polymeric stents. There is a mean increase in functional duration of 4 mo, using the Resonance stent when it is compared to conventional polymeric stent [75].
Although PCN has a high success rate[13] and is considered safer than JJ [69], its need to carry an external bag could threaten the patient QoL [69]. PCN seems to be more suitable for patients with advanced malignancy who may not have the candidacy for anesthesia or the ureteral patency to pass JJ. Also, they may have expected survival rates less than 12 mo that could be improved by PCN. However, the disturbance of their QoL is still the main concern, warranting estimation of the balance between the benefits and the risks[6,70]. There are no clear advantages between the two forms of urinary diversion in MUO[6] (Tables 1 and 2). However, the type of urinary diversion depends on the experience of the urologist, the existing expertise, the availability of the armamentarium, the stage of malignancy, and the urgency of the diversion[82]. In addition, it is dependent on the potential benefits of diversion at different parameters, including the radiological exposure, decrease in SCr, the overall complication rate, febrile episodes after drainage, tube exchange rate, and overall patient survival. Both drainage forms seem to have no advantage over each other in these variables [43].
However, despite the evidence-based recommendation by the recent meta-analyses in favor of the use of JJ rather than PCN in patients with MUO[43], there is an attitude that PCN is more commonly used than JJ for drainage of BOKS with MUO (Table 1). This attitude is noticeable in the single-center studies [5,8,83]. Owing to the potential of placement of wide-caliber tubes and insertion of antegrade JJ [11,37], PCN may provide the chance of obtaining high drainage capacities [44]. Also, PCN may become the only suitable method for drainage, especially in the elderly patients with advanced stages of malignancy who are not candidates for intervention [34,43], or have non-passable MUO [15,43]. On the other hand, PCN may disturb the QoL more than JJ [6,19]. This may be attributable to many potential unfavorable events with PCN such as the repeated slippage, obstruction, and urinary leakage. Hence, there should be a sufficient rationale to perform urinary diversion by PCN in patients with terminal stages of malignancy [6,57,84]. If the evidence of the effect on QoL is absent, the potential survival benefit remains the individual factor that drives the decision, which should be PCN in patients with advanced malignancy [43,84]. This may be attributed to the fact that most of these patients have no further oncological treatment chances following the diversion [39].
Laterality of drainage of BOKs with MUO has been addressed by some authors like Hyppolite et al [85] who concluded superiority of bilateral over unilateral drainage. However, Nariculam et al [28] found no difference between unilateral and bilateral drainage. The combination of the tool and side of drainage in cases of BOKs is known as the mode of drainage. Despite the continuous research, the definition of the optimal mode of drainage of BOKs is still controversial, including the cases of MUO[5,43,70]. We may adopt the perspective of performing unilateral drainage of BOKs, unless there are bilateral infections, pain, or non-improvement of SCr after unilateral drainage. In the latter situation, bilateral drainage can be performed consecutively [5]. Similarly, the optimal mode of drainage of BOKs due to BUO is still controversial. In a recent survey study to evaluate the preferences of urologists and radiologists who may have the principal duties of interventions in cases of acute BOKs, the conclusion was to individualize the decision for each case with emergency indications for upper tract decompression by JJ vs PCN[86].
Urine output
An increase in urine output is an early sign of renal recovery in patients with oliguric AKI. This is accompanied by a reduction in the level of high SCr, followed by a plateau period, and a subsequent fall in SCr [8,54]. Usually, the increase of urine output is physiologic and self-limiting within the first 24 h after relief of obstruction. The kidneys try to normalize the internal environment of the body by fluid and electrolyte homeostasis within the early hours before returning to the normal status of the urine output [57]. The post-obstructive diuresis means increased urine output after relief of BOKs. It is defined as increased urine output > 200 mL for two consecutive hours or urine output > 3000 mL per 24 h after relief of obstruction. When this diuresis becomes excessive or is prolonged, it becomes pathologic. It is attributed to the sudden release of the obstruction, which initiates reflex diuresis by multiple mechanisms, evoking the full capacity of the functioning nephrons[57].
There is a perspective that post-obstructive diuresis may be a sign of the acuteness of the condition and the magnitude of the renal power preserved. Also, it is believed that it is more common after drainage of BOKs due to BUO than those due to MUO[5]. For example, an obstruction by a stone is related to its migratory potential that can be sudden and complete in comparison with an infiltrating malignancy that causes a gradual obstruction [6,7]. However, this point of difference between BUO and MUO has not been sufficiently addressed in the literature. Despite its favorable prognostic values, the potential pathologic, metabolic, and circulatory risks of post-obstructive diuresis may threaten the patient's life. Hence, it should be managed properly by oral or intravenous fluid compensation and management of the electrolyte imbalances that could ensue with excessive diuresis[57].
SCr trajectory
The rate of change of SCr over time in AKI is known as the creatinine trajectory. It can be applied in both the deterioration and recovery phases[1,5]. The time factor in this topic reflects its practical importance in catching a cure in patients with MUO. SCr trajectory has attracted the attention in the management of patients with prerenal and renal AKI [87]. However, it is still not recognizable in cases of Po-AKI. Our own work on this subject has not been published yet. The SCr trajectory is a potential parameter to understand AKI during both the renal dysfunction and recovery phases. The deterioration SCr trajectory may facilitate clinical classification and subtyping of AKI, using a different parameter rather than maximal SCr change. However, it mandates knowing a predeterioration or baseline SCr level, which is often lacking for most patients admitted in an emergency setting[1,88]. On the other hand, based on SCr trajectory, the post-intervention classification facilitates understanding patient responses to early medical interventions. This could be provided by serial measures of SCr. Hence, the identification of AKI subclasses based on SCr trajectory has been proposed as a tool to improve the precision of risk stratification of patients with AKI[1,87,88].
The time-to-nadir SCr
The time needed to reach a nadir SCr or what is known as the time-to-nadir SCr after drainage of BOKs is another parameter of the responses of the kidneys to drainage. To the best of our knowledge, this parameter has not been sufficiently addressed in the literature of Po-AKI due to MUO. However, our work in this issue has revealed that large proportions of patients may fail to reach a normal nadir SCr due to the burden of malignancy. Also, the time-to-nadir in cases of MUO seems to be longer than that in the cases of BUO [5]. Furthermore, the long time-to-nadir SCr may be associated with a low predrainage urine output and high body mass index. The rationale of measurement of the time-to-nadir SCr in patients with AKI is related to the magnitudes of benefits provided by early recovery, regarding the chance of cure or early management. This issue is still controversial in patients with MUO. The timeto-nadir SCr may be significantly shorter in patients with the potential to normalize SCr than in patients without normalized SCr levels after drainage [89].
Malignancy-related factors
The literature reports that some malignancies are statistically significant predictors of worse survival (Table 1). They include the unresectable or unsuitable malignancies for chemotherapy [83], gastropancreatic[90], hormonal-resistant prostate cancers, and those requiring hemodialysis before the procedure [16]. Despite the successful drainage of BOKs in cases of MUO, the survival rate is still poor [23]. The three significant factors that can predict a short survival time after PCN in patients with advanced stage malignancy are a low serum albumin before placement of PCN (3 g/dL or less), low grade hydronephrosis (Grade 1 or 2), and a large number of events related to malignant dissemination (3 or more). Patients who had only one variable had a 69% chance of 6-mo survival, those who had two variables had a 24% survival rate, and those with three variables had a 2% survival rate [6,26]. Wong et al [23] identified other predictors as metastases, prior therapy, and diagnosis of MUO with a previously established malignancy. Despite developing these prognostic models, there should be a shared decisionmaking approach to perform invasive procedures like PCN and JJ, with a questionable degree of the effect on renal function recovery and the risk of complications. There should be a proper explanation of prognosis, subsequent treatment possibilities, and expected results before proceeding to these invasive maneuvers [42].
Current perspectives and future expectations to improve the poor prognosis
In the last decade, the literature has shown an extensive study of the predictors of the success and overall survival rates in patients with MUO. The common finding in this category of patients is the poor overall survival with advanced MUO [68,91]. Many directions have been adopted in research to define the modifiable factors affecting the outcomes of drainage of BOKs in those patients. The main direction is studying the factors related to obstruction-based sequelae of MUO. Besides the type of malignancy, the occurrence of MUO and its degree and laterality were included as risk factors [92,93]. Electrolytes and blood biochemical compounds such as serum albumin and hemoglobin levels have been found as independent factors [94,95]. Hence, several prognostic models have been configured and published, initiating more debates on the optimal management approach [96][97][98][99]. As an overview, the ongoing fact that seems to be verified with time is that not all patients gain benefits from drainage, and treatment should be individualized to each patient [95,100]. Another direction is the improvement of the qualities and compression-bearing capabilities of the drainage tools, represented by the advances in manufacturing of JJ for MUO. In addition, the research has gone to outweighing the certainty of the benefits of interventions versus observation in those patients, considering disturbances of QoL as a principal factor in decision-making[101,102].
CONCLUSION
AKI due to MUO is a urological emergency, warranting immediate evaluation and management. The principal line of treatment is the drainage of the kidneys via a placement of PCN or JJ. Despite the growing relevant literature, there is no consensus on the optimal approach. Several prognostic models have been attempted to stratify those patients relative to the potential risks and justify the interventions, but the controversies persist. Hence, the decision-making should be tailored to the patient stage and status rather than to strict guidelines. This selective approach may be attributed to the presence of many prognostic factors that should be considered during management, including the QoL and the anticipated benefit of drainage with a markedly reduced life expectancy of those patients.
|
v2
|
2022-12-08T15:57:16.558Z
|
2022-11-25T00:00:00.000Z
|
254393891
|
s2orc/train
|
Dichloro[ N -[( η 6 -phenyl)methyl]-4-(1-(3,5,5,8,8-pentamethyl-5,6,7,8tetrahydronaphthalen-2-yl)vinyl)benzamide] (1,3,5-triaza-7-phosphatricyclo[3.3.1.1 3,7 ]decane- κ P 7 )ruthenium
: Bexarotene-tethered RuII(arene) compounds with 1,3,5-triaza-7-phosphatricyclo[3.3.1.1] decane (PTA) were prepared as an analog of RAPTA antitumor complexes in order to evaluate their in vitro antiproliferative activity against human cancer cell lines.
Introduction
Ruthenium-based antitumor drugs are the most widely studied after platinum-based complexes [1][2][3] and are first-in-class approved by FDA as an orphan drug against gastric cancer BOLD 100 ( Figure 1) [4]. OrganorutheniumII(arene) compounds with PTA co-ligands, termed RAPTA (Figure 1), have previously shown excellent tumor-inhibiting properties [5]. Tethering the known metal-based drugs with the biologically active molecule is a promising approach in medicinal chemistry to improve cytotoxicity and selectivity [6][7][8].
Recently we have utilized the antitumor drug bexarotene, a selective agonist of retinoid X receptors (RXRs) and an FDA-approved drug, to treat cutaneous T cell lymphoma, improving the antitumor activity of Ru(II), Ru(III), and Pt(IV) complexes [9][10][11]. In this paper, we have followed the same approach and prepared RAPTA analogs with bexarotene moiety attached to the arene part of the complex. The synthesized compound was fully characterized using NMR spectroscopy and mass-spectrometry with electrospray ionization (ESI-MS). The antiproliferative activity was investigated against human cancer cell lines. Tethering the known metal-based drugs with the biologically active molecule is a promising approach in medicinal chemistry to improve cytotoxicity and selectivity [6][7][8].
Recently we have utilized the antitumor drug bexarotene, a selective agonist of retinoid X receptors (RXRs) and an FDA-approved drug, to treat cutaneous T cell lymphoma, improving the antitumor activity of Ru(II), Ru(III), and Pt(IV) complexes [9][10][11]. In this paper, we have followed the same approach and prepared RAPTA analogs with bexarotene moiety attached to the arene part of the complex. The synthesized compound was fully characterized using NMR spectroscopy and mass-spectrometry with electrospray ionization (ESI-MS). The antiproliferative activity was investigated against human cancer cell lines.
Results
The RAPTA analog with the bexarotene moiety 2 ( Figure 2) was prepared by the reaction of the PTA ligand with Ru-dimer 1 in CH 2 Cl 2 at room temperature (Scheme 1).
of 4
A pure compound was isolated by precipitation out of the reduced-in-volume reaction mixture by the petroleum ether. The compound was characterized by 1 H, 13 C{ 1 H}, and 31 P{ 1 H} NMR spectroscopy, ESI-MS, and elemental analysis (full spectra available in Supplementary Materials). 31 P{ 1 H} NMR spectroscopy was used to monitor the formation of the complex. These spectra included a shift from ca. −100 to −30 ppm for the PTA ligand upon coordination. The 1 H NMR spectrum had no significant shift in the proton signals for both the arene fragment and the CH 2 groups of the PTA ligand compared to the initial ruthenium dimer. ESI-mass spectra were recorded without the addition of any acid or base in both the positive and negative modes, hence, the ions corresponding to complex 2 appeared mainly due to the loss or gain of the chloride ([M − Cl] + and [M + Cl] − ions).
Results
The RAPTA analog with the bexarotene moiety 2 ( Figure 2) was prepared by the reaction of the PTA ligand with Ru-dimer 1 in CH2Cl2 at room temperature (Scheme 1). A pure compound was isolated by precipitation out of the reduced-in-volume reaction mixture by the petroleum ether. The compound was characterized by 1 H, 13 C{ 1 H}, and 31 P{ 1 H} NMR spectroscopy, ESI-MS, and elemental analysis (full spectra available in Supplementary Materials). 31 P{ 1 H} NMR spectroscopy was used to monitor the formation of the complex. These spectra included a shift from ca. −100 to −30 ppm for the PTA ligand upon coordination. The 1 H NMR spectrum had no significant shift in the proton signals for both the arene fragment and the CH2 groups of the PTA ligand compared to the initial ruthenium dimer. ESI-mass spectra were recorded without the addition of any acid or base in both the positive and negative modes, hence, the ions corresponding to complex 2 appeared mainly due to the loss or gain of the chloride ([M − Cl] + and [M + Cl] − ions). For the obtained complex 2, the antiproliferative activity was studied by the MTTassays on a series of human cancer cell lines (lung carcinoma A549, colon carcinoma HCT116, breast adenocarcinoma MCF7, colon adenocarcinoma SW480) and is presented in Table 1. The complex exhibits activity in the range of low micromolar concentrations, exceeding the activity of the parent drug bexarotene Ru-dimer 1 and greatly exceeding the activity of RAPTA-type complexes.
Results
The RAPTA analog with the bexarotene moiety 2 (Figure 2) was prepared by the reaction of the PTA ligand with Ru-dimer 1 in CH2Cl2 at room temperature (Scheme 1). A pure compound was isolated by precipitation out of the reduced-in-volume reaction mixture by the petroleum ether. The compound was characterized by 1 H, 13 C{ 1 H}, and 31 P{ 1 H} NMR spectroscopy, ESI-MS, and elemental analysis (full spectra available in Supplementary Materials). 31 P{ 1 H} NMR spectroscopy was used to monitor the formation of the complex. These spectra included a shift from ca. −100 to −30 ppm for the PTA ligand upon coordination. The 1 H NMR spectrum had no significant shift in the proton signals for both the arene fragment and the CH2 groups of the PTA ligand compared to the initial ruthenium dimer. ESI-mass spectra were recorded without the addition of any acid or base in both the positive and negative modes, hence, the ions corresponding to complex 2 appeared mainly due to the loss or gain of the chloride ([M − Cl] + and [M + Cl] − ions). For the obtained complex 2, the antiproliferative activity was studied by the MTTassays on a series of human cancer cell lines (lung carcinoma A549, colon carcinoma HCT116, breast adenocarcinoma MCF7, colon adenocarcinoma SW480) and is presented in Table 1. The complex exhibits activity in the range of low micromolar concentrations, exceeding the activity of the parent drug bexarotene Ru-dimer 1 and greatly exceeding the activity of RAPTA-type complexes. For the obtained complex 2, the antiproliferative activity was studied by the MTTassays on a series of human cancer cell lines (lung carcinoma A549, colon carcinoma HCT116, breast adenocarcinoma MCF7, colon adenocarcinoma SW480) and is presented in Table 1. The complex exhibits activity in the range of low micromolar concentrations, exceeding the activity of the parent drug bexarotene Ru-dimer 1 and greatly exceeding the activity of RAPTA-type complexes.
General
All commercial reagents were used without further purification. All solvents were purified and degassed before use. 1 H NMR, 13 C NMR, and 31 P spectroscopy were performed at 298 K on Bruker Avance 600. 1 H and 13 C NMR spectra were calibrated against the residual solvent: CDCl 3 . 31 P spectra were calibrated by external reference (85% H 3 PO 4 in H 2 O, δ = 0 ppm). The splitting of the proton resonances in the reported 1 H spectra is defined as s = singlet, d = doublet, t = triplet, and m = multiplet. Mass-spectra were recorded using TSQ Endura (Thermo Scientific, Waltham, MA, USA) mass-spectrometer with an electrospray ionization source (ESI). The methanol solution of each compound was introduced through a syringe pump directly into the ion source at 5-10 µL/min. Mass spectra were acquired in both positive and negative modes. The system was controlled by the Xcalibur software, which was also used for data collection and data processing. The ion transfer tube temperature was set to 275 • C, and the vaporizer temperature to 40 • C. The Sheath and Aux gases were 6 and 5 units, while the spray voltage was 3.4 and 2.5 kV for both positive and negative modes correspondingly. The spectra were recorded during 30 s in the m/z range 150-1400.
Dichloro A solution of 1,3,5-triaza-7-phosphaadamantane (26 mg, 0.16 mmol) in CH 2 Cl 2 (1 mL) was added to a solution of ruthenium dimer 1 (100 mg, 0.08 mmol) in CH 2 Cl 2 (14 mL). The reaction mixture was stirred for 2 h at room temperature. The solvent was evaporated under the vacuum to a minimum volume, the product was precipitated with petroleum ether, separated by centrifugation, and the resulting dark orange powder was dried in a vacuum.
Cells and In Vitro Antiproliferative Assays
The human HCT116 colorectal carcinoma, SW480 colon adenocarcinoma, A549 nonsmall cell lung carcinoma, and MCF7 breast adenocarcinoma cell lines were obtained from the European collection of authenticated cell cultures (ECACC; Salisbury, UK) All cells were grown in a DMEM medium (Gibco™, Dublin, Irland) supplemented with 10% fetal bovine serum (Gibco™, Brazil). The cells were cultured in an incubator at 37 • C in a humidified 5% CO 2 atmosphere and were sub-cultured 2 times a week. The effect of the investigated compounds on cell proliferation was evaluated using a common MTT assay. The cells were seeded in 96-well tissue culture plates («ТРР», Trasadingen, Switzerland) at a 1 × 10 4 cells/well in 100 µL of the medium. After overnight incubation at 37 • C, the cells were treated with the tested compounds in the concentration range of 0 to 200 µM. Cisplatin was used as a standard. After 72 h of treatment, the solution was removed, and a freshly diluted MTT solution (100 µL, 0.5 mg/mL in cell medium) was added to the wells, and the plates were further incubated for 50 min. Subsequently, the medium was removed, and the formazan product was dissolved in 100 µL of DMSO. The number of living cells in each well was evaluated by measuring the absorbance at 570 nm using the «Zenith 200 rt» microplate reader (Biochrom, Cambridge, UK).
Conclusions
The synthesis and characterization of bexarotene-tethered RuII (arene) compounds with 1,3,5-triaza-7-phosphatricyclo[3.3.1.1]decane (PTA) as an analog of the RAPTA complex has been reported here for the first time. The antiproliferative activity of the compound 2 showed the potential applications of this compound as an antitumor agent.
|
v2
|
2022-12-12T05:19:39.285Z
|
2022-11-25T00:00:00.000Z
|
254535029
|
s2orc/train
|
Synergistic In Vitro Anticancer Toxicity of Pulsed Electric Fields and Glutathione
Despite continuous advancement in skin cancer therapy, the disease is still fatal in many patients, demonstrating the need to improve existing therapies, such as electrochemotherapy (ECT). ECT can be applied in the palliative or curative setting and is based on the application of pulsed electric fields (PEF), which by themselves exerts none to low cancer toxicity but become potently toxic when combined with low-dosed chemotherapeutics such as bleomycin and cisplatin. Albeit their favorable side-effect profiles, not all patients respond to standard ECT, and some responders experience tumor recurrence. To identify potential adjuvant or alternative agents to standard electrochemotherapy, we explored the possibility of combining PEF with a physiological compound, glutathione (GSH), to amplify anticancer toxicity. GSH is an endogenous antioxidant and is available as a dietary supplement. Surprisingly, neither GSH nor PEF mono treatment but GSH + PEF combination treatment exerted strong cytotoxic effects and declined metabolic activity in four skin cancer cell lines in vitro. The potential applicability to other tumor cells was verified by corroborating results in two leukemia cell lines. Strikingly, GSH + PEF treatment did not immediately increase intracellular GSH levels, while levels 24 h following treatment were enhanced. Similar tendencies were made for intracellular reactive oxygen species (ROS) levels, while extracellular ROS increased following combination treatment. ROS levels and the degree of cytotoxicity could be partially reversed by pre-incubating cells with the NADPH-oxidase (NOX) inhibitor diphenyleneiodonium (DPI) and the H2O2-degrading enzyme catalase. Collectively, our findings suggest a promising new “endogenous” drug to be combined with PEF for future anticancer research approaches.
Introduction
Despite continuous advancement in skin cancer therapy, the disease is still fatal in many patients [1]. Typical types of skin cancer with high malignancy are malignant melanomas and squamous cell carcinomas (SCC), including those deriving from head and neck tissue (HNSCC). HNSCC originates from mucosal epithelial tissues of the mouth, throat, salivary glands, nose, and sinuses. Etiologically, excessive alcohol and tobacco use and human papillomavirus infection are mainly linked to HNSCC prevalence. The five-year survival rate (incidence: 650,000 globally) is 67% (2013), substantiating the need for further improving therapies. With a 5-year survival rate of only 20%, malignant metastatic melanoma provides similar challenges. Therapeutic strategies depend on the tumor location, cancer stage, patient's age, and general health. Traditional skin cancer therapy includes surgery, radiotherapy, chemotherapy, targeted therapy, immunotherapy, or combinations of those within multimodal schemes [2,3].
Electrochemotherapy (ECT) is among the canon of skin anticancer therapies [4]. Due to many other effective therapies and the large number of patients failing these therapies, ECT is primarily applied in the palliative setting, albeit curative approaches have been 2 of 14 described [5]. Bleomycin and cisplatin are primarily used chemotherapeutics applied within ECT schemes and show overall good tolerability as they are administered at low doses [6,7]. Notwithstanding, ECT's response rates in treating skin cancer patients remain to be improved [8]. Accordingly, several approaches have been reported in the past focusing on novel agents or physical treatment modalities to be potentially combined with PEF, such as doxorubicin [9], 17β-Estradiol [10], supraphysiological calcium [11], gas plasma technology [12], and checkpoint antibody immunotherapies [13].
This study aimed to investigate the potential of an endogenous compound, glutathione (GSH), to combine with PEF for promoting cytotoxic responses in squamous cell carcinoma and malignant melanoma cells in vitro. Glutathione is the most critical human antioxidant and has also been attributed a role in cancer and the success of onco-therapies [14]. Single PEF and GSH treatment did not exert cytotoxic effects, while combining both dramatically increased cell death responses up to 50-fold, partially in a reactive oxygen species (ROS)dependent fashion.
Synergistic GSH and PEF Treatment Shows Striking Anticancer Toxicity
The purpose of this study was, based on preliminary findings, to investigate whether PEF treatment together with GSH exposure would combine to have cytotoxic effects. To this end, mono and combination treatments were performed, and several cell types were analyzed using a microplate reader and flow cytometry assays ( Figure A1). Four skin cancer cell lines (with A375 and MNT-1 being malignant melanoma cells and A431 and SSC-25 being squamous cell carcinoma cells) were used to address this question. In untreated, GSH-exposed, and PEF-treated cells investigated at 24 h, the number of dead or dying cells was virtually unchanged, while combination treatment potently induced terminal cell death ( Figure 1A, viability). Similar results were obtained when considering the metabolic activity. Quantification of these results showed a dramatic (50-fold) GSH + PEF combined toxicity in A375 cells ( Figure 1B). In MNT-1 cells, results were less pronounced but still very potent ( Figure 1C). The combined effect was more pronounced in A431 ( Figure 1D) and SCC-25 ( Figure 1E) cells. In all four skin cancer cell lines, the results of viability testing using flow cytometry and metabolic activity testing using a resazurin-based assay matched, except for SCC-25 cells. In the latter, metabolic activity was higher, indicating a subset of metabolically very active cells surviving the treatment. In all four skin cancer cell lines tested, the exposure to either GSH or PEF alone did not induce cell death, demonstrating the potency of the combination treatment. To assess whether similar results would be achieved in other cancer cell lines, the experiments were performed in THP-1 ( Figure 1F) and Jurkat ( Figure 1G) leukemia cells. A highly significant synergistic effect was observed in both cases, particularly strong in Jurkat cells. Coefficient of drug interaction (CDI) calculations showed outstanding synergistic effects of the PEF and GSH combination treatment across six cancer cell lines (Table 1). Table 1. Coefficient of drug interaction (CDI). CDI was calculated as follows: CDI = (AB)/(AxB). AB is the ratio of the combined treatment group to the control group, and A or B is the ratio of the monotreatment group to the control group. Therefore, CDI < 1 indicates synergism, CDI < 0.7 indicates significant synergism, CDI = 1 indicates an additive effect, and CDI > 1 indicates an antagonistic effect. The CDI was determined for both cell viability and metabolic activity. n.d. = not determined.
Presence and Roles of Reactive Oxygen Species in Combined GSH + PEF Toxicity
GSH is a known antioxidant used in all body cells to fine-tune oxidatively challenging situations and eustress [15]. Thus, we investigated whether the combination treatment would alter this redox balance based on changed levels of either oxidants (ROS) or antioxidants (GSH). GSH is the main source of replenishing the protein thiol pool, and total intracellular GSH was quantified using the thioltracker agent. Twenty-four hours after treatment, A375 ( Figure 2A) and A431 ( Figure 2B) cells showed a markedly enhanced intracellular GSH pool. However, at early time points after treatment, such as 0 h and 2 h, intracellular thiol pools were similar or decreased in combination treatments in A375 ( Figure 2C), MNT-1 ( Figure 2D), A431 ( Figure 2E), and (except for 2 h) in SCC-25 ( Figure 2F) cells. Similar results were seen with exposure of GSH alone in the absence of PEF, and the results were overall similar to GSH + PEF conditions. By contrast, PEF treatment alone left the intracellular GSH levels unchanged. Contrary to what we had expected, these results suggested that PEF treatment did not yield an intracellular GSH overload but did not influence GSH uptake within 2 h after PEF and GSH exposure. By contrast, at 24 h, intracellular GSH levels were elevated in GSH + PEF combination treatment, while GSH and PEF mono treatment did not affect cells considerably.
Changes in the presence or abundance of GSH can be hypothesized to affect reactive oxygen species (ROS) production or levels. Therefore, intracellular ROS were measured at the same time points as intracellular GSH levels. Interestingly, in A375 ( Figure 3A) and A431 ( Figure 3B) skin cancer cells, a decline in intracellular ROS was also observed in combination regimens over mono treatments. Also similar to intracellular GSH levels, there was a strong increase in steady-state intracellular ROS levels at 24 h following GSH + PEF combination exposure, while mono treatments did not show much effect. These results suggested a massive perturbation of redox homeostasis in GSH + PEFtreated skin cancer cells with diverging trends between short-and long-term analysis. Most cell types possess NADPH oxidases (NOX), many of them also at cell membranes, even if in low quantities. NOXs can produce ROS (superoxide) in the extracellular space. We investigated the possibility of extracellular ROS accumulation following mono and combination treatments by performing kinetic measurements in A375 ( Figure 3C,D) and A431 ( Figure 3E,F) cells. Indeed, GSH + PEF combination treatment generated significantly enhanced levels of ROS compared to mono treatments in both skin cancer cell lines. Results were, in principle, similar in MNT-1 cells ( Figure 3G,H), albeit PEF alone already increased ROS strongly in these cells. Interestingly, DPI, an inhibitor of NOX enzymes, significantly reduced extracellular ROS production after combination treatment. Nevertheless, there must be other ROS sources at play, as the amplitude of the DPI-induced ROS reduction was modest. Notwithstanding this, we next sought to investigate the role of ROS in the GSH + PEF-induced apoptosis-induction by pre-incubating cells with DPI or extracellular catalase, an hydrogen peroxide (H 2 O 2 )-depleting enzyme ( Figure 4A). To our surprise, DPI and catalase fully abrogated combination treatment-mediated cytotoxicity and reduced metabolic activity in MNT-1 cells ( Figure 4B). In A375 ( Figure A2A), A431 ( Figure A2B), and Jurkat ( Figure A2C), DPI-mediated cytotoxicity reduction was less pronounced but significant in the case of catalase in the latter cell type ( Figure 4C) as well as in SCC-25 cells ( Figure 4D). These findings strongly suggested a role of ROS as a mechanism of GSH + PEF-induced cancer cell decline. Finally, we were interested in understanding the cell death kinetics of the GSH + PEF combination treatment. To this end, we performed kinetic measurements on terminally dead (DAPI-positive) dead cells in A375 ( Figure 4E,F) and A431 ( Figure 4G,H) cells. Cell death was continuous and peaked at 12 h post-treatment in A375 and >14 h in A431 cells. In A375 but not A431, this may potentially be linked to a significantly enhanced electroporation in the cells with PEF in the presence of GSH ( Figure A3). Strikingly, pre-treatment of both cell types with catalase abrogated cell death induction in GSH + PEF combined treatments to baseline levels, ultimately leading to a significantly reduced cytotoxicity in A375 ( Figure 4F) and A431 ( Figure 4H) skin cancer cells.
kinetic measurements on terminally dead (DAPI-positive) dead cells in A375 ( Figure 4E,F) and A431 ( Figure 4G,H) cells. Cell death was continuous and peaked at 12 h post-treatment in A375 and >14 h in A431 cells. In A375 but not A431, this may potentially be linked to a significantly enhanced electroporation in the cells with PEF in the presence of GSH ( Figure A3). Strikingly, pre-treatment of both cell types with catalase abrogated cell death induction in GSH+PEF combined treatments to baseline levels, ultimately leading to a significantly reduced cytotoxicity in A375 ( Figure 4F) and A431 ( Figure 4H) skin cancer cells. conditions. Data show one representative (A,B) or mean of at least two independent experiments with several replicates (dots). Statistical analysis was performed using one-way anova with Turkey's multiple comparison test (*: p < 0.05, **: p < 0.01, and ***: p < 0.001; colors indicate combination comparison to either GSH or PEF; ns: not significant). n.d.: not determined.
Discussion
Electrochemotherapy (ECT) is an established oncological treatment scheme, especially in patients with palliative skin cancer (malignant melanoma, squamous cell carcinoma) [16,17]. While bleomycin and cisplatin are established cytostatic drugs in ECT, non-responding patients need alternative treatment options. We here provide compelling in vitro evidence that supraphysiological levels of extracellular glutathione (GSH) synergistically combined with pulsed electric field (PEF) treatment to exert cytotoxic effects in six cancer cell lines.
By using two cell lines of three cancer types (malignant melanoma, squamous cell carcinoma, leukemia), we could compare the efficacy of our approach and did not identify a major dependency of PEF + GSH combination treatment on tumor type. This could be owed to two reasons. First, GSH is a universally important molecule in all body cell types, including non-nucleated ones [18]. Second, PEF, especially when applied in the microsecond range, affects cell membranes by inducing membrane charging [19] and pore formation [20]. The basic structure of lipid bilayer cell membranes is similar among different cell types, apart from alterations in, e.g., cholesterol content, lipoproteins, and lipid rafts [21]. In addition, it was suggested that intracellular membranes (e.g., ER) could also be affected by microsecond PEF [22]. However, it should be noted that PEF treatment alone had no notable effect in any of the cell lines or assays investigated. Hence, the key question is the contribution of GSH in this combination treatment. One possibility is that GSH someone extends the opening of the cell membrane pores by interacting with the proteins near the pore site, thereby allowing extensive amounts of cytosol to exit to cell and thereby inducing cell death. This idea is contrasted by our findings that GSH + PEF combination treatment cell death takes place slowly and continuously over many hours and involves activation of caspases 3 and 7, arguing for regulated (apoptotic) cell death rather than necrosis [23]. A second possibility is that PEF treatment induces the formation of GSH aggregates, as known from its oxidized form, GSSG containing two oxidized GSH molecules [24]. Much larger GSH aggregates are observable, e.g., under extensive heat-stress conditions [25]. It is known that protein aggregates can be cytotoxic to cells [26,27].
The strongest association we found with GSH + PEF combination toxicity was the involvement of ROS. ROS are generated upon PEF treatment [28]. In our study, PEF treatment alone did not promote intracellular ROS release in flow cytometry but in three cell lines when measured kinetically. Since DPI, a known inhibitor of NOX in vitro and in vivo [29], reduced ROS release only to a modest extent, other sources, such as mitochondrial ROS due to, e.g., PEF-induced hyperpolarization, may be involved [30]. Since GSH and protein thiols are known to be consumed to deteriorate ROS [31], this could explain the decrease of intracellular GSH 0 h and 2 h after GSH + PEF treatment because GSH is consumed. At the same time, the question is why the abundant extracellular GSH is not transported into the cell to re-establish homeostatic levels. It is important to note that a major pathway of intracellular GSH re-generation is through the import of cystine through the chloride-dependent cystine/glutamate antiporter called solute carrier family 7 (SLC7A11) [32]. Potentially, the transporter activity is decreased through PEF treatment, or the limiting step of GSH intracellular re-constitution is the availability of extracellular cystine. Direct shuttling of GSH across membranes is known for mitochondrial membranes via SLC25A39 [33] but has been less described for cell membranes. In addition, the question arises whether PEF-treated GSH had lost its antioxidative activity. This could be assumed since excess GSH protects tumor cells from cell death [34]. Such protection was not the case since, in our study, tumor cells elaborately died following combination treatment. Therefore, it can be assumed that cell death-inducing stimuli were either too strong or the antioxidant effect of GSH was insufficient to abrogate cell demise, or GSH itself was deteriorated or complexed. A former study found increased GSH antioxidant activity following PEF treatment with about ten to twenty-fold higher field strengths than our study setup, for which no changes were reported [35]. Hence, increased antioxidant activity of PEF-treated GSH unlikely explains the nature of our results.
Pulsed Electric Fields (PEF) Application
An electro square porator (ECM 830; BTX Havard Apparatus, Holliston, MA, USA) was used for applying pulsed electric fields (PEF). PEF pulse duration was 100 µs at 1 Hz and 0.5-0.75 kV/cm as compliant with the European standard operating procedures for electrochemotherapy [36]. Before PEF treatment, cells received either vehicle controls or 10 mM Glutathione (Sigma-Aldrich, St. Louis, MO, USA). In some experiments, cells were pre-incubated with diphenyleneiodonium (DPI, 1 µM; Sigma-Aldrich, St. Louis, MO, USA), being a general NADPH oxidase (NOX) inhibitor or the hydrogen peroxide (H 2 O 2 )-degrading enzyme catalase (20 µg/mL, Sigma-Aldrich, St. Louis, MO, USA). For the PEF treatment, the cells were transferred to electroporation cuvettes (2 mm; Biozym Scientific, Oldendorf, Germany). Control samples were transferred to such cuvettes as well as mock treatment. Afterward, cells were added to microwell plates or immediately used for downstream analysis. To confirm electroporation, YO-PRO-1 (0.5 µM; Thermo Fisher Scientific, Waltham, MA, USA) was added to the cells for 15 min at a pre-determined frequency (immediately, 3 min, 6 min, and 9 min after treatment). Subsequently, the YOPRO-1 mean fluorescence intensities were measured using flow cytometry and normalized.
Metabolic Activity
To identify the cells' metabolic activity, resazurin (100 µM; Alfa Aesar, Kandel, Germany) was added 20 h after their treatment. Then, the cells were incubated for 4 additional hours. During this time, resazurin is transformed by metabolically active cells into fluorescent resofurin, which can be quantified in the cells' supernatants. This was accomplished using a multimode plate reader (F200; Tecan, Männedorf, Switzerland) at λ ex 560 nm and λ em 590 nm. Data were normalized to controls.
Cell Viability
Cell viability was determined by incubating the cells for 30 min in the incubator with CellEvent caspase 3/7 reagent (1 µM; Thermo Fisher Scientific, Dreieich, Germany) and 4 , 6-Diamidino-2-phenylindole dihydrochloride (DAPI, 1 µM; BioLegend, Amsterdam, The Netherlands). Before, adherent cell lines were detached using accutase (BioLegend), while suspension cell lines were collected directly into round-bottom 96-well plates. Cells were acquired using flow cytometry (CytoFLEX LX; Beckman-Coulter, Krefeld, Germany). For viability analysis, the percentage of the caspase 3/7-negative, DAPI-negative population was quantified among all intact cells gated from the forward and side scatter dot plots. Data were normalized to controls. Alternatively, cell death was quantified dynamically. For this, cells were seeded in 96-well plates after treatment, and DAPI was added. Then, the plates were added to a pre-heated and pre-gassed microplate reader (M200; Tecan) equipped with temperature control and CO 2 supply units (Tecan, Männedorf, Switzerland). In addition, the outer wells of the well plates were filled with deionized water to protect the inner wells from evaporation during the extended 12 h-incubation period in the microplate reader and DAPI fluorescence acquisition (λ ex 365 nm and λ em 450 nm) every 30 min. Data were normalized to individual wells' baseline values at 2 h after the plate acquired the correct temperature. Data analysis was performed by calculating the resulting areas under the curve (AUC).
Intracellular Glutathione
To determine the intracellular glutathione content, the cells were stained with propidium iodide (PI; 5 µg/mL; Santa Cruz Biotechnology, Heidelberg, Germany) to discriminate live from dead cells, and ThiolTracker Violet (10 µM; Thermo Fisher Scientific) in PBS containing calcium and magnesium (Pan-Biotech). The staining was done for 30 min in the incubator. During this time, the dye penetrates the cell membranes and binds free protein thiols (reduced GSH) in all cellular compartments. The binding leads to a conformational change and fluorescent properties (λ ex 405 nm and λ em 525 nm). After the staining, the cells were washed with fully supplemented cell culture medium and resuspended in FACS buffer for acquisition by flow cytometry (CytoFLEX S; Beckman-Coulter). This process was done for cells immediately after treatment and after 2 h and 24 h incubation. Data were normalized to control samples.
Intracellular and Extracellular Reactive Oxygen Species
To assess the intracellular oxidation, the cells were stained with DAPI to exclude dead cells and CM-H 2 DCFDA (1 µM; Thermo Fisher Scientific) for cytosolic reactive oxygen species (ROS). The staining was performed for 15 min in the incubator in PBS. Afterward, the cells were washed, resuspended in fully supplemented medium, and measured using flow cytometry (CytoFLEX S). This was done immediately and 2 h and 24 h after treatment. To dynamically assess the production or release of ROS into extracellular space, the cells were exposed to the different PEF treatment modalities, added to a 96-well plate containing DCFH, and put into a 37 • C-pre-heated and pre-CO 2 -gassed microplate reader (F200) to dynamically assess fluorescence intensities every 15 min (λ ex 485 nm and λ em 525 nm). The outer wells of the plate were filled with deionized water to protect from evaporation.
Software and Statistical Analysis
Flow cytometry samples were quantitively analyzed in this study using Kaluza analysis software 2.1.3 (Beckman-Coulter). Data normalization was done using Excel 2021 (Microsoft, Redmond, WA, USA). Data analysis and graphing were done utilizing prism 9.4.1 (GraphPad Software, San Diego, CA, USA). One-way ANOVA with Turkey's multiple comparison test or t-test was executed to determine the degree of statistical significance between groups. The level of significance is indicated as follows: p < 0.05 (*), p < 0.01 (**), and p < 0.001 (***).
Conclusions
This first-time reporting of extensive cytotoxic effects of extracellular GSH across several PEF-treated cancer cell types could lead to identifying a new molecule to be used within local ECT injection schemes in palliative oncology. The benefits of GSH are the absence of toxicity due to decades of experience as a dietary nutrient and its role as an intracellular oxidant, making this "endogenous drug" a promising candidate to be tested in animal models for the safety and efficacy of the treatment when benchmarked against standard ECT regimes using cisplatin or bleomycin. Future studies also need to elaborate the relationship between electric field intensity and cytotoxic GSH activity for different intensities, concentrations, time points, and cell lines. Another striking point that needs to be investigated using cells and tissue models is whether the antioxidant activity of GSH is altered due to PEF processing. Figure A1 was realized with a commercial license of biorender.com.
Conflicts of Interest:
The authors have no conflict of interest to declare. Appendix A Figure A1. Study design. Tumor cells in the presence or absence of glutathione (GSH) were expos to pulsed electric fields (PEF) prior to seeding in microwell plates, incubation, and downstrea analysis using flow cytometry and plate reader-based assays. Figure A1. Study design. Tumor cells in the presence or absence of glutathione (GSH) were exposed to pulsed electric fields (PEF) prior to seeding in microwell plates, incubation, and downstream analysis using flow cytometry and plate reader-based assays.
|
v2
|
2022-12-24T05:11:54.383Z
|
2022-11-25T00:00:00.000Z
|
254997434
|
s2orc/train
|
Cuproptosis-Related lncRNA Gene Signature Establishes a Prognostic Model of Gastric Adenocarcinoma and Evaluate the Effect of Antineoplastic Drugs
Background: One of the most frequent malignancies of the digestive system is stomach adenocarcinoma (STAD). Recent research has demonstrated how cuproptosis (copper-dependent cell death) differs from other cell death mechanisms that were previously understood. Cuproptosis regulation in tumor cells could be a brand-new treatment strategy. Our goal was to create a cuproptosis-related lncRNA signature. Additionally, in order to evaluate the possible immunotherapeutic advantages and drug sensitivity, we attempted to study the association between these lncRNAs and the tumor immune microenvironment of STAD tumors. Methods: The TCGA database was accessed to download the RNA sequencing data, genetic mutations, and clinical profiles for TCGA STAD. To locate lncRNAs related to cuproptosis and build risk-prognosis models, three techniques were used: co-expression network analysis, Cox-regression techniques, and LASSO techniques. Additionally, an integrated methodology was used to validate the models’ predictive capabilities. Then, using GO and KEGG analysis, we discovered the variations in biological functions between each group. The link between the risk score and various medications for STAD treatment was estimated using the tumor mutational load (TMB) and tumor immune dysfunction and rejection (TIDE) scores. Result: We gathered 22 genes linked to cuproptosis based on the prior literature. Six lncRNAs related to cuproptosis were used to create a prognostic marker (AC016394.2, AC023511.1, AC147067.2, AL590705.3, HAGLR, and LINC01094). After that, the patients were split into high-risk and low-risk groups. A statistically significant difference in overall survival between the two groups was visible in the survival curves. The risk score was demonstrated to be an independent factor affecting the prognosis by both univariate and multivariate Cox regression analysis. Different risk scores were substantially related to the various immunological states of STAD patients, as further evidenced by immune cell infiltration and ssGSEA analysis. The two groups had differing burdens of tumor mutations. In addition, immunotherapy was more effective for STAD patients in the high-risk group than in the low-risk group, and risk scores for STAD were substantially connected with medication sensitivity. Conclusions: We discovered a marker for six cuproptosis-associated lncRNAs linked to STAD as prognostic predictors, which may be useful biomarkers for risk stratification, evaluation of possible immunotherapy, and assessment of treatment sensitivity for STAD.
Introduction
One of the biggest causes of cancer-related fatalities globally is gastric cancer (GC) [1]. The most prevalent subtype of GC is understood to be stomach adenocarcinoma (STAD). At the time of initial diagnosis, most STAD patients had distant metastases. Significant advancements in the treatment of advanced STAD, including targeted treatments and immunotherapy as well as conventional chemotherapy, have improved prognosis in recent years [2]. Although STAD is a highly diverse tumor, many patients in clinical practice do not benefit from immunotherapy or targeted therapy [3]. Therefore, it is essential to choose those patients who might benefit from these treatments.
Long non-coding RNAs (lncRNAs) are non-coding functional RNAs. Numerous lncRNAs are related to patient prognosis in STAD [4][5][6], even though several lncRNAs have been linked to the prognosis of gastric cancer and may be exploited as prognostic markers in future prognostic studies. However, because lncRNAs and genes may be associated, unilateral examination of lncRNA is frequently unstable. Therefore, a model incorporating various lncRNAs with predictive impact must be created. A nutrient called copper plays a role in the pathways that control cell growth and degeneration. Peter Tsvetkov et al. [7] recently described a novel type of cell death called cuproptosis, which is distinct from the known processes of death such apoptosis, pyroptosis, necrosis, and ferroptosis. Cuproptosis has been shown to be associated with the occurrence and development of a variety of cancers, including liver cancer [8], colorectal cancer [9], esophageal cancer [10], and some hematologic malignancies, including the acute myeloid leukemia [11]. These studies suggest that cuproptosis may be associated with a wider range of malignancies. However, the relationship between cuproptosis and STAD remains unclear. The lncRNAs related to cuproptosis may serve as a potential diagnostic, typing and therapeutic targets for STAD in the future.
To conduct a comprehensive analysis of cuproptosis-related gene (CRG) expression, mutational status, and copy number alterations, we gathered STAD samples from The Cancer Genome Atlas (TCGA) database. To fully assess the relationship between various risk strata and the tumor immune microenvironment (TIME), predictive models were created. Additionally, we looked into how sensitive patients were to STAD immunotherapeutic medicines based on their risk levels. Our research offers fresh perspectives on STAD categorization and effective therapy.
Data Collection
The TCGA database (https://cancergenome.nih.gov/ (accessed on 11 September 2022) provided the RNA sequencing data as well as pertinent clinical and follow-up data. Stomach adenocarcinoma (STAD) FPKM values were converted to transcripts per kilobase million and then normalized (TPM). We combined the two cohorts and eliminated patients whose survival status was uncertain or for whom there was insufficient follow-up data. In this study, 371 STAD patients were enrolled for analysis. Clinical information was gathered, including TNM stage, pathological grade, age, gender, follow-up period, and survival status. In this study, 22 genes associated with cuproptosis were chosen for examination based on previously published studies [7,[12][13][14].
Construction of Cuproptosis-Related Prognostic Signature for STAD
Cuproptosis-related lncRNAs that were strongly correlated with survival were identified using LASSO regression and Univariate Cox regression analysis. A 6-lncRNA signature was created based on the regression coefficient and prognostic potential.
Establishment and Evaluation of the 6-lncRNA Signature
All of the patients were separated into two groups at random, one of which served as the test set and the other as the train set. The median risk score is utilized in the train set to categorize patients into two categories (high and low risk, respectively). The R software packages "survival" and "survminer" were used to perform the Kaplan-Meier survival analysis. Additionally, the accuracy and diagnostic value of the 6-lncRNA signature were assessed using the receiver operating characteristic (ROC) curve and the area under the curve (AUC). The consistency of these results in the test set was subsequently confirmed. In order to validate risk models, the principal component analysis (PCA) was also carried out [15]. Scatterplot3D programs in R software were used to display the results. The R "survival" and "survminer" packages were used to calculate the progression-free survival (PFS). We utilized the R packages "rms", "dplyr", "survival", and "pec" to predict the accuracy of risk models using the C-index.
Exploration of the Relationship between the Prognostic Risk Score and Clinical Stage
We investigated the correlations between risk score and clinical stage using univariate and multivariate Cox regression analyses to determine whether the model is appropriate for patients with various clinical stages.
Construction of Nomogram
We developed nomograms for predicting survival in STAD patients using the clinical parameters, such as TNM stage, age, and gender. Calibration curves were also created in order to evaluate the consistency between anticipated and actual survival.
Enrichment Functional Analysis
We started by comparing the expression of a group of DEGs, or differentially expressed genes, in the two groups. We used the following rules by referring to previous studies [8,16]: if the LogFC (fold change) is greater than 1 or less than −1 (|logFC| > 1), we think that the gene is expressed significantly differently in the two risk groups. Furthermore, the FDR (false discovery rate) should less than 0.05. Following that, KEGG pathway analysis and GO function enrichment analysis were carried out for selected DEGs.
Estimation of Intratumoral Immune Cell Infiltration
We measured the number of immune cells in the two risk groups using the ssGSEA algorithm. In addition, according to previous research, the clinical effectiveness of immune checkpoint inhibitor blocking therapy may be connected with the level of gene expression in immune checkpoint-related tissues. Thus, it was also investigated whether there was a relationship between risk scores and immunological checkpoints.
Estimation of Tumor Mutation Burden
The quantity of tumor mutations is reflected by the tumor mutational burden (TMB). Using the R package "maftools" the mutation data of HNSC samples acquired from TCGA were examined. The waterfall diagram demonstrated the connection between TMB and risk ratings in HNSC patients. The immunological reaction was forecasted using the tumor immune dysfunction and exclusion (TIDE) method.
Evaluation of Drug Sensitivity
The measured antagonist's measured IC50 concentration was its semi-inhibitory level. We used the "pRRophetic" R package and its dependencies "car, ridge preprocess Core, genefilter, and sva" to determine the IC50 of the chemotherapeutic medicines in order to evaluate CRLPM in the clinic for the treatment of HNSC. There were 19 different medications total. The IC50 discrepancies between popular antineoplastic drugs in the high-and low-risk categories were compared using the Wilcoxon sign rank test. The "ggplot2" R package was used to present the boxplot.
Data Processing
A total of 371 STAD samples were randomly assigned to the test set (n = 185) or the training set (n = 186). The clinical characteristics of the patients in the two sets are shown in Table 1. The differences among all the baseline variables were not statistically significant (all p-values > 0.05). We identified 17648 lncRNAs in the TCGA_STAD dataset. In total, we collected 22 cuproptosis-related genes. The Sankey plot showed the association between cuproptosisrelated genes and cuproptosis-related lncRNAs ( Figure 1).
Genes 2022, 13, x FOR PEER REVIEW 5 of 16 Figure 1. The relationships between cuproptosis-related genes and cuproptosis-related lncRNAs in the Sankey diagram. lncRNA, long noncoding RNA.
A Cuproptosis-Related Long Noncoding RNAs Prognostic Marker for STAD: Development and Validation
The "glmnet" package of R software was used to find the cuproptosis-related lncRNAs with the highest prognostic values. We identified sixteen lncRNAs ( Figure 2A).
The patients in the test group and training group were then split into high-and lowrisk groups for survival analysis based on the median risk score. The OS of patients in the two groups was analyzed using the KM technique ( Figure 3A-C). The overall survival rate (OS) in both groups was substantially greater in the high-risk group than in the lowrisk group (p = 0.05) The cuproptosis-related lncRNAs' diagnostic usefulness for the OS of STAD patients was demonstrated by the ROC curves ( Figure 3D). For the 1-, 3-, and 5year ROCs, the area under the curve (AUC) was 0.703, 0.722, and 0.680, respectively. Additionally, the risk score (AUC = 0.703) has a stronger diagnostic value when compared to Figure 2C represents the change trajectory of each coefficient of the independent variable (representing a LncRNA in this study). The ordinate is the value of the coefficient, the lower abscissa is log (λ), and the upper abscissa represents the number of non-zero coefficients in the model at this time.
(D) Correlation of lncRNAs with cuproptosis-related genes in risk models.
The patients in the test group and training group were then split into high-and lowrisk groups for survival analysis based on the median risk score. The OS of patients in the two groups was analyzed using the KM technique ( Figure 3A-C). The overall survival rate (OS) in both groups was substantially greater in the high-risk group than in the low-risk group (p = 0.05) The cuproptosis-related lncRNAs' diagnostic usefulness for the OS of STAD patients was demonstrated by the ROC curves ( Figure 3D). For the 1-, 3-, and 5-year ROCs, the area under the curve (AUC) was 0.703, 0.722, and 0.680, respectively. Additionally, the risk score (AUC = 0.703) has a stronger diagnostic value when compared to other variables ( Figure 3E), such as age (AUC = 0.594), gender (AUC = 0.522), tumor grade (AUC = 0.561), and tumor stage (AUC = 0.602). The C-Index curve ( Figure 3F) showed that the risk model had higher consistency than other variables. Figure 4A-F displays the distribution of risk scores and the patients' survival status. The survival time was decreased and the death rate rose in all three groups as the risk score rose. A heatmap depicts the expression levels of six lncRNAs related to cuproptosis that were active in three groups ( Figure 4G-I).
Independent Prognostic Marker for Cuproptosis-Related lncRNAs in Predicting Overall Survival
To examine the predictive potential of the prognostic signature employing cuproptosisrelated lncRNAs in STAD, univariate and multivariate Cox regression analyses were undertaken. Age, stage, and risk score all showed statistically significant differences in the univariate Cox analysis ( Figure 5A). They continued to be statistically significant in the multivariate Cox regression analysis ( Figure 5B). They show that the risk score can independently predict the prognosis of STAD patients (HR = 1.134, 95% CI = (1.074-1.197), p = 0.001). Between the high-and low-risk groups, there is a statistically significant difference in PFS (progression-free survival) (p = 0.001, Figure 6A). After that, we looked into the reasons behind the discrepancies between the high-and low-risk groups using PCA. Figure 6C,D shows that there are no variations in the expression of all genes, all 22 cuproptosis-related genes, or all 16 cuproptosis-related lncRNAs ( Figure 6E). However, the six cuproptosis-associated lncRNAs were the most effective at differentiating between patients at low and high risk ( Figure 6B). Patients were further separated into subgroups to examine whether clinical stages had an impact on the prognostic signature's capacity to predict outcomes. All high-risk patients were discovered to have a worse prognosis in both stage I-II ( Figure 7A) and stage III-IV ( Figure 7B) categories. For the purpose of analyzing clinical outcomes in STAD patients quantitatively, a predictive nomogram model comprising eight variables was developed ( Figure 7C). The calibration curves demonstrate that the model's predictions and the measured values correspond quite well ( Figure 7D). In conclusion, cuproptosis-related lncRNAs have independent and reliable prognostic prediction abilities.
Independent Prognostic Marker for Cuproptosis-Related lncRNAs in Predicting Overall Survival
To examine the predictive potential of the prognostic signature employing cuproptosis-related lncRNAs in STAD, univariate and multivariate Cox regression analyses were undertaken. Age, stage, and risk score all showed statistically significant differences in the univariate Cox analysis ( Figure 5A). They continued to be statistically significant in the multivariate Cox regression analysis ( Figure 5B). They show that the risk score can independently predict the prognosis of STAD patients (HR = 1.134, 95%CI = (1.074-1.197), p = 0.001). Between the high-and low-risk groups, there is a statistically significant difference in PFS (progression-free survival) (p = 0.001, Figure 6A). After that, we looked into the reasons behind the discrepancies between the high-and low-risk groups using PCA. Figure 6C,D shows that there are no variations in the expression of all genes, all 22 cuproptosis-related genes, or all 16 cuproptosis-related lncRNAs ( Figure 6E). However, the six cuproptosis-associated lncRNAs were the most effective at differentiating between patients at low and high risk ( Figure 6B). Patients were further separated into subgroups to examine whether clinical stages had an impact on the prognostic signature's capacity to predict outcomes. All high-risk patients were discovered to have a worse prognosis in both stage I-II ( Figure 7A) and stage III-IV ( Figure 7B) categories. For the purpose of analyzing clinical outcomes in STAD patients quantitatively, a predictive nomogram model comprising eight variables was developed ( Figure 7C). The calibration curves demonstrate that the model's predictions and the measured values correspond quite well ( Figure 7D). In conclusion, cuproptosis-related lncRNAs have independent and reliable prognostic prediction abilities.
Functional Enrichment Analysis
To learn more about the lncRNAs and mRNAs that were differentially expressed in the two risk groups, we used GO (Figure 8A,B) and KEGG ( Figure 8C,D) pathway analysis. Skeletal system development and ossification were highly enriched in the BP (biological processes) category. The DEGs were primarily concentrated in collagen-containing as well as six other pathways within the CC (cellular components) category. DEGs were pri-
Functional Enrichment Analysis
To learn more about the lncRNAs and mRNAs that were differentially expressed in the two risk groups, we used GO ( Figure 8A,B) and KEGG ( Figure 8C,D) pathway analysis. Skeletal system development and ossification were highly enriched in the BP (biological processes) category. The DEGs were primarily concentrated in collagen-containing as well as six other pathways within the CC (cellular components) category. DEGs were primarily enriched in receptor-ligand activity and signaling receptor activator activity in the MF (molecular functions) category. Differentially expressed genes were mainly enriched in the PI3K-Akt signaling network, neuroactive receptor-ligand interaction, and another 22 pathways, according to KEGG pathway analysis. Figure 9A depicts the results of our investigation into the relationship between risk ratings and immune-related activities in STAD. The heatmap demonstrates the striking differences between the CCR, Type 1 IFN response, HLA, APC co-stimulation, parainflammation, Type II IFN response T-cell co-inhibition, Cheak point, and T-cell costimulation in various risk classes. It is interesting to note that in high-risk patients, almost Figure 9A depicts the results of our investigation into the relationship between risk ratings and immune-related activities in STAD. The heatmap demonstrates the striking differences between the CCR, Type 1 IFN response, HLA, APC co-stimulation, parainflammation, Type II IFN response T-cell co-inhibition, Cheak point, and T-cell co-stimulation in various risk classes. It is interesting to note that in high-risk patients, almost all immunerelated processes are more active.
Tumor Mutational Burden of the Cuproptosis-related lncRNAs Prognostic Marker in Samples
TMB (tumor mutation burden) was significantly different between the two gro general ( Figure 9B). It is unclear why the high TMB group demonstrated a better pr sis than the low TMB group ( Figure 9C). The prognosis of STAD patients was then f evaluated by combining risk score and TMB, and we discovered that, regardless TMB level, the high-risk group had a poorer chance of survival than the low-risk ( Figure 9D). From the TGCA database, we obtained the somatic mutation data, a compared the mutation rates between the two groups ( Figure 9E,F). The findings re that the high-risk group had a greater mutation frequency than the low-risk group (9 vs. 89.16%). The two genes with the highest mutation frequency were TTN and TP5
Tumor Mutational Burden of the Cuproptosis-related lncRNAs Prognostic Marker in STAD Samples
TMB (tumor mutation burden) was significantly different between the two groups in general ( Figure 9B). It is unclear why the high TMB group demonstrated a better prognosis than the low TMB group ( Figure 9C). The prognosis of STAD patients was then further evaluated by combining risk score and TMB, and we discovered that, regardless of the TMB level, the high-risk group had a poorer chance of survival than the low-risk group ( Figure 9D). From the TGCA database, we obtained the somatic mutation data, and we compared the mutation rates between the two groups ( Figure 9E,F). The findings revealed that the high-risk group had a greater mutation frequency than the low-risk group (90.26% vs. 89.16%). The two genes with the highest mutation frequency were TTN and TP53.
Drug Sensitivity
Analyses were performed on the immunotherapy's sensitivity variations between the two risk groups. The low-risk group had considerably lower TIDE scores than the high-risk group ( Figure 10A), indicating that they were more likely to receive effective immunotherapy and less likely to experience immunological escape. The half maximum IC50 (half maximum inhibitory concentration) of several medications was determined in two groups to reveal the relationship between drug sensitivity and risk scores in order to determine whether our risk score model might be used in the tailored treatment of STAD ( Figure 10B-K). The IC50 of Gefitinib increased as the risk score rose, but it reduced for Cytarabine, Dasatinib, Pazopanib, and Saracatinib. Cytarabine, Dasatinib, Pazopanib, and Saracatinib had a greater IC50 for the low-risk group, but Gefitinib had a higher IC50 for high-risk group. Supplementary Figures S1 and S2 display the outcomes of the other 14 medications. In conclusion, the findings imply that our risk model might guide therapeutic care for STAD patients.
Drug Sensitivity
Analyses were performed on the immunotherapy's sensitivity variations between the two risk groups. The low-risk group had considerably lower TIDE scores than the high-risk group ( Figure 10A), indicating that they were more likely to receive effective immunotherapy and less likely to experience immunological escape. The half maximum IC50 (half maximum inhibitory concentration) of several medications was determined in two groups to reveal the relationship between drug sensitivity and risk scores in order to determine whether our risk score model might be used in the tailored treatment of STAD ( Figure 10B-K). The IC50 of Gefitinib increased as the risk score rose, but it reduced for Cytarabine, Dasatinib, Pazopanib, and Saracatinib. Cytarabine, Dasatinib, Pazopanib, and Saracatinib had a greater IC50 for the low-risk group, but Gefitinib had a higher IC50 for high-risk group. Supplementary Figures S1 and S2 display the outcomes of the other 14 medications. In conclusion, the findings imply that our risk model might guide therapeutic care for STAD patients.
Discussion
One of the tumors of the digestive system that pose significant health hazards is STAD, which has drawn attention from people all over the world [8]. Studying
Discussion
One of the tumors of the digestive system that pose significant health hazards is STAD, which has drawn attention from people all over the world [8]. Studying prospec-tive biomarkers and potentially tumor-promoting or suppressor genes [9,17] in STAD is therefore worthwhile.
The primary mechanism of tumor treatment resistance is tolerance to apoptosis, which is mainly induced by conventional chemotherapeutic agents in tumor cells [18]. Comprehensive research on the apoptotic pathways in tumor cells in recent years has gradually revealed new types of programmed cell death, including pyroptosis, ferroptosis, and necroptosis. Most significantly, cuproptosis is the most recent type of programmed cell death to be described. Lipid peroxidation and significant iron accumulation are frequently present in addition to it [19,20]. A loss in cellular antioxidant capability, a buildup of lipid reactive oxygen species (ROS), and ultimately oxidative cell death can result from the direct or indirect effects of iron atrophy inducers on glutathione peroxidase [21]. Similarly, copper can cause cell death by increasing energy metabolism in the mitochondria and ultimately oxidative cell death.
Similar to the way it causes cuproptosis, copper can also cause cell death via increasing energy metabolism that is dependent on the mitochondria and cytotoxicity brought on by a buildup of ROS. According to research, copper is a dynamic signaling metal and an extraterrestrial bioregulator that controls and coordinates biological activity in response to environmental cues. When the copper transporter CTR1 or ULK1 is genetically lost or mutated, copper binding is disrupted, which lowers ULK1/2-dependent signaling, autophagosome complex formation, and lung cancer development and survival [22]. The RAS/RAF/MEK/ERK (MAPK) signaling cascade controls fundamental cellular processes such as cell proliferation, survival, and differentiation. It is also crucial for intracellular communication. Increased levels of activation upstream of receptor tyrosine kinase TRKB, EGFR, and MAPK signaling were seen in copper-treated cancer cells [23,24]. The E2-binding enzymes UBE2D1 and UBE2D4 are heterologously activated by copper metallization to accelerate protein breakdown. As a result, ubiquitin labels and destroys several proteins, most notably p53. Therefore, the overabundance of copper in malignant cells causes the attenuation of p53, which may contribute to the tumor cells' resistance to programmed cell death [25].
In this study, to gain insight into cuproptosis-associated lncRNAs with STAD prognosis, we first downloaded the expression profiles of lncRNAs and genes in STAD patients provided by the TCGA database. By cox regression and LASSO analysis, we identified six prognosis-related lncRNAs: AC016394.2, AC023511.1, AC147067.2, AL590705.3, HAGLR, and LINC01094. we constructed a 6-lncRNA signature risk score model. We further divided the patients into high-risk score and low-risk score groups based on median risk scores. Patients with high-risk scores had significantly shorter survival. ROC analysis was used to evaluate the accuracy of this lncRNA risk model. the high AUC value at 5 years (AUC = 0.608) suggested that the risk model was reliable for the prognosis of STAD. The risk score (AUC = 0.703) had a better diagnostic value than other variables. The Cox regression analysis of the risk score model and clinical characteristics suggested that the genetic risk model could be used as an independent predictor for prognostic evaluation of STAD.
In addition, we evaluated the tumor immune microenvironment of STAD patients in different risk groups, and almost all immune-related activities were more active in high-risk patients. We evaluated the TMB in STAD patients, and we found that TTN and TP53 were the two genes with the highest mutation frequencies, and the probability of 3-, 5-, and 10-year survival was lower in the high-risk group than in the low-risk group, regardless of TMB levels. Finally, we evaluated 19 STAD therapeutic agents and found different "risk score-sensitivity" relationships. The results suggest that our risk model can inform the clinical treatment of STAD patients.
However, our work has some limitations. Firstly, we did not demonstrate our results in in vitro tissues. Secondly, some novel lncRNAs with clinical importance in STAD need to be further explored to determine their potential molecular mechanisms. Thirdly, the training and test sets were equally separated in this article. Although the statistical consistency of clinical indicators can be achieved by reducing the sample difference between two groups, the performance of the parameter estimation through the training set may degrade.
In conclusion, we identified a practical prognostic model based on cuproptosisassociated lncRNAs in STAD and analyzed the relationship between cuproptosis and tumor immune correlates. Our findings provide a reference for exploring novel targeting and immunotherapy approaches for STAD.
Supplementary Materials: The following supporting information can be downloaded at: https:// www.mdpi.com/article/10.3390/genes13122214/s1, Figure S1: The correlation between the risk score and estimated IC50 value in 14 drugs; Figure S2: Comparison of estimated IC50 value 14 drugs between high-and low-risk groups.
|
v2
|
2022-12-28T16:01:52.581Z
|
2022-11-25T00:00:00.000Z
|
255178418
|
s2ag/train
|
Assessing Feasibility of Using Quality of Life Questionnaire in Head and Neck Cancer Patients Undergoing Palliative Radiation Therapy
Objective: Advanced head and neck cancer patients have distressing symptoms and bad prognosis. They have very limited treatment options. Radiation therapy in palliative intent appears to decrease symptoms. But there are limited data on palliative radiation therapy in relation to quality of life. Materials and methods: We conducted a pilot study to assess the feasibility of using quality of life questionnaire in patients undergoing palliative radiation therapy. Advanced head and neck cancer patients who are deemed incurable were recruited. Results: Out of 15 patients, 9 were males and 6 were females. 6 patients were in 51-60 years age group followed by 3 patients in 61-70 years age group. Significant improvement was seen in the physical domain at the end of radiotherapy course. Only 8 patients completed the questionnaire at 4, 8 and 12 weeks. 5 patients skipped the scheduled follow ups occassionally. Conclusion: There is a urgent need to devise a simple and validated tool for prognostication and to improve the quality of life. Intent of treating these patients should be according to patient directed goal of care.
|
v2
|
2022-11-25T06:17:28.972Z
|
2022-11-29T00:00:00.000Z
|
253838250
|
s2ag/train
|
[Correlation between Helicobacter pylori enrichment and clinical and pathological characteristics of colorectal adenoma].
Objective: Aim to observe the enrichment of Helicobacter pylori (Hp) in adenoma tissue of patients with colorectal adenoma and analyze its effect on the clinical and pathological characteristics of colorectal adenoma. Methods: The data of 1 622 cases of gastroenteroscopy in the Endoscopy Center of Wenzhou Integrated Traditional Chinese and Western Medicine Hospital Affiliated to Zhejiang University of Traditional Chinese Medicine from January 2019 to June 2021 were collected retrospectively. The general data, gastric HP infection, clinical and pathological features, HP methyl blue special staining, HP immunohistochemical staining and toll-like receptor5(TLR5) protein immunofluorescence of colorectal adenomas were compared between the colorectal adenoma group (743 cases) and the control group (879 cases). Results: There were 743 cases in the colorectal adenoma group, aged (54.5±12.3) years, and 56.0% were male. There were 879 cases in the control group, aged (55.6±12.1), and 58.4% were male. Gastric Hp was positive in 361 cases in the colorectal adenoma group with a positive rate of 48.6% and in 331 cases in the control group with a positive rate of 37.7%. The difference was statistically significant (P<0.001). Gastric HP infection significantly increased the risk of Hp enrichment in colorectal adenomas (OR=28.590;95%CI:18.554-44.055; P<0.001). At the same time, Hp enrichment in colorectal adenomas was the promoting factor of positive events in adenoma diameter, pathological adenoma type, and adenoma malignancy (RR=0.804,3.163,3.089,2.463, P<0.001). It was also found that the expression of TLR5 protein was increased in HP-enriched adenomas. Conclusion: There is a positive correlation between gastric HP infection and intestinal HP enrichment. The effect of intestinal HP enrichment on the clinical and pathological characteristics of colorectal adenoma is statistically significant, and its tumor-promoting effect may be related to the upregulation of mucosal TLR5 protein.
|
v2
|
2022-11-25T06:17:28.985Z
|
2022-11-29T00:00:00.000Z
|
253838171
|
s2ag/train
|
[Related factors and prognosis analysis of esophagorespiratory fistula after esophageal cancer surgery].
Objective: To explore the factors associated with the development of esophagorespiratory fistula (ERF) after esophageal cancer surgery and its relationship with patient survival. Methods: A total of 241 patients with esophageal cancer after surgery, who received postoperative sputum suction through bronchoscope from West China Hospital of Sichuan University between January and December 2021 were included. The clinical data and airway features under bronchoscope of these patients were collected. Of the 241 patients, 203 were males (84.2%) and 38 were females (15.8%), aged (63.63±8.05) years. The related factors of ERF were analyzed by multivariate logistic regression analysis, and Kaplan-meier was used to analyze the relationship between bronchoscopic specific manifestations, treatment modality and patient survival. Results: Of the 241 postoperative patients with esophageal cancer, 21 (8.7%) developed ERF. There were 39 (16.2%) patients with bronchoscopic specific manifestations, including 16 cases (6.6%) of hyperemia, 13 cases (5.4%) of congestion, and 15 cases (6.2%) of erosion. Bronchoscopic specific manifestations of tracheal mucosa (OR=13.734, 95%CI: 3.535-29.074, P<0.001) and thoracotomy (OR=9.121, 95%CI 1.843-44.237, P=0.007) were independent risk factors for the development of ERF, and preoperative chemotherapy (OR=0.128, 95%CI: 0.052-0.607, P=0.006) was a protective factor in the occurrence of ERF. The median survival time was 224 (95%CI: 95-353)d in the stent-treated group (14 patients) after the onset of ERF, and the median survival time of patients in the supportive care group (7 patients) was 29 (95%CI: 8-50)d, and the survival difference was statistically significant (χ2=5.69, P=0.017). Conclusions: Bronchoscopic specific manifestations are independent risk factors for the development of ERF in postoperative patients with esophageal cancer and are useful in assessing the risk of developing ERF. After the occurrence of postoperative ERF, timely intervention by insertion of tracheal stents to seal the fistula may prolong the survival time of the patients.
|
v2
|
2022-11-27T14:44:09.038Z
|
2022-11-26T00:00:00.000Z
|
253968196
|
s2orc/train
|
Hypercalcemia affected in metastatic breast cancer patients without bone metastasis: report of three cases
Background Since humoral hypercalcemia of malignancy (HHM) in breast cancer patients without bone metastasis is rare, the clinical features of this condition are not fully understood. Case presentation During the recent 12 years, 3602 patients were diagnosed with breast cancer in our institution, and only three patients developed HHM without bone metastasis. They were all recurrent breast cancer patients with visceral metastases including the lung and the liver. It took no more than 2 months since symptomatic onset to hospitalization because of hypercalcemia. The maximum serum calcium concentrations were 15.0 mg/dL or higher. All patients had symptoms related to hypercalcemia. Treatment of hypercalcemia including hydration, calcitonin, bisphosphonate, and diuretics was initially effective in the three patients. However, two of three cases were eventually fatal because of unsuccessful treatment of breast cancer. Conclusions The common features of HHM without bone metastasis in breast cancer patients include acute onset, severe symptomatic hypercalcemia, and presence of visceral metastasis. Treatment of hypercalcemia decreased serum calcium level in a short period, while successful treatment of breast cancer was essential for a long-term management of HHM. This report provides a consideration to help elucidate the pathophysiology and medical care of breast cancer patients with HHM without bone metastasis.
Background
Up to 30% of cancer patients experience hypercalcemia, which is a common complication [1] usually caused by parathyroid hormone-related protein (PTHrP)-induced humoral hypercalcemia of malignancy (HHM), local osteolytic hypercalcemia (LOH) associated with bone metastasis, or both. The overproduction or intoxication of 1,25-dihydroxy vitamin D and accompanying primary hyperparathyroidism is less common, but needs to be considered.
The leading cause of hypercalcemia associated with malignancy is HHM, which is accounted for up to 80% of hypercalcemia of malignancy [2]. HHM is induced by overproduction of PTHrP, a hormone similar to parathyroid hormone (PTH, encoded by the PTH gene), in tumor cells. PTHrP is a small protein encoded by PTHLH gene and increases the serum calcium level by acting on the bone and the kidney; PTHrP activates osteoblastic cells in the bone through PTH receptor 1 to promote bone resorption and promotes distal tubular calcium resorption in the kidney. This oncologic emergency rapidly progresses and eventually becomes fatal despite the availability of HHM treatments [3]. On the other hand, LOH occurs when tumor cells in the bone produce paracrine Open Access *Correspondence: [email protected] Department of Breast and Endocrine Surgery, Osaka University Graduate School of Medicine, 2-2-E10 Yamadaoka, Suita, Osaka 565-0871, Japan factors such as tumor necrosis factor (TNF) α and interleukin-1, which in turn hyperactivate osteoclasts and enhance bone resorption in patients with extensive bone metastasis.
In patients with metastatic breast cancer, LOH is the most prevalent cause of hypercalcemia, because almost all metastatic breast cancer patients with hypercalcemia have bone metastasis. HHM is frequently observed in patients with squamous cell carcinoma, renal cell carcinoma, and ovarian carcinoma, while breast cancer rarely (< 1%) manifests HHM without bone metastasis [4]. Therefore, HHM's clinicopathological features without bone metastasis in breast cancer patients are not fully understood. Here, we report three HHM cases with no bone metastasis among 3602 cases diagnosed with breast cancer treated in our institution. All 3602 cases were reviewed for bone metastases. Along with five cases reported previously, the common clinical pictures of HHM without bone metastasis in patients with breast cancer are discussed in the present report.
Case 1
A 43-year-old woman with right breast cancer T2N1M0 received nipple-sparing mastectomy and axillary lymph node dissection. The tumor was estrogen receptor (ER)positive and human epidermal growth factor receptor-2 (HER2)-positive. Recurrence in the preserved nipple occurred 10 years after the initial surgery, and local resection was performed. Three years later, recurrence was observed in the lung and the pleura. Chemotherapy induced clinical complete remission, but new liver metastasis appeared 1 year later. At that time, serum calcium mildly increased to 11.5 mg/dL, but then rapidly increased to 17.1 mg/dL after the administration of vinorelbine and trastuzumab as the seventh-line treatment. She developed nausea and altered mental status. No bone metastasis was found in the latest computed tomography (CT) scan. Serum PTH and PTHrP were 10.4 pg/mL and 153 pmol/L, respectively, indicating the presence of HHM. Zoledronate infusion, hydration and calcitonin administration were initially effective. Zoledronate was administered twice to continually control hypercalcemia after terminating calcitonin administration. Although serum calcium was controlled thereafter, she died of respiratory failure 4 months after the onset of HHM. The time course of serum calcium and CEA levels is shown in Fig. 1.
Case 2
A 39-year-old woman with right breast cancer T3N1M0 underwent mastectomy and axillary lymph node dissection, followed by chemotherapy, radiotherapy, and endocrine therapy. Her breast tumor was ER-positive and HER2-negative. Two years and 8 months after surgery, she suffered from recurrent breast cancer in the liver. After 4 years and 7 months since the recurrence, she started to receive paclitaxel and bevacizumab as the tenth-line treatment against metastatic breast cancer. Five months later, metastatic tumors in the liver rapidly progressed, and she developed mouth dryness and abdominal pain. As serum calcium rose to 15.5 mg/dL, she was hospitalized. Hydration, diuretics, and calcitonin administration followed by zoledronate administration improved serum calcium level to 10.9 mg/dL on the 7th day of hospitalization. She died of liver failure on the 18th day. Bone metastasis as well as parathyroid swelling was not observed in CT and positron emission tomography-CT scans, clinically suggesting the presence of HHM, though PTH and PTHrP were not measured. The time course of serum calcium and CA15-3 levels is shown in Fig. 1.
Case 3
A 60-year-old woman with right breast cancer T2N1M0 received lumpectomy and axillary lymph node dissection after neoadjuvant chemotherapy. Her breast tumor was ER-positive and HER2-negative. She underwent postoperative radiotherapy and endocrine therapy, but 1 year later, multiple lung and liver metastases occurred. Endocrine treatment and chemotherapy against metastatic breast cancer was continued for 4 years and 8 months. Pulmonary lesions disappeared after a short time since the treatment and did not relapse. During the fifth-line treatment with eribulin, serum calcium and tumor markers including CEA and CA15-3 gradually increased. Eribulin was discontinued and zoledronate was administered with significant serum calcium decrease. Then fluorouracil + epirubicin + cyclophosphamide was administered but did not alleviate the hypercalcemia. After repeat zoledronate administration, capecitabine was started as anticancer therapy. Two months later, hypercalcemic symptoms such as dry mouth and altered state of consciousness appeared. CT and positron emission tomography-CT scans revealed further exacerbation of liver metastasis. Bone was not affected. Serum calcium increased to 14.2 mg/dL, and PTHrP also increased to 16.7 pmol/L, indicating the presence of HHM. She was hospitalized and started to receive hydration and calcitonin injections followed by zoledronate administration. Symptoms gradually disappeared, but the serum calcium level was still as high as 13.8 mg/dL. Capecitabine was discontinued, and docetaxel administration once every 3 weeks began, which was effective in suppressing the hepatic lesions. In accordance with the reduction of tumor load, serum calcium level was also Good (surgery) Alive [9] decreased to the normal level without any treatments for hypercalcemia. The treatment with docetaxel is ongoing. The time course of serum calcium and CA15-3 is shown in Fig. 1.
Discussion
LOH can be sometimes encountered in patients with bone metastasis of breast cancer. The serum calcium level is often mildly elevated (10.5-11.9 mg/dL), and the patients are generally asymptomatic. Treatment of mild hypercalcemia is not required in many cases. Such mild clinical presentation of LOH may be because denosumab or zoledronic acid, both of which are a standard-of-care for hypercalcemia, has already been used to prevent pathologic fractures of the metastasized bones.
In contrast to LOH, HHM prevalence without bone metastasis is less than 1% in patients with metastatic breast cancer, and thus, the clinical picture and the response to treatment in breast cancer patients are not fully understood. Only three cases of HHM without bone metastasis were found among 3602 cases with breast cancer diagnosed in our institution between January 2010 and February 2022. In search of case reports on HHM in breast cancer patients, five cases have been reported so far, which, in addition to the present three cases, are summarized in Table 1 [5][6][7][8][9]. In those eight cases, hypercalcemia rapidly developed, and it was severe (≥ 14 mg/dL) and symptomatic. Such clinical course of the HHM without bone metastasis in breast cancer patients was similar to that of HHM induced by other types of cancer [3]. As severe hypercalcemia may become fatal, physicians need to monitor serum calcium in breast cancer patients with visceral metastasis, and prompt treatment of hypercalcemia is of great importance. Extensive visceral metastases including the lung and the liver were present in seven of the eight cases, which suggests that a high tumor burden is necessary to develop HHM without bone metastasis. HHM without bone metastasis in breast cancer patients is rare. The rare condition may be attributable to the property of PTHrP; PTHrP produced in breast cancer cells is associated with the development and progression of bone metastasis. The most important process in establishing bone metastasis is bone resorption induced by tumor cells. PTHrP secreted from breast cancer cells stimulates osteoblastic cells to upregulate receptor activator of NFκB ligand, which in turn promotes osteoclast formation, resulting in bone resorption [10]. The link between PTHrP and bone metastasis has been evidenced by experimental as well as clinical reports [11][12][13][14]. PTHrP is expressed in 60% of invasive breast tumors [15], suggesting that substantial proportion of hypercalcemia present in breast cancer patients with extensive bone metastasis, often recognized as LOH, is caused by multiple humoral factors including PTHrP, TNFα, and interleukins. Thus, it is plausible that HHM without bone metastasis is caused by the uncoupling of PTHrP-induced bone resorption and colonization of breast cancer cells in the bone. Elucidating the mechanism would help us develop a novel therapeutic approach preventing bone metastasis.
In accordance with HHM etiology, bone resorption inhibitors, such as calcitonin and bisphosphonates, are effective for HHM treatment. In addition, saline infusion for correcting dehydration and promoting calcium excretion is also important. Glucocorticoid helps reduce intestinal calcium absorption. These treatments are generally used in combination, which was the case in the eight cases of HHM without bone metastasis. The combination of those treatments was effective to rapidly decrease serum calcium level in patients with HHM without bone metastasis. For long-term control of serum calcium, treatment of breast cancer is essential. In the eight cases of HHM without bone metastasis, the favorable response to anticancer treatment led to the normalization of serum calcium for a long period. For example, in case 3, the treatment of HHM with bisphosphonate, hydration, and diuretics helped in the rapid decline of serum calcium, and the treatment of breast cancer with an anticancer drug, docetaxel, contributed to the sustained decrease in calcium concentration as shown in Fig. 1. To summarize, the multimodal therapy is of particular importance in the management of HHM without bone metastasis in breast cancer patients.
Conclusions
Although HHM without bone metastasis in breast cancer patients is rare, its clinical features are similar to those in patients with other cancer types. Because HHM without bone metastasis develops rapidly, calcium monitoring and prompt treatment of hypercalcemia is vital. Also, successful treatment of metastatic breast cancer is a key to the long-term control of serum calcium.
|
v2
|
2022-11-27T14:44:40.634Z
|
2022-11-26T00:00:00.000Z
|
253968174
|
s2orc/train
|
Proteomic and functional profiling of platelet-derived extracellular vesicles released under physiological or tumor-associated conditions
During hemostasis, thrombosis, and inflammation, activated blood platelets release extracellular vesicles (PEVs) that represent biological mediators of physiological and pathological processes. We have recently demonstrated that the activation of platelets by breast cancer cells is accompanied by a massive release of PEVs, evidence that matches with the observation that breast cancer patients display increased levels of circulating PEVs. A core concept in PEVs biology is that their nature, composition and biological function are strongly influenced by the conditions that induced their release. In this study we have performed a comparative characterization of PEVs released by platelets upon activation with thrombin, a potent thrombotic stimulus, and upon exposure to the breast cancer cell line MDA-MB-231. By nanoparticle tracking analysis and tandem mass spectrometry we have characterized the two populations of PEVs, showing that the thrombotic and tumoral stimuli produced vesicles that largely differ in protein composition. The bioinformatic analysis of the proteomic data led to the identification of signaling pathways that can be differently affected by the two PEVs population in target cells. Specifically, we have demonstrated that both thrombin- and cancer-cell-induced PEVs reduce the migration and potentiate Ca2+-induced apoptosis of Jurkat cells, but only thrombin-derived PEVs also potentiate cell necrosis. Our results demonstrate that stimulation of platelets by thrombotic or tumoral stimuli induces the release of PEVs with different protein composition that, in turn, may elicit selective biological responses in target cells.
INTRODUCTION
Platelets are anucleated blood cells primarily involved in hemostasis and thrombosis and are activated by adhesion molecules and soluble agonists. Platelet activation stimulates a complex array of signaling pathways, leading to platelet aggregation and blood clot formation [1]. These processes are accompanied by the release of extracellular vesicles (EVs), commonly defined as platelet-derived extracellular vesicles (PEVs), that are mediators of intercellular communication [2]. By delivering biologically active molecules to target cells, PEVs regulate several processes and are involved in the onset and progression of different pathological conditions [3]. In response to various stimuli, blood platelets release in the bloodstream a heterogenous population of PEVs mainly composed by plasma membrane-derived PEVs and exosomes [2]. PEVs generated by budding of the plasma membrane have a diameter ranging from 100 nm to 1 μm and are commonly referred to also as plateletderived microparticles (PMPs), platelet-derived microvesicles (PMVs), or medium-large PEVs. These medium/large PEVs (henceforth defined PEVs) incorporate proteins, lipids, and nucleic acids, and their specific composition is known to depend on the environmental conditions and the stimuli that induce their release [2].
A growing body of evidence suggests that PEVs are also important regulators of cancer progression and modulate key steps of the metastatic cascade [4,5]. Specifically, PEVs display the remarkable ability to bind tumor cells and to regulate their survival and intrinsic aggressiveness [6][7][8][9][10][11][12]. In previous studies, we have characterized the mechanism of platelet activation induced by breast cancer cells [13], and we have demonstrated that breast cancer cells can also induce the release of PEVs [7]. More recently, also colon cancer cells were shown to stimulate the generation of PEVs [14], suggesting that this ability may be a common feature of cancer cells. To date, nothing is known about the composition and function of PEVs released by platelets upon exposure to cancer cells, and whether they differ in any way from PEVs released in response to classical hemostatic/thrombotic stimuli.
In this study, PEVs released by platelets upon exposure to the breast adenocarcinoma cell line MDA-MB-231 or upon stimulation with thrombin were isolated and characterized through a proteomic approach to unravel specific differences in the cargo proteins associated with possible distinctive functional properties.
Analysis of PEVs size distribution
In this study, we characterized and compared two different populations of PEVs, named as follows: (1) PEVs-THR, released by platelets in response to the physiological stimulus thrombin; (2) PEVs-BCC, released by platelets in response to the incubation with the triple negative, highly aggressive breast cancer cell line MDA-MB-231.
The procedure for PEVs isolation (Fig. 1) was based on the strategy adopted in our previous investigations [6,7,12], and is detailed in the materials and methods section. The two populations of PEVs have been previously analyzed for their ability to stimulate the intrinsic aggressiveness of MDA-MB-231 cells [6,7,12] but they have not been characterized for their distinctive molecular signature.
The measurement of the size distribution of PEVs showed that both preparations contained heterogenous populations of vesicles with size ranging from 50 to 500 nm ( Fig. 2A). Data analysis revealed that both the mode and mean size of PEVs-THR and PEVs-BCC were similar (Fig. 2B). In both PEVs preparations most of the particles (about 60%) were in the 100-200 nm diameter range, whereas about 20% of PEVs had a size in the 200-300 nm range (Fig. 2C). The percentage of vesicles with a diameter higher than 300 nm was below 10% in both samples. Interestingly, a statistically significant difference between the two preparations of PEVs was observed for the smallest vesicles, with a diameter below 100 nm: the percentage of PEVs-THR falling in this subpopulation was clearly higher than that of PEVs-BCC (11.5% ± 1.49 vs 5.80% ± 2.25).
Comparative proteomic profiling of PEVs-THR and PEVs-BCC The protein content of the two populations of PEVs was analyzed upon in-solution digestion by liquid chromatography-tandem mass spectrometry. The list of proteins identified in the two PEVs samples analyzed is reported as supplementary material (Table S1). As shown in the Venn diagram reported in Fig. 3A, a total of 924 proteins were identified through this approach, of which 429 proteins found in both samples, 86 proteins exclusively present in the PEVs-THR, and 409 proteins detected only in the PEVs-BCC. It appears therefore that PEVs-BCC are more heterogeneous in protein composition than PEVs-THR. Platelet-derived proteins, such as integrin αIIb (ITA2B), integrin β3 (ITB3), and GPIbα (GP1BA), as well as the cytoskeletal proteins actin (ACTB) and tubulin (TBA1), were found in both PEVs preparations and their presence was confirmed by immunoblotting analysis. Also typical EVs markers such as the enzyme glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and the autophagosome component p62 [15,16], were found in both PEV-THR and PEV-BCC as also confirmed by immunoblotting (Fig. 3B). The presence of several proteins selectively found in one of the two PEVs preparations (marked in blue in Table S1) suggests that the mechanism of cargo selection for PEVs-THR and PEVs-BBC may be significantly different and may underlie radically different functional abilities. As
Quantitative MS analysis of PEVs-THR and PEVs-BCC
The ability of PEVs to regulate specific processes in target cells has been widely documented [6-9, 12, 17-19]. It is reasonable to hypothesize that the capacity of PEVs to control biological responses may depend on the delivery of proteins involved in the regulation of specific pathways. Since PEVs-THR and PEVs-BCC are remarkably different in protein composition, we further investigated their protein cargo by quantitative proteomic analysis. While qualitative analysis can provide a list of proteins identified in PEVs samples, label-free quantitative proteomics yields information about the functional differences between two biological samples. This approach allowed the comparison of the levels of proteins expressed in PEVs-THR and PEVs-BCC. A total of 34 proteins were found to be differentially expressed between the two PEVs samples (fold change > 1.3 and p-value < 0.05) (Fig. 4A). Light gray bars indicate proteins that are expressed at higher levels in PEVs-THR rather than PEVs-BCC, conversely dark gray bars indicate proteins that are more abundant in PEVs-BCC. The results from quantitative MS analysis were validated by immunoblotting, focusing on the proteins VASP and PAR4, which are detectable in both samples, but expressed at higher levels in PEVs-THR and PEVs-BCC, respectively (Fig. 4B).
Bioinformatic analysis of the expression profiles allowed us to associate specific groups of differently expressed proteins to predict functional pathways. Proteins involved in the regulation of leukocyte extravasation, integrin, and GPVI signaling, were found to be more abundant in PEVs-THR than in PEVs-BCC. Accordingly, these pathways were also predicted to be negatively regulated in PEVs-BCC versus PEV-THR (Fig. 4C, dark gray bars). At the same time, other pathways (light gray bars in Fig. 4C), such as ERK/MAPK signaling and Calcium-induced T Lymphocyte Apoptosis, were identified as significantly altered by PEVs, but here a prediction of regulation, inhibition or activation, was not possible based on the proteomic quantitative profile (Fig. 4C). A complete list of all the predicted pathways, potentially associated with the proteins quantified in PEVs, is reported in Supplementary Table S2.
PEVs in the regulation of leukocyte functions
In search of novel functional effects of PEVs, we chose to focus on their possible ability to regulate leukocyte function. In particular, the effects of PEVs-THR and PEVs-BCC on the regulation of leukocyte extravasation and calcium-induced T-cell apoptosis were investigated. As experimental cellular model, the immortalized human T-cell line Jurkat was selected, since these cells have been previously used to investigate leukocyte migration [20,21] and Ca 2+ -induced apoptosis [22,23].
By imaging flow cytometry experiments, we found that Jurkat cells efficiently interacted with PEVs upon 16 h incubation (Fig. 5A). Quantitative analysis revealed that PEVs-THR and PEVs-BCC displayed a comparable ability to bind to Jurkat cells (Fig. 5B).
To study leukocyte extravasation, a transwell assay with matrigel-coated membranes was adopted. This approach revealed that incubation with PEVs significantly reduced the chemotactic invasion of Jurkat cells through the extracellular matrix. Despite the different enrichment in proteins regulating the extravasation pathway, PEVs-THR and PEVs-BCC displayed a very similar effect on Jurkat cell migration (Fig. 5C). Conversely, EVs released by cancer cells in the absence of platelets (EVs-MDA-MB-231) did not influence Jurkat cell migration ( Supplementary Fig. 2).
We next investigated whether the interaction with PEVs could influence Ca 2+ -induced apoptosis in Jurkat T cells, as predictable from the informatic analysis of PEVs cargo. As reported in Fig. 6, the incubation of Jurkat cells with PEVs-THR or PEVs-BCC alone did not cause any significant increase of the percentage of apoptotic cells. As expected, stimulation with the Ca 2+ ionophore A23187 induced a remarkable apoptosis in Jurkat cells. The percentage of apoptotic cells significantly increased when stimulation of Jurkat cells with the Ca 2+ ionophore A23187 was performed in the presence of PEVs (Fig. 6B). Although PEVs-BCC appeared to display a more potent stimulation of apoptosis than PEV-THR, the statistical analysis revealed no significant differences between the two samples. The treatment with the Ca 2+ ionophore A23187 caused necrosis in about 10% of the Jurkat cells. Interestingly, Ca 2+ -induced T-cell necrosis was significantly potentiated in the presence of PEVs-THR but was not affected by PEVs-BCC (Fig. 6C). Therefore, both PEVs-THR and PEVs-BCC were able to stimulate Ca 2+ -induced apoptosis of Jurkat cells, but only PEVs-THR also potentiated cell necrosis.
DISCUSSION
In the present study, we have combined proteomic and cell biology approaches to provide a characterization of EVs released by platelets upon incubation with the triple negative cell line MDA-MB-231, in comparison with EVs released upon a thrombotic stimulus. Our results demonstrate a remarkable heterogeneity of the protein cargo in the two different types of PEVs, that is partially mirrored by differences in the ability to modulate leukocyte function.
PEVs are important regulators of cancer progression: by transferring bioactive molecules from platelets to cancer cells, PEVs modulate specific features of neoplastic cells and tumor microenvironment [4].
The majority of previous studies aimed to understand the functional effects of PEVs on target cells in the context of cancer, focused their attention on medium/large PEVs released in response to stimulation with common platelet agonists, such as thrombin and collagen [6,8,9,12,17,18]. We have previously demonstrated that cancer cells themselves can activate platelets and induce a massive release of PEVs [7]. This observation matches the notion that the levels of circulating medium/large PEVs are elevated in cancer patients [24][25][26][27], and indicates that Actin staining was performed as control for equal loading. C Gene ontology enrichment analysis of the PEVs proteins involved in the regulation of specific biological processes. The 20 pathways that, according to the bioinformatic analyses, displayed the most significant protein enrichment are reported. The dark gray bars indicate pathways that were predicted to be inhibited by PEVs-BCC compared to PEVs-THR, whereas light gray bars indicate processes that are likely to be modulated although no prediction was possible.
the direct interaction between platelets and circulating cancer cells may play an active role in the release of PEVs. Here we addressed the question whether these PEVs released upon activation by cancer cells are different from PEVs released upon platelet stimulation with physiological agonists in terms of protein cargo and functional properties.
A major conclusion of our study is that PEVs composition is significantly different, depending on the stimulus that induces their release. The proteomic profiling demonstrated that some proteins, including cytoskeletal proteins and typical plateletderived membrane receptors, are common between PEVs-THR and PEVs-BCC, but several others were found uniquely in one type of PEVs. PEVs-BCC are characterized by a more complex composition and more than 400 proteins detected in these vesicles, were not found in PEVs-THR. By a comparative analysis with previous data sets of platelet proteomic analyses [28], we found that the majority (about 75%) of the proteins exclusively detected in PEVs-BCC were expressed in platelets. This observation supports the concept that tumor cells are able to promote a specific sorting of selected proteins into released PEVs. About 25% of proteins found in PEVs-BCC were not previously detected in platelets, suggesting that some tumor cell proteins could be incorporated into the released PEVs, which may actually have a hybrid identity. It may be considered that the supernatant of platelets co-cultured with MDA-MB-231 cells could contain also vesicles originating from cancer cells, rather than from platelets. Fully addressing these aspects is a demanding task and goes beyond the goal of our current interest. However, we have previously demonstrated that platelets do not stimulate the release of EVs from co-cultured BCCs and that EVs recovered in the supernatant are exclusively of platelet origin [7]. Furthermore, proteomic analysis of vesicles spontaneously released by MDA-MB-231 cells (EVs-MDA-MB-231) revealed that relatively few proteins were in common with PEVs-BCC. Our analysis also identified proteins in PEVs-BCC, such as integrin alpha3 subunit and tissue factor, that are expressed in cancer cells but not in platelets [28], and that were not detected in EVs-MDA-MB-231. Based on these observations, it is reasonable to conclude that while cancer cells activate platelets inducing the release of PEVs, a feedback regulation exerted by platelets on MDA-MB-231 cells can promote the loading of some cancer-derived proteins into the released vesicles. Therefore, the proteomic composition of PEVs-BCC likely derives from a complex functional interplay between platelets and cancer cells, rather than being a simple mixture of two populations of distinct vesicles independently released by the two cell types.
Quantitative protein profiling coupled with bioinformatic analysis allowed us to identify functional pathways that could be potentially regulated by PEVs in target cells. Some of these signaling pathways, including MAPK/ERK pathway, have already been investigated in previous studies in target cancer cells [6,7].
In addition to interacting directly with cancer cells, platelets are known to regulate leukocytes [4,29], but the possible contribution of PEVs in this frame is poorly known. Here we focused our attention on two still unexplored pathways related to the regulation of leukocyte function, namely leukocyte extravasation and the Ca 2+ -induced apoptosis, using Jurkat cells as experimental cellular model.
Based on the presence of several proteins involved in leukocyte motility among the protein cargo of both types of PEVs we predicted that migration of Jurkat cells could be regulated by PEVs, as already observed for other cell types [6,9]. Our results indicated that Jurkat cells bind equally well PEVs-THR and PEV-BCC and that this interaction was associated to a reduced cell invasiveness. Moreover, despite the prediction by the bioinformatic analysis of potentially different effects of PEVs-THR and PEVs-BCC, they were equally efficient in reducing Jurkat cell mobility. The mechanisms supporting this effect deserve further investigations, although it may be hypothesized that the negative regulation of Jurkat cell migration is due to PEVs bioactive components different than proteins that remain to be identified and that are equally expressed in both types. However, the observation that PEVs alone did not cause significant apoptosis or necrosis of Jurkat cells (Fig. 6), ruled out the possibility that the reduced migration was consequent to reduced cell viability.
We also found that the physical interaction with PEVs sensitized Jurkat cells to Ca 2+ -induced apoptosis. To the best of our knowledge, this observation represents the first evidence that PEVs can regulate T-cell apoptosis and may have important implications in cancer progression. It can be hypothesized that, by activating platelets and inducing the release of PEVs, cancer cells could potentiate T-cell apoptosis as an additional mechanism of immune evasion. Once again, PEVs-THR and PEVs-BCC were similarly efficient in sensitizing Jurkat cells to Ca 2+ -induced apoptosis, although PEVs-BCC displayed a slightly stronger effect. However, only PEVs-THR but not PEVs-BCC potentiated Ca 2+induced cell necrosis. The bioinformatic analysis failed to identify the molecular signature that supports such a different behavior and no obvious explanation emerged from the critical analysis of the differential protein enrichment between the two populations of PEVs. We performed a preliminary analysis of the signaling pathways possibly regulated by PEVs in this context. Interestingly, co-culture of Jurkat cells with both populations of PEVs in the absence of Ca 2+ionophore was associated to the increase of Akt phosphorylation, but only PEVs-BCC caused a modest reduction of p38MAPK and ERK (p42/44 MAPK) phosphorylation. Upon treatment with A23187, the phosphorylation of all these proteins was strongly reduced independently of the presence of PEVs, likely as a consequence of major cell disruption associated with apoptosis ( Supplementary Fig. 3). These observations confirm that PEVs are able to perturbate Jurkat cell homeostasis, although the precise mechanism linking PEVs to Ca 2+ -induced apoptosis certainly deserves further investigation. Nonetheless, it was noted that PEVs-THR expressed significantly higher amounts of Fig. 6 Effect of PEVs on calcium-induced apoptosis in Jurkat cell. A Representative dot plots of Jurkat cell apoptosis analyzed by flow cytometry. The signal associated to propidium iodide (PI) and Annexin V-APC are reported on the y-and x-axis, respectively. B Quantification of apoptosis as the percentage of cells in the Q2 (late apoptosis) and Q3 (early apoptosis) quadrants. The data are representative of the mean ± SD of four independent experiments. The results of the statistical analysis of the differences between samples treated with A23187 (gray bars) and respective controls (white bars) are indicated by^^^(p < 0.0001). The statistical significance of the differences between PEVstreated samples and respective controls is indicated with the asterisks (*p < 0.05; ***p < 0.0001). C Quantification of necrotic cells as the percentage of cells in the Q1 quadrant. The data are representative of the mean ± SD of three independent experiments with *p < 0.05. The statistical significance between samples treated with A23187 (gray bars) and respective controls (white bars) are indicated by as^(p < 0.05) and^^(p < 0.001).
apoptosis-inducing factor mitochondria-associated 1 (AIFM1), which was previously associated to necrotic-like mechanisms of cell death [30] and may be involved in the potentiation of necrosis observed in our experiments. Moreover, it cannot be excluded that other classes of bioactive molecules delivered by the two PEVs populations could be responsible for the diverse effect on cell necrosis.
CONCLUSIONS
Our results indicate that tumor-cell-induced platelet activation leads to the generation of PEVs that are similar in quantity and size to those generated in response to a thrombotic stimulus, but that are characterized by a different protein cargo. We have identified two previously unknown effects of PEVs on leukocytes, demonstrating that, despite the different protein enrichment, PEVs-THR and PEVs-BCC inhibit Jurkat cell migration and potentiate Ca 2+induced apoptosis. Moreover, only PEVs-THR but not PEVs-BCC stimulate necrosis of Jurkat cells.
Altogether, these data represent a useful platform for further studies in search of still unknown functional effects of PEVs and open the way to new models in the platelet-cancer interplay.
Cell culture
MDA-MB-231 cells were cultured as previously described [6]. Jurkat cells were maintained in culture at a concentration between 1 × 10 5 and 1 × 10 6 viable cells/ml in RPMI supplemented with 10% FBS, 2 mM L-glutamine, 100U/ml penicillin, and 100 μg/ml streptomycin. The day of the experiment, cells were harvested, centrifuged at 120 × g for 10 min, and resuspended in the culture medium at the desired concentration.
PEVs isolation
Human blood platelets were purified from buffy coat bags as previously described [31]. Washed platelets were resuspended at the concentration of 3 × 10 8 /ml in HEPES buffer supplemented with 1 mM CaCl 2 , 0.5 mM MgCl 2 , and 5.5 mM glucose. To induce the release of PEVs, samples containing 5 ml of washed platelets were stimulated for 30 min at 37°C under constant stirring with 0.1 U/ml of thrombin or with MDA-MB-231 cells (5 × 10 4 cells/ml) in the presence of 0.05% v/v of autologous platelet poor plasma. As control, MDA-MB-231 cells were incubated under the same experimental conditions in the absence of platelets, to produce EVs of cancer cell origin.
Platelets and cells were pelleted by low-speed centrifugation (750 × g, 20 min) and the supernatant was then centrifuged at 20,000 × g for 90 min at 10°C to collect PEVs. PEVs were resuspended in 25 mM Tris/HCl, 0.1% SDS, pH 7.4 for proteomic analysis and in HEPES buffer for all the other experiments, and the protein content was determined by BCA protein assay kit.
In selected experiments, platelets were labeled with 3 μg/ml of CFSE for 10 min before stimulation, to obtain fluorescently labeled PEVs for the analysis of their interaction with Jurkat cells.
Nanoparticle tracking analysis
The concentration and dimension of purified PEVs were assessed by Nanoparticle Tracking Analysis (NTA) using NanoSight NS300 (Malvern Panalytical). The optimal dilution for the NTA analysis was determined and, for each sample, five videos of 60 sec were recorded and analyzed using NTA software (version 3.4; NanoSight Ltd.).
Immunoblotting
The analysis of proteins of PEVs was performed by immunoblotting, as described previously [32]. Membrane staining was performed using specific primary antibodies diluted 1:1000 in TBS (20 mM Tris, 500 mM NaCl, pH 7.5) containing 5% BSA and 0.1% Tween-20 in combination with the appropriate HRP-conjugated secondary antibodies (1:2000 in PBS plus 0.1% Tween-20). Acquisition of membrane images was performed by ChemiDoc XRS Imaging System (Bio-Rad).
Proteomic analysis
The proteomic analyses were performed as previously described [33,34], and the detailed protocol is available as supplementary file.
Analysis of PEVs interaction with Jurkat cells
Jurkat cells (10 6 cells/well) were seeded in a 24-well plate and incubated for 16 h with 30 μg/ml of PEVs obtained from stimulated CFSE-labeled platelets. Negative control samples were cultured under the same conditions in the absence of PEVs. Cells were subsequently collected by centrifugation at 700 × g for 7 min and washed once with PBS. Cells were then recovered by centrifugation, resuspended in PBS and eventually fixed with 0.5% of PFA for 15 min at room temperature in the dark. The interaction between PEVs and Jurkat cells was analyzed by flow cytometry (BD FACSLyric, BD Biosciences) and by imaging flow cytometry (Amnis ImageStream X Mark II, Merck Millipore).
Cell migration assay
The effect of PEVs on migration of Jurkat cells was evaluated using Falcon cell culture inserts (8 μm pore size) coated with 15 µg of Matrigel positioned in a 24-well plate [35]. Cells were resuspended in RPMI containing 0.5% FBS, and 10 6 cells were transferred into the inserts and either left untreated or treated with PEVs. RPMI containing 10% FBS was added to lower chamber as chemotactic stimulus. After 24 h, cells that moved in the lower chamber were collected and counted using a hemocytometer and Olympus CK40 microscope (Olympus Corporation, JPN).
Analysis of apoptosis
Jurkat cells (10 6 cell/well) were seeded in a 24-well plate and incubated for 24 h with 1 µM A23817 either in the absence, or in the presence of 30 μg/ ml PEVs. Appropriate untreated samples were prepared as control. After 24 h, cells were harvested, spun at 700 × g for 7 min, resuspended in PBS and counted. Cells (5 × 10 4 ) were transferred into a new tube and incubated with annexin V-APC/propidium iodide (PI) staining mix following the manufacturer's instructions. Samples were analyzed within 30 min using a BD FACSLyric cytometer (BD Biosciences). Apoptosis was expressed as the percentage of cells in Q2 and Q3 quadrants, which represent the cells in late and early apoptosis, respectively. Necrotic cells were quantified as PI-positive cells in the Q1 quadrant.
Statistical analysis
All the reported figures are representative of at least three different experiments and the quantitative data are reported as mean ± SD. Comparisons between two groups were done using Student t-test, whereas multiple comparisons were performed using one-way analysis of variance (ANOVA) with Bonferroni's post hoc test. p-value less than 0.05 was considered statistically significant. Data were analyzed using GraphPad Prism Version 8.0 software.
DATA AVAILABILITY
All data generated or analyzed during this study are included in this published article (and its supplementary information files).
|
v2
|
2022-11-28T16:14:16.402Z
|
2022-11-26T00:00:00.000Z
|
254033284
|
s2orc/train
|
A Model for Predicting Clinical Prognosis in Patients with WHO Grade 2 Glioma
Objectives Although patients with grade 2 glioma have a relatively better prognosis and longer survival than those with high-grade glioma, there are still a number of patients with disappointing outcomes. In order to accurately predict the prognosis of patients, relevant risk factors were included in the analysis to establish a clinical prediction model so as to provide a basis for clinically individualized treatment. Methods A retrospective study was conducted in patients diagnosed with grade 2 glioma. Data including clinical features, pathological type, molecular classification, neuroimaging examination, treatment, and survival were collected. The data sets were randomly assigned, with 80% of the data used for model building and 20% for validation. Cox proportional hazard regression analysis was used to construct the model using important risk factors and present it in the form of a nomogram. The nomogram was evaluated a using C-index and calibration chart. Results A total of 160 patients were enrolled in this analysis, including 128 in the training group and 32 in the validation group. In the training group, eight important risk factors including preoperative KPS, the first presenting symptom, the extent of resection, the gross tumor size, 1p19q, IDH, radiotherapy, and chemotherapy were identified to construct the model. The C-index of the training group and the validation group was 0.832 and 0.801, respectively, indicating that the model had good prediction ability. The calibration charts of the two groups were drawn respectively, which showed that the calibration line and the standard line had a good consistency, which suggested that the model-predicted risk had a good consistency with the actual risk. Conclusions Based on the data of our center, a nomogram prediction model with eight variables has been established as an off-the-rack tool and verified its accuracy, which can guide clinical work and provide consultation for patients.
Introduction
Adult-type difuse gliomas are the most common neurogenic tumor in adult primary brain tumors. Te 2016 edition of the World Health Organization (WHO) classifcation of central nervous system (CNS) tumors included molecular typing as the classifcation criteria for the frst time, which ended the classifcation mode that had relied solely on histopathology for nearly a century [1]. Te WHO grade 2 glioma accounts for 5% of all primary brain tumors [2]. Although patients with grade 2 glioma have a relatively better prognosis and longer survival than those with high-grade glioma, there are still a number of patients with disappointing outcomes. Such tumors bring great challenges to clinical management, which requires us to determine the best treatment strategy according to the specifc situation of each patient. Te premise for achieving this goal is to accurately predict the prognosis of patients, so it is particularly important to establish a prognostic prediction models for grade 2 glioma in this study.
As a reliable clinical tool, the nomogram has been widely used in clinical decision making, and it can help physicians predict survival, decide on individualized treatment plans and determine follow-up times [3]. Te most obvious advantages of nomogram are its accurate predictability, accessibility, and intuitiveness [4].
Terefore, the purpose of the study is to construct a validated nomogram that could predict the survival of patients with WHO grade 2 glioma using relevant clinical variables. All patient data evaluated in this study were from that institution.
Study Population.
Te study population was selected from adult patients with WHO grade 2 glioma confrmed by pathological fndings in our center from January 2010 to December 2019. We identify and document risk factors that infuence patient prognosis, including sex, age, preoperative Karnofsky Performance Status (KPS) score, frst presenting symptom, extent of resection, location of the tumor, gross tumor size, pathological type, 1p19q, IDH, radiotherapy, and chemotherapy. Patients enrolled in the criteria were randomly divided into the training group and the validation group in a ratio of 4 :1. Te training group was used to build the model, and the validation group was used to verify the model.
Operational Defnition.
Te KPS score is the most commonly used functional status rating scale for adults, and it is divided into 10 stages on a 100-point scale [5]. It was divided into two groups, including KPS scores ≥80 and <80 groups. Neurosurgeons assess tumor size and location based on brain MRI. Deep tumors were defned as those that were difcult to reach surgically. Postoperative residual tumor size was determined by postoperative MRI or contrastenhanced brain CT. Gross total resection was defned as complete resection of the tumor or the neurosurgeon's opinion that only <5% residual tumor was found on postoperative imaging. Nontotal resection was defned as a residual tumor of more than 5%. A biopsy was defned as a procedure that was performed only for pathological diagnosis and did not attempt to remove the tumor. Temozolomide was the chemotherapy regimen used in all our enrolled cases. Concurrent chemoradiotherapy is the main treatment option for most patients, including patients with partial resection or biopsy. A small number of patients choose chemotherapy alone or radiotherapy alone because they cannot tolerate high-intensity treatment, such as low KPS score and contraindication of chemoradiotherapy.
Te follow up was completed until December 2020 including death or survival and cause of death.
Statistical Analyses.
Te variables in the training group and the validation group were described, and the chi-square test was used for statistical analysis of the variables to compare whether the diferences were statistically signifcant. Kaplan-Meier survival analysis was used to calculate the 3-year and 5-year survival rates of patients and draw survival curves, which can intuitively show the infuence of various variables on the prognosis of patients. Ten, the logrank test was used to compare whether there was a statistical diference in the infuence of each variable on prognosis. In the training group, all risk factors identifed and collected were used as independent variables to conduct univariate cox regression analysis one by one. Te variables with P < 0.05 in univariate analysis were used as independent variables to enter multivariate cox regression analysis and identifed as independent risk factors. Te hazard ratio (HR) and 95% confdence interval (CI) were calculated. P values <0.05 were considered to indicate statistical signifcance.
Construction and Evaluation of the Models.
Te model is presented in the form of the nomogram. Use the nomogram function in the RMS package of the R language to draw the nomogram for predicting 3-year and 5-year survival using the variables screened out by deployment as independent risk factors. Certain variables are not screened out, but these variables were kept in the multivariable models due to clinical importance. Te validation group data will be used for external validation at nomogram to evaluate the performance of the model. Te C-index and calibration chart are reliable methods to verify the accuracy of nomograms. Te C-index function in R language is used to calculate the C-index value of the model. Te higher the number and the closer it is to 1, the better the prediction ability of the model. Ten, the calibration chart is drawn, and the better the coincidence between the calibration line and the standard line, the better the prediction ability of the model.
Patient Baseline Characteristics.
A total of 160 patients were enrolled in this analysis, including 128 in the training group and 32 in the validation group. Te clinical data of all patients were stratifed according to the designated set. Tere were no statistically signifcant diferences in clinical baseline characteristics between the training group and the validation group (see Table 1).
Survival Analyses.
Te median follow-up time of patients was 37 months, and Kaplan-Meier survival analysis showed that the 3-year and 5-year survival rates were 80.9% and 57.4%, respectively, with a median survival of 71 months. Te log-rank test showed that preoperative KPS, frst presenting symptom, extent of resection, location of the tumor, gross tumor size, radiotherapy, and IDH were correlated with survival prognosis and that the survival difference was statistically signifcant (see Figure 1).
Univariate and Multivariate Analyses.
In the training group, cox proportional hazard regression analysis was used for univariate and multivariate analyses (see Table 2). Univariate analyses revealed that preoperative KPS, the frst presenting symptom, the extent of resection, the location of the tumor, the gross tumor size, the IDH, and radiotherapy signifcantly afected overall survival (see Figure 2). Ten, these variables were treated as independent variables to enter multivariate cox regression analysis. Finally, multivariate analysis showed that preoperative KPS, the frst presenting symptom, the extent of resection, and the gross tumor size were four independent prognostic factors (see Figure 3).
Nomogram Construction.
Four independent prognostic factors selected by multivariate analysis were used as the predictors. Molecular typing and treatment were not found to be statistically signifcant, but these variables were kept in the multivariable models due to their clinical importance. Ultimately, eight prognostic factors were used to construct the model and present it in the form of the nomogram (see Figure 4). In the nomogram, diferent scores are given according to the status of each factor, and then, all scores are added to get a total score, and the corresponding 3-year or 5year survival rate is obtained based on the total score. Te nomogram shows that preoperative KPS has the strongest correlation with prognosis. Te survival rate of each patient can be easily and intuitively calculated by the cumulative scores of each variable (see Table 3).
Nomogram Validation.
Te internal validation using the nomogram to predict survival had a C-index of 0.832 (95% CI: 0.786-0.872), and the external validation of the validation group data applied to the nomogram had a Cindex of 0.801 (95% CI: 0.735-0.912). Te results show that the model has a good performance in prediction. Whether it is internal validation or external validation, as can be seen from the calibration chart, the actual prediction curve of the model has a high degree of coincidence with the validation curve, indicating a high degree of consistency between the predicted risk and the actual risk, and the actual observed values and predicted values of the nomogram show good consistency in both the training group and the verifcation group (see Figure 5).
Discussion
Due to the large heterogeneity and the large diference in prognosis and survival time of grade 2 glioma, it is of great signifcance to predict the survival and prognosis of this type of glioma for clinical diagnosis and treatment. With the development of various clinical studies and the support of high-level clinical evidence, especially the clinical application of tumor molecular typing, the development of personalized diagnosis and treatment has provided a strong impetus. As a graphical scoring tool, the nomogram is often used in various statistical prediction models. It can calculate the probability of survival according to the individual characteristics of patients, and it has become an important part of modern medicine [4]. Te study collected clinical data from 160 patients with grade 2 glioma, screened predictors by cox proportional hazard regression analysis and deployment, and then developed a clinical nomogram. It can predict survival rates based on the clinical characteristics of patients and have been proven to have good predictive accuracy.
Te present nomogram consists of 8 prognostic factors: preoperative KPS, the frst presenting symptom, the extent of resection, the gross tumor size, 1p19q, IDH, chemotherapy, and radiotherapy. Good preoperative functional status, seizures as the main initial symptoms, small tumor size, complete resection of the tumor, 1p19q-codeleted, IDH mutant, postoperative efective radiotherapy, and chemotherapy were associated with improved survival for patients with grade 2 glioma. Te nomogram revealed that preoperative KPS was most strongly associated with the prognosis. After tumor diagnosis, the patient's functional status is the primary consideration for clinicians to decide which treatment method to take. Te KPS score is a scale for evaluating functional impairment. Te lower the score, the worse the quality of life, and the less likely it is to be treated aggressively, and thus, afect the patient's prognosis.
Te grade 2 glioma is the main type of low-grade glioma (LGG). Symptoms of LGG vary depending on the location and size of the tumor, mainly due to the mass efect [6]. Seizure is the most common clinical symptom, occurring in more than 90% of LGG patients at some stage of the disease, mostly in the frontal lobe of patients with oligodendroglioma [7]. In the largest retrospective study published by Pallud et al. seizure was found to be an independent predictor of overall survival [8], which is consistent with our fndings. Seizure at the onset in LGG patients predict the possibility of continuous occurrence of postoperative seizure and are related to prognosis. In patients with intact nervous system, manifestations associated with seizure are related to better prognosis, which may be related to early diagnosis of patients by timely medical treatment. Te occurrence of headache, paresthesia, and other nonepileptic symptoms are often easily ignored by patients.
Total tumor resection can minimize tumor load, reduce the risk of transition to higher-grade gliomas, and improve the efcacy of subsequent adjuvant therapy [9]. However, it is difcult to make a defnitive diagnosis if a small excision or biopsy is performed [10]. A large number of studies suggest that the excision range has a positive efect on the natural history of the disease, signifcantly delays the time to malignant Journal of Oncology 5 progression, and is an independent predictor of survival regardless of age, preoperative tumor volume, and functional status [11,12].
Surgery has always been a focus in the treatment of grade 2 gliomas [13]. If the tumor volume is large, it is easy to damage important functional areas during surgical resection and cause new neurological dysfunction, thus reducing the surgeon's willingness to perform radical resection of such tumors. Terefore, for patients with large tumors, the surgical resection scope needs to be weighed, and sometimes it is difcult to achieve radical resection, thus afecting the prognosis of patients [14]. Te national comprehensive cancer network guidelines have identifed tumor size as an important independent prognostic factor, and our study confrmed that tumor size ≥6 cm is a negative prognostic factor.
For high-risk patients with grade 2 glioma, tumor recurrence or progression may occur even after total surgical resection, thus, adjuvant therapy with radiotherapy and chemotherapy is required. Radiotherapy for patients with grade 2 gliomas has been controversial. Te European Organization for Research and Treatment of Cancer 22845 trial observed the efcacy of postoperative radiotherapy with LGG [15]. Te study set up the early postoperative treatment group and the advanced postoperative treatment group, and the results showed that the diference in median progression-free survival (PFS) between early radiotherapy and delayed radiotherapy was statistically signifcant, while the diference in median overall survival (OS) was not statistically signifcant. Terefore, it is recommended that radiotherapy should be performed after disease progression for low-risk patients, while early radiotherapy should be considered for high-risk patients. Although the results showed that radiotherapy alone did not prolong the OS, but had some efcacy in alleviating edema, intracranial pressure, and symptoms of focal neurological defcits.
Te Radiation Terapy Oncology Group 9802 trial is one of the frst to evaluate radiotherapy combined with chemotherapy for high-risk LGG [16]. Te results showed that the addition of chemotherapy to radiotherapy had a better OS and PFS and a lower risk of recurrence compared with radiotherapy alone. Temozolomide has been widely used in clinical practice due to its oral administration, low toxicity, [17][18][19][20], so it is necessary to screen patients rationally, and the high-risk predictors in our study can provide a reference. In our study, the diference in prognosis between patients receiving adjuvant therapy and those not receiving adjuvant therapies did not reach statistical signifcance, which may be caused by the inclusion of some low-risk postoperative patients due to the year limitation. Molecular phenotypes even outweigh histopathology in the new classifcation of CNS tumors, largely due to the mutated status of IDH. At the same time, most studies have shown that LGG patients with the IDH mutation have a better prognosis [21,22]. Based on this, the defnitive guidelines have clearly indicated that IDH is an important indicator for the molecular typing of gliomas. Our study also confrmed that IDH mutation status is a risk factor for grade 2 glioma. Terefore, it is recommended that patients with grade 2 glioma should be tested for IDH status after surgery to guide subsequent treatment. Studies have shown that oligodendroglioma patients characterized by an IDH mutation and 1p19q-codeleted have a better prognosis than astrocytoma patients [23,24]. Terefore, detection of 1p19qcodeleted is of great signifcance in the diagnosis of oligodendroglioma and the prognosis of patients. Compared with patients with 1p19q not codeleted, patients with the IDH mutation combined with 1p19q-codeleted have the best prognosis.
Te survival of grade 2 glioma was afected by many factors. Te model constructed in this study manages these risk factors in a unifed manner, allowing clinicians to calculate the survival probability of patients conveniently and quickly, thus guiding further treatment. Te validity of the model has been verifed by identifcation and correction. Finally, this study still has some limitations. As a retrospective study, the infuence of bias and confounding factors cannot be completely excluded. Multivariate analysis was used to adjust and solve this limitation as much as possible [25]
Conclusions
Based on the data of our center, a nomogram prediction model with eight variables has been established as an ofthe-rack tool and verifed its accuracy, which can guide clinical work and provide consultation for patients.
Data Availability
Te data used to support the fndings of this study are available from the corresponding authors upon request.
|
v2
|
2022-11-29T16:12:18.808Z
|
2022-11-26T00:00:00.000Z
|
254064649
|
s2ag/train
|
A Study of Cyclin D1, E-cadherin, EGFR, HER- 2, Ki67, and p53 Tumor Marker Expressions in Neoplastic and Non -neoplastic Gall Bladder Lesions and their Clinico-pathological Correlation
Background: Worldwide gall bladder cancer (GBC) is known to be the commonest malignant tumour of the biliary tract. It is the most aggressive carcinoma of the biliary tract with short median survival from the time of diagnosis. The aggressive biologic behaviour of the carcinoma and non-availability of sensitive screening tests for early detection may be responsible for the poor prognosis associated with GBC.
Material and Methods: Patients diagnosed with neoplastic and non-neoplastic gallbladder lesions in the Department of Pathology, Subharti Medical College in India were included in the study. Gall bladder biopsies findings and the clinic-pathological data were compiled and different immune-markers diagnostic and therapeutic usefulness were studied .
Results: 24 (24.0%) of the cases were in the age group of 51-60 Years. In 38 (38.0%) of the cases the site of lesion was Fundus. 55 (55.0%) of cases had associated stones. 36 (36.0%) of them had P53: strong over expression, 40 (40.0%) of the them had ki67: strong over expression, 25 (25.0%) had EGFR: strong over expression whereas negative expression for Her2/Neu was found in 61 (61.0%) of the cases. Cyclin D1: moderate over expression was found in 27 (27.0%) of them and moderate over expression of E-cadherin were found in 22 (23.2%) cases.
Conclusions: Novel prognostic biomarkers could bring about the needed breakthrough in gall bladder cancer diagnosis and treatment. We conclude that the biomarkers studied by us may help in the identification of cases who may benefit tremendously from adjuvant and targeted therapies.
Key words: Cyclin D1, E-cadherin, EGFR, HER- 2, Ki67, p53, tumour marker, neoplastic , non –neoplastic, Gall bladder lesions.
|
v2
|
2022-11-30T15:07:14.477Z
|
2022-11-26T00:00:00.000Z
|
254072628
|
s2orc/train
|
Targeting uridine–cytidine kinase 2 induced cell cycle arrest through dual mechanism and could improve the immune response of hepatocellular carcinoma
Background Pyrimidine metabolism is critical for tumour progression. Uridine–cytidine kinase 2 (UCK2), a key regulator of pyrimidine metabolism, is elevated during hepatocellular carcinoma (HCC) development and exhibits carcinogenic effects. However, the key mechanism of UCK2 promoting HCC and the therapeutic value of UCK2 are still undefined. The aim of this study is to investigate the potential of UCK2 as a therapeutic target for HCC. Methods Gene expression matrices were obtained from public databases. RNA-seq, co-immunoprecipitation and RNA-binding protein immunoprecipitation were used to determine the mechanism of UCK2 promoting HCC. Immune cell infiltration level and immune-related functional scores were evaluated to assess the link between tumour microenvironment and UCK2. Results In HCC, the expression of UCK2 was upregulated in part by TGFβ1 stimulation. UCK2 promoted cell cycle progression of HCC by preventing the degradation of mTOR protein and maintaining the stability of PDPK1 mRNA. We also identified UCK2 as a novel RNA-binding protein. Downregulation of UCK2 induced cell cycle arrest and activated the TNFα/NFκB signalling pathway-related senescence-associated secretory phenotype to modify the tumour microenvironment. Additionally, UCK2 was a biomarker of the immunosuppressive microenvironment. Downregulated UCK2 induced a secretory phenotype, which could improve the microenvironment, and decreased UCK2 remodelling metabolism could lower the resistance of tumour cells to T-cell-mediated killing. Conclusions Targeting UCK2 inhibits HCC progression and could improve the response to immunotherapy in patients with HCC. Our study suggests that UCK2 could be an ideal target for HCC. Supplementary Information The online version contains supplementary material available at 10.1186/s11658-022-00403-y.
Background
Hepatocellular carcinoma (HCC) is the fourth leading cause of cancer-related mortality, and its incidence is increasing worldwide [1]. The most common causes of HCC are chronic hepatitis B virus and hepatitis C virus infection [2]. On the basis of proteomic profiling, patients with HCC can be divided into three subgroups that show distinct molecular features in metabolic reprogramming, microenvironment dysregulation and cell proliferation [3]. A previous study demonstrated that dysregulation of metabolic genes promotes HCC proliferation by regulating the cell cycle, suggesting the existence of a regulatory network [4].
Pyrimidine metabolism is critical for DNA replication, RNA synthesis and cellular bioenergetics as well as for cancer cells to maintain uncontrolled tumour growth by continuously supplying dNTPs [5,6]. In addition, pyrimidine metabolites can induce epithelial to mesenchymal transition to promote tumour metastasis, playing a non-proliferative role in pyrimidine metabolism in cancer [7]. Uridine-cytidine kinase 2 (UCK2), a key regulator of pyrimidine metabolism, catalyses the phosphorylation of uridine and cytidine to form uridine monophosphate and cytidine monophosphate [8]. UCK2 is frequently upregulated in various tumour types and serves as an indicator of poor prognosis [9][10][11]. High levels of UCK2 promote cancer cell proliferation and metastasis by activating the Wnt/β-catenin and EGFR-AKT signalling pathways [12,13].
Previous studies have shown the oncogenic role of UCK2 in the progression of HCC. However, the link between UCK2 and tumour microenvironment has not been investigated. In the present study, we found that knockdown of UCK2 induced cell cycle arrest through dual mechanisms in HCC and that targeting UCK2 promoted the secretory features involved in the senescence-associated secretory phenotype (SASP) and inflammasomes. Senescence is a cellular state in cells undergoing cell cycle arrest; these cells can remain metabolically active, resulting in the secretion of pro-inflammatory factors to result in SASP [14]. Both SASP and inflammasomes exhibit tumour-promoting and tumour-suppressive roles, which is determined by the cell type, tissue of origin and primary cellular stressor [14][15][16]. Secretory factors, such as interleukin 1A (IL1A), IL1B, IL18, CXCL10, tumour necrosis factor α (TNFα) and intracellular adhesion molecule 1 (ICAM1), are involved in natural killer (NK) cell recruitment, proliferation and activation [17]. In addition, downregulation of UCK2 increases the expression of major histocompatibility complex (MHC) I, which sensitizes cancer cells to T-cell-dependent killing [18]. In the present study, we aimed to explore the mechanism of UCK2 promoting HCC and the potential therapeutic value.
Clinical specimens and cell lines
The Cancer Genome Atlas Liver Hepatocellular Carcinoma (TCGA-LIHC), Gene Expression Omnibus and International Cancer Genome Consortium datasets were acquired from the SangerBox platform (http:// vip. sange rbox. com/). Tissue microarray chips (164 tissue dots, including 78 tumour dots for further analysis) were obtained from Shanghai Outdo Biotech Company (Shanghai, China). The ethics committee of the Second Affiliated Hospital of Harbin Medical University approved this study protocol.
Lentivirus, stable cell line construction and quantitative real-time PCR
The lentiviral vector system and empty vector were purchased from GeneChem Corporation (Shanghai, China). Stable cell lines expressing the target gene or negative control were selected by adding 0.5 μg/mL puromycin into the medium. Total RNA was extracted and quantified according to the protocol of the RNA purification kit (Thermo Fisher Scientific, Waltham, MA, USA). Quantitative real-time PCR was performed using SYBR Green Power Master Mix (Promega, Madison, WI, USA). The following primers were used for quantitative reverse-transcription PCR: UCK2 forward: 5′-GCC CTT CCT TAT AGG CGT CAG-3′; UCK2 reverse: 5′-CTT CTG GCG ATA GTC CAC CTC-3′; GAPDH forward: 5′-AGA AGG CTG GGG CTC ATT TG-3′, GAPDH reverse: 5′-AGG GGC CAT CCA CAG TCT TC-3′.
HCC stem cell detection, cell proliferation and cell cycle assay
To evaluate HCC stem cell characteristics, 1000 cells were seeded into 24-well plates pre-treated with the CSwell 600 kit (Suzhou Jiyan Biotech Co., Ltd., Jinang City, China). After 24 h, the number of cell spheres was counted under a microscope. To examine cell proliferation, the cells were seeded into 96-well plates at 2 × 10 3 cells per well, and cell viability was measured using Cell Counting Kit-8 assays (Dojindo Molecular Technologies, Kumamoto, Japan) at different timepoints. For cell cycle tests, 4 × 10 4 cells were stained according to the protocol of the Cycle TESTTM PLUS DNA Reagent Kit (BD Biosciences, Franklin Lakes, NJ, USA) and analysed using flow cytometry (FC500, Beckman Coulter, Brea, CA, USA).
Transwell assay
The migration and invasion of HCC cells were evaluated in Transwell assays. Chambers with or without pre-coated Matrigel were placed in a 24-well plate. DMEM supplemented with 10% FBS was added to the lower chamber. Cells (5 × 10 4 ) suspended in 100 µL of DMEM without FBS were seeded into the upper chamber and cultured for 24 h.
Western blotting and co-immunoprecipitation (co-IP)
Cells were lysed in radioimmunoprecipitation assay buffer containing protease and phosphatase inhibitors. The proteins were separated by sodium dodecyl sulphate polyacrylamide gel electrophoresis and transferred onto polyvinylidene fluoride membranes. After blocking with 5% skimmed milk at room temperature for 1 h, the membranes were incubated with primary antibodies overnight. The primary and secondary antibodies are listed in Additional file 5: Table S1. The membranes were then incubated with secondary antibodies for 1 h at room temperature, and the bands were detected using an enhanced chemiluminescence kit. For co-immunoprecipitation, the cells were incubated with pre-cold immunoprecipitation (IP) lysis buffer for 5 min and then transferred into a 1.5 mL tube for centrifugation at 13,000g for 10 min. The supernatant was collected, and the IP process was performed according to the protocol of the A Dynabeads protein G IP Kit (Thermo Fisher Scientific). Western blotting was performed as described above.
Immunofluorescence (IF) assays
The cells were seeded onto coverslips in six-well plates and incubated for 24 h. The cells were fixed with 4% paraformaldehyde and penetrated with 0.1% Triton-X-100. After incubation with the primary antibody for ICAM1 (ab222736, ABCAM), secondary antibody (Invitrogen, Carlsbad, CA, USA), and DAPI (Vector Laboratories) in sequence, images of the cells were acquired using a DMRA fluorescence microscope (20×, Olympus, Tokyo, Japan).
RNA-binding protein immunoprecipitation (RIP)
The cells were lysed using RIP assay buffer. The cell lysates were incubated with beads that had been pre-coated overnight with an antibody for UCK2 (ab241281, ABCAM). RNA was extracted from the samples according to the protocol of the RIP kit (Millipore, Billerica, MA, USA). Quality control and RIP sequencing were performed by GeneChem Corporation.
Determination of immune cell infiltration level and immune-related functional scores
Information on pan-cancer immune cell infiltration was obtained from TISIDB, an integrated repository portal for tumour-immune system interactions [19]. Using the CIBFERSORT database, we identified 22 immune cell types. The immune score, stromal score and tumour purity were generated using the R package "ESTIMATE". Tumour immune dysfunction and exclusion (TIDE) and immunophenoscore analyses were performed as previously described [20,21].
Statistical analysis
The correlation of gene expression and the survival of patients with HCC was determined using Lasso-Cox analysis with R package "glmnet". Student's t-test was used for comparisons between the two groups. Pearson's correlation analysis was used to determine the linear relationship between the two groups. Multivariate analysis was performed using the Cox regression model. Kaplan-Meier curves were used to compare Histological score = proportion score × intensity score.
survival, and the log-rank test was used to compare survival between different groups. The results were considered as significant when p < 0.05.
UCK2 was upregulated in HCC and involved in tumour stemness
Pyrimidine metabolism is critical for tumour proliferation. To identify an ideal target involved in pyrimidine metabolism for treating HCC, we compared gene expression between 50 pairs of HCC and adjacent tissues. Gene expression data were obtained from TCGA-LIHC dataset. Eleven genes related to pyrimidine metabolism were significantly dysregulated during HCC development (Fig. 1A). Eleven candidates were filtered using Lasso-Cox regression analysis. The results revealed that UCK2, DTYMK and TYMS were independent indicators of HCC prognosis (Fig. 1B, C). TYMS indicated a favourable prognosis, whereas UCK2 and DTYMK indicated unfavourable prognosis (Fig. 1C). Compared with DTYMK, upregulation of UCK2 in HCC was detected in a larger number of individual studies, and UCK2 was more specific for HCC (Fig. 1D, Additional file 1: Fig. S1A). Patients with higher levels of UCK2 predicted to have poor prognosis was also detected in individual studies (Additional file 1: Fig. S1B). UCK2 expression gradually increased during HCC development (Fig. 1E). Gene set enrichment analysis (GSEA) suggested that oncogenic signalling pathways, including the mTORC1, P13K/AKT, Wnt/β-catenin, NOTCH and TGFβ signalling pathways, were enriched in patients with higher levels of UCK2 (Fig. 1F). These pathways are also involved in tumour stemness. A relationship between the gene expression of UCK2 and tumour stemness features was detected on the basis of gene expression data from TCGA-LIHC dataset. Six tumour stemness signatures were constructed, including including RNA expression-based (RNAss), epigenetically regulated RNA expression-based (EREG.EXPss), DNA methylation-based (DNAss), epigenetically regulated DNA methylation-based (EREG-METHss), differentially methylated probes-based (DMPss) and enhancer elements/DNA methylation-based (ENHss), differentially methylated probe-based, and enhancer elements/DNA methylation-based signatures. Gene expression of UCK2 was strongly related to the RNAss signature, suggesting that UCK2 is involved in the transcriptional regulation of tumour stemness (Fig. 1G). Decreased UCK2 significantly inhibited sphere formation of HCCLM3 cells (Fig. 1H). These results demonstrate that upregulated UCK2 is involved in stemness during HCC development.
UCK2 was elevated by TGFβ signalling pathway
However, the mechanism of UCK2 upregulation in cancer remains unclear. A recent study showed that expression of the UCK2 gene in HCC was negatively correlated with its DNA methylation level [8]. In addition, the gene expression of UCK2 was significantly positively correlated with all four DNA methylation transferases in different tumour types (Additional file 2: Fig. S2A). Demethylation by 5-azacytidine-2′-deoxycytidine in the HCCLM3 and Hep3B cell lines increased the expression of UCK2 (Additional file 2: Fig. S2B). These results indicate that UCK2 is regulated by epigenetic modifications in HCC. UCK2 expression was also elevated following copy number amplification, and rare mutations were detected in the UCK2 genome in HCC (Fig. 2A). The GSEA results suggested that upregulation of UCK2 in HCC is associated with extracellular stimuli (Fig. 2B). Here, we found that UCK2 was increased in the HCCLM3 and Hep3B cell lines following TGFβ1 stimulation (Fig. 2C, D). The expression of UCK2 was also positively correlated with that of TGFβ1 in TCGA-LIHC dataset (Fig. 2E). Downregulation of UCK2 attenuated the pro-tumorigenic effect of TGFβ1 (Fig. 2F-I). The knockdown efficiency of UCK2 by lentivirus was detected using quantitative real-time PCR (Additional file 2: Fig. S2C). We found that downregulated UCK2 decreased the expression of SULF2 (Additional file 2: Fig. S2D), which can promote the release of pro-angiogenic factors, including TGFβ1, from the cell surface or extracellular matrix [22]. UCK2 was also positively correlated with regulatory T cells, which are among the major sources of TGFβ1 (Additional file 2: Fig. S2E). These results reveal that UCK2 was upregulated by TGFβ1 and formed a feedback loop via SULF2.
Overview of UCK2 in human cancers
Considering the results of UCK2-related cancer research, we assessed the expression of UCK2 in 32 tumours, including HCC. The prognostic value of UCK2 expression for overall survival (OS) and disease-free survival (DFS) was validated in TCGA cohort using Cox regression analysis. UCK2 served as a poor prognostic biomarker for both OS and DFS in several tumour types (Fig. 3A). The GSEA results showed that gene sets related to the cell cycle and mTORC1 signalling pathway were enriched in patients with high levels of UCK2, suggesting a role for UCK2 in tumour progression (Fig. 3B). UCK2 was positively correlated with the tumour mutation burden (TMB) and microsatellite Fig. 2 UCK2 was elevated by TGFβ signalling pathway. A Gene expression of UCK2 with the copy number variation. B GSEA analysis revealed that gene expression of UCK2 was associated with extracellular stimuli. C, D 10 ng and 20 ng TGFβ1 were added to HCCLM3 and Hep3B cell lines, respectively; the gene expression of UCK2 was detected in different timepoints using qPCR. E Correlation between gene expression of UCK2 and TGFβ1. F, H CCK8 assays was used to determine the proliferation of the indicated cell lines and the value of OD450 was related to control. G, I The migration and invasion abilities of the indicated cell lines were detected by Transwell assays in the left panel, and the statistical analysis is presented in the right panel. *p < 0.05; **p < 0.01; ***p < 0.001; ****p < 0.0001 instability (MSI), which favoured the infiltration of immune effector cells and antitumour immune response (Fig. 3C). However, UCK2 was negatively correlated with the infiltration of immune effector cells in most tumour types (Fig. 3D).
UCK2 promoted cell cycle progression via regulating the expression of mTOR
mRNA sequencing was performed to further explore the role of UCK2 in HCC progression. Differentially expressed genes were filtered and enriched in signalling pathways (Fig. 4A, B). The results showed that downregulation of UCK2 decreased the expression of genes related to the cell cycle and mTOR signalling pathway (Fig. 4B). Knockdown of Fig. 3 Overview of UCK2 in human cancers. A Univariate Cox regression analysis estimating the prognostic value of UCK2 in different cancer types from TCGA database. B GSEA analysis revealed the signalling pathways of KEGG and Hallmark terms related to UCK2 in pan-cancer. C Correlation of UCK2 with TMB and MSI in different tumour types. D The correlation of UCK2 with immune cell infiltrating in different tumour types. *p < 0.05; **p < 0.01; ***p < 0.001; ****p < 0.0001 UCK2 suppressed the expression of genes related to ribosome biogenesis, which is regulated by the mTORC1 signalling pathway (Fig. 4C). Downregulation of UCK2 decreased the expression of both pmTOR and total mTOR (Fig. 4D). The co-immunoprecipitation results showed that UCK2 directly interacted with mTOR (Fig. 4E). Immunohistochemical staining indicated a positive correlation between UCK2 and mTOR protein expression (Fig. 4F). Inhibiting the mTOR signalling pathway by rapamycin attenuated the tumour-promoting effect of UCK2 (Fig. 4G). Upregulation of UCK2 promoted cell cycle progression in HCC, inhibiting the mTOR signalling pathway impeded this effect (Fig. 4H). These data indicate that UCK2 promotes cell cycle progression by regulating the expression of mTOR, which plays a non-metabolic role.
UCK2 accelerated cell cycle progression by maintaining the stability of PDPK1 mRNA
UCK2 is pivotal in pyrimidine metabolism and activation of cytotoxic nucleoside analogues [23]. Under certain conditions, UCK2 shuttles between the nucleus and cytoplasm [23]. We examined whether UCK2 is involved in genetic information processing. RIP sequencing revealed 9652 peaks related to 4139 genes (Additional file 3: Fig. S3A). The peaks were mostly located in the promoter, 3′UTR, and exon regions (Fig. 5A). These genes are involved in different human disease signalling pathways (Additional Fig. S3B). UCK2 targeted the 3′UTR regions of 1285 genes and influenced the mRNA stability of 96 genes (Fig. 5A, B). These genes are involved in signalling pathways related to post-transcriptional regulation and metabolism (Fig. 5C). The target sequence of PDPK1 3′UTR by UCK2 (peak over chromosome: Chr16: 2,561,353-2,561,710) contains three AU-rich regions (Fig. 5D). Downregulation of UCK2 decreased the expression of PDPK1 and inhibited the downstream AKT signalling pathway (Fig. 5E). Gene expression of UCK2 was positively correlated with that of PDPK1 (Additional file 3: Fig. S3C). The GSEA results indicated that UCK2 and PDPK1 are involved in several common signalling pathways, including the cell cycle and mTOR signalling pathways (Fig. 5F). Increased expression of PDPK1 attenuated the proliferation suppression and cell cycle arrest induced by knockdown of UCK2 (Fig. 5G, H). Therefore, UCK2 is an RNA-binding protein and promoted cell cycle progression by maintaining the stability of PDPK1 mRNA.
Targeting UCK2 activated SASP induced by cell cycle arrest
Downregulated UCK2 induced modification of the innate immune system and activated several signalling pathways related to the immune response (Fig. 6A). The GSEA results demonstrated that decreased UCK2 activated the TNFα/NFκB signalling pathway related SASP (Fig. 6B). Dysregulated genes involved in SASP are listed (Fig. 6C). SASP was a phenotype induced by cell cycle arrest. The secreted SASP factors included CXCL10, which can promote the infiltration of NK cells and T cells. Downregulation of UCK2 increased the expression of ICAM1, which is a downstream adherent molecule of the TNFα/NFκB signalling pathway (Fig. 6D). The immunofluorescence results also showed that knockdown of UCK2 increased the expression of ICAM (Fig. 6E). ICAM1 enhances NK cell cytotoxicity [17]. These results indicate that targeting UCK2 facilitates NK cell surveillance via SASP. Blocking of the TNFα/NFκB signalling pathway did not influence the effect of downregulated UCK2 on the proliferation of HCC cell lines (Fig. 6F). Additionally, gene expression of UCK2 was negatively correlated with NK cell infiltration, particularly the CD56 bright type in HCC but not the NK cell resting and NK cell activation types (Fig. 6G). Moreover, patients with higher levels of activated NK cells and lower levels of UCK2 exhibited a considerably better prognosis (Fig. 6H). These and activated NK cell on the prognosis of HCC. *p < 0.05; **p < 0.01; ***p < 0.001; ****p < 0.0001 results indicated that targeting UCK2 might sensitize the tumour cells to NK-cell-mediated killing.
Targeting UCK2 may improve anti-tumour immune response
The ESTIMATE and immunophenoscores (IPS) were determined on the basis of the gene expression of TCGA-LIHC dataset. Elevated UCK2 was only associated with low stromal (Fig. 7A). UCK2 was negatively associated with MHC and IPS but positively associated with the effector cell (EC) score (Fig. 7B). Moreover, patients with higher level of UCK2 predicted to have poorer response to immune checkpoint inhibitors on the basis of TIDE scores (Fig. 7C). These results suggest that patients with high UCK2 levels are less sensitive to immunotherapy. Downregulated UCK2-induced SASP was positively I Correlation between TIDE score and metabolism related signalling pathways. J Downregulated UCK2 induced metabolism altered in immunotherapeutic response versus non-response group from TIDE; *p < 0.05; **p < 0.01; ***p < 0.001; ****p < 0.0001 correlated with M1 macrophage infiltration in HCC, promoted anti-tumour immunity and functioned as a biomarker for the immunotherapeutic response (Fig. 7D) [24]. A higher level of UCK2 in HCC was associated with a higher mutation burden (Fig. 3B, Additional file 4: Fig. S4A). Decreased UCK2 elevated the expression of the MHC I molecules, HLA-B, HLA-E and B2M, increasing the chance of neoantigen exposure (Fig. 7E). Additionally, downregulation of UCK2 promoted NLRP1-related inflammasome formation (Fig. 7F, G). MHC I molecules and inflammasome factors are involved in the innate immune system, which instructs the adaptive immune system and sensitizes the tumour to immunotherapy [25]. These data suggest that targeting the UCK2-induced secretory phenotype can improve the immunosuppressive microenvironment. The score for resistance to T-cell-mediated killing was generated based on the TISIDB dataset using the single-sample GSEA method. A high level of UCK2 increased the resistance of tumour cells to T-cell cytotoxicity (Additional file 4: Fig. S4B). Downregulation of UCK2 decreased the expression of genes related to resistance, and these genes were majorly enriched in metabolic pathways (Additional file 4: Fig. S4C). Downregulation of UCK2 regulated several signalling pathways related to metabolism, particularly amino acid metabolism (Fig. 7H). These metabolic pathways were negatively correlated with the TIDE scores (Fig. 7I). The metabolic level based on the above metabolic pathways was generated using the single-sample GSEA method. Thus, patients with higher metabolic levels were predicted to have a better response to immunotherapy (Fig. 7J). These results suggested that targeting UCK2 could also modify the adapt immune response and enhanced the effect of immunotherapy.
Discussion
Pyrimidine metabolism is critical for tumour progression. UCK is a pyrimidine ribonucleoside kinase that catalyses the first step of the pyrimidine salvage pathway and phosphorylation of several cytotoxic ribonucleoside analogues for cancer treatment [26]. There are two human UCKs: UCK1 and UCK2. UCK1 is ubiquitously expressed in several tissues, whereas UCK2 is expressed in the human placenta and tumour tissues [23]. UCK1 and UCK2 show a sequence similarity of 72%, and UCK2 has a higher catalytic efficiency than UCK1, indicating that UCK2 is an ideal target for tumour treatment [27].
UCK2 has been reported as a prognostic marker for several tumours, including HCC [8]. Several studies have reported that elevated UCK2 promoted HCC proliferation and metastasis [13,28]. UCK2 upregulated in cancer is partly due to demethylation, which contributes to resistance of cancer to 5-azacytidine treatment [29]. In the present study, we first explore the link between UCK2 and tumour microenvironment. We found that UCK2 was responsive to TGFβ1 stimulation implying the crosslink between microenvironment and tumour cell in the initial stages of tumour formation. The mechanisms of UCK2 promoting the progression of HCC have been reported by several studies. Here, we showed that UCK2 accelerates the cell cycle process through a dual mechanism and identified UCK2 as a novel RNA-binding protein. Downregulation of UCK2 induced cell cycle arrest and activated SASP, which could increase NK cell infiltration and NK-cellmediated killing. Meanwhile downregulation of UCK2 also causes a secretory phenotype, and MHC I expression which can improve immunosuppression microenvironment. In addition, downregulating UCK2 remodelling metabolism in tumour cells can also increase the response to immunotherapy.
Cancer metabolism has been extensively investigated in recent decades, and metabolic phenotypes adapted by cancer cells can profoundly influence the tumour microenvironment [30]. Because nutrient and oxygen delivery are inefficient owing to poorly differentiated vasculature in tumours, cancer and immune cells compete for nutrients to maintain the demands of rapid proliferation, leading to an anti-tumour defence [31]. Strategies that alter tumour metabolism may improve cancer therapy. However, one limitation of this approach is that critical metabolic pathways are shared by cancer cells and immune cells. For example, the glycolytic pathway, which is essential for dendritic cell survival, is controlled by the mTOR signalling pathway [32]. While aberrant activation of mTOR signalling pathway has been observed in HCC. Targeting mTOR signalling pathway also induces immunosuppression and this effect has been applied in postoperative management of liver transplantation.
UCK2 is mainly expressed in tumour tissues and tumour cells. UCK2 is essential for maintaining the stability of mTOR, and downregulation of UCK2 can specifically inhibit mTOR signalling pathway-related metabolic reprogramming of cancer cells. In addition, targeting UCK2 can relapse amino acid metabolism to decrease the resistance of cancer cells to T-cell-mediated killing [30].
Conclusions
Targeting UCK2 inhibits HCC progression and improves immune response. This modification could improve the response to immunotherapy in patients with HCC. Therefore, UCK2 is an ideal target for treating HCC to prevent tumour progression and facilitate immunotherapy.
|
v2
|
2022-12-01T06:44:35.296Z
|
2022-11-26T00:00:00.000Z
|
254120289
|
s2orc/train
|
HMGA1 As a Potential Prognostic and Therapeutic Biomarker in Breast Cancer
Background High-mobility group AT-hook1 (HMGA1) protein plays an important role in various diseases. However, the contribution of HMGA1 in breast cancer remains to be tapped. Methods The expression of HMGA1 was analyzed in The Cancer Genome Atlas (TCGA) and TIMER database, and immunohistochemistry was performed in 39 breast cancer (BC) patients. The correlation between HMGA1 expression and prognosis was evaluated using Kaplan–Meier plotter (KM plotter) in patients with breast cancer. Then, cBioPortal and bc-GenExMiner were requisitioned to analyze the contribution of HMGA1 expression to clinical features. In order to reveal the function of HMGA1 in breast cancer cells, enrichment analysis was performed using the clusterProfiler R software package. Moreover, CCK8 assay, EdU assay, and Cell Cycle Assay were performed to assess the proliferation, and transwell assay was used to evaluate cell migration and invasion. Flow cytometry was used to explore the role of HMGA1 on cell apoptosis. After that, the effect of HMGA1 on signaling pathways in BC cells was detected by western blot. Results HMGA1 was highly expressed in a variety of tumors tissues, including BC. High HMGA1 expression was correlated with poor prognosis in BC patients. Meanwhile, HMGA1 expression was increased in molecular phenotypes with poor prognosis (ER-, PR-, and HER2+) and associated with high-grade group, lymph node metastasis, and NPI (Nottingham Prognostic Index). Further, function analysis revealed HMGA1 was enriched in DNA replication and cell cycle pathways in breast cancer. Moreover, knockdown of HMGA1 caused apoptosis, inhibited proliferation, migration, and invasion of MCF-7 and MDA-MB-231 cells, in which the oncogenic signaling pathway of PI3K/AKT/MMP9 played a critical role. Conclusions HMGA1 was important for breast cancer progression and was a critical prognostic indicator, prompting a potential therapeutic target of breast cancer.
Introduction
Breast cancer with an incidence of more than 10% is considered the most common female malignancy in the world [1]. Despite rapid advances in diagnosis and treatment, the prognosis of many breast cancer patients remains poor, and mortality of breast cancer remains a major challenge [2]. Metastasis is mainly responsible for treatment failure and 90% of cancer-related deaths in breast cancer [3]. Approximately 20%-30% early breast cancer patients will experience distant metastatic relapse. The 5-year overall survival rate for breast cancer patients without metastasis is greater than 80%, while distant metastasis can lead to a significant reduction to about 25% [4]. However, the regulatory mechanisms that conduce to cancer metastasis in breast cancer have not been expounded. Therefore, it is urgent to identify powerful prognostic predictors and novel therapeutic approaches for treatment of breast cancer.
High-mobility group AT-hook1 (HMGA1), located at chromosomal locus 6p21, is a protein that plays an important role in the assembly of enhancers of transcription factors and cofactors [5]. HMGA1 proteins are abundant during embryogenesis and tumorigenesis and are reported as a key molecule inducing transcriptional networks involved in self-renewal and pluripotency in embryonic stem cells [6]. With abnormally expression in most aggressive tumors, high expression of HMGA1 portends poor differentiation of tumor cells and adverse clinical outcomes of patients [7][8][9]. Further, accumulating researches have indicated that HMGA1 is critical for the progression of malignant tumors, including ovarian cancer, cervical cancer, and lung cancer [10][11][12], accelerating the malignant progression of tumors through influencing DNA replication, cell proliferation, and epithelial-to-mesenchymal transition (EMT) [5,13]. However, the prognostic value of HMGA1 in breast cancer tissues and the mechanism in tumor progression remain to be determined.
In this study, the role of HMGA1 was evaluated in different types of tumors in The Cancer Genome Atlas (TCGA). We further investigated the association of HMGA1 expression with distinct receptors and molecular pathways in breast cancer. Finally, we explored the role of HMGA1 silencing on proliferation, apoptosis, migration, and invasion in breast cancer cells. These findings advance the understanding of HMGA1 and indicate that HMGA1 is a promising biomarker for breast cancer diagnosis and prognosis.
Survival
Analysis. Survival analysis of breast cancer patients was performed in KM Plotter (http://www.kmplot .com) and bc-GenExMiner (http://http://bcgenex .centregauducheau.fr/), which was determined based on the hazard ratios (HRs) and log-rank P value. To distinguish between high and low expression of HMGA1, we used the median as the cut-off point for survival analysis, which is the number in the middle of a sequential set of data.
Correlation Analysis of HMGA1 and Clinicopathological
Features. Online databases that contained cBioportal (http:// www.cbioportal.org) and bc-GenExMiner were used to analyze the correlation between the HMGA1 expression and clinicopathological features.
Function Analysis.
Pearson correlation analysis of HMGA1 mRNA and other mRNAs in breast cancer was performed using TCGA data. GSEA analysis was performed using the clusterProfiler package in R. GO analysis was performed using the EnrichGO function in the clusterProfiler package in R.
2.6. Transwell Assay. Migration assays were performed using Matrigel-free transwell chambers (Coring, USA), and invasion assays were carried out with Matrigel (BD Biosciences). Cells were seeded into the upper chamber of the transwell chamber (BD Biosciences, Franklin Lake, NJ) with a density of 2 × 10 5 cells/ml. After 48 h at 37°C, cells on the top of the incubator were removed. Cells on the bottom were fixed with 4% paraformaldehyde for 10 min, and then cells stained with crystal violet (Beyotime, China) for 5 min and counted in microscope.
Cell
Counting Kit (CCK8) Assay. Cells with a density of 5000 cells per well were seeded into 96-well plates. After incubated with 10 μl CCK8 reagents, cells were detected in 24 h, 48 h, and 72 h using microplate reader (Molecular Devices, Rockford, IL, USA) with optical density value at 460 nm.
EdU Assay.
We assessed cell proliferation using 5-ethynyl-2 ′ -deoxyuridine (EdU) according to the manufacturer's instructions (BeyoClick™ EdU cell Proliferation Kit with Alexa Fluor 555). Briefly, cells (2 × 10 4 /well) were cultured in 8-well slide and incubated with 50 umol/L EdU (1 : 1000) for 12 hours. Cells were fixed with 4% formaldehyde at 37°C for 20 minutes and soaked in 0.5% Triton X-100 at 37°C.Then, add 100 μl of Apollo reaction cocktail and incubate in the shade for 30 minutes. After several washes with PBS, the nuclei were stained with 4 ′ ,6 ′ -diamidino-2-phenylindole (DAPI) at 37°C for 20 minutes. The EdU-labelled cells were observed by laser scanning confocal microscopy (Leica SP8) and normalized to the total number of cells stained with DAPI.
2.9. Flow Cytometry. For analysis of cell cycle assay, treated cells were collected, fixed overnight in 70% ethanol at 4°C, washed three times with cold PBS, and incubated with RNase A (0.1 mg/ml, Taraka) diluted in prechilled PBS. Then, PI (propidium iodide, 20 mg/ml) was added. The cell cycle was measured using FACS Calibur flow cytometer (Franklin Lake, NJ). The data were analyzed by Cell Quest software (Franklin Lake, NJ).
For the detection of cell apoptosis, all samples were washed in phosphate-buffered saline and resuspended in 200 μl binding buffer. Next, 5 μl Annexin-V-fluorescein isothiocyanate, and 10 μl propidium iodide (PI; 1 μg/ml) was added, and the cell suspenson was incubated in dark room for 1 h at room temperature. Then, FACS Calibur flow cytometer (BD Biosciences, Franklin Lakes, NJ, USA) was used for measurement, and CellQuest software (BD Biosciences) was used for data analysis. 2.11. Real-Time PCR. Total RNA was extracted with Trizol reagent (Takara, Japan), and then ReverTra Ace qPCR RT kit (Toyobo, Japan) was used for reverse transcription. Real-time PCR was performed on a CFX Connect real-time system (Biorad, USA). The conditions were as follows: initial denaturation (95°C for 5 min) and then 40 cycles of threestep PCR (95°C for 40 s, 60°C for 50 s, and 72°C for 30 s).
Immunohistochemistry (IHC).
For immunohistochemical analysis, 39 breast cancer tissues and paired adjacent noncancer samples were included. The clinical characteristics are shown in Table 1. Immunohistochemistry was carried out according to the manufacturer's instructions (Boster, Wuhan, China). HMGA1 antibody was purchased from Abcam (1 : 200, ab4078). The results were evaluated as described previously [14].
2.13. Statistical Analysis. SPSS 20.0 was applied for statistical analysis. Data were presented as mean ± SD. Statistical comparisons between groups were analyzed using Student's t -test. P < 0:05 indicated statistical significance.
HMGA1 Expression Is Elevated in Breast Cancer Tissues.
In analysis of RNA-seq data in TIMER database, we found that the expression of HMGA1 in most cancer tissues was higher than that in normal tissues, including breast and other 17 types of cancers (Figure 1(a)). Additionally, high HMGA1 expression was observed in breast cancer in the TCGA cohort compared to normal breast tissues ( Figure 1(b)). Moreover, the level of HMGA1 was prominently increased in breast cancer tissues compared with the adjacent nontumor tissues (Figure 1(c)).
In view of the clinical characteristics of HMGA1 mRNA expression in breast cancer, we try to evaluate the HMGA1 protein expression in breast cancer tissues and paired adjacent nontumor tissues by immunohistochemical staining (IHC). As shown in Figure 1(d), HMGA1 protein positive staining is located in the nucleus and is upregulated in breast cancer tissue.
Next, we examined the expression of HMGA1 mRNA and protein in six breast cancer tissues and paired adjacent nontumor tissues and got consistent finding in TCGA database. The qRT-PCR and western blot results showed higher HMGA1 expression in cancer tissues comparing with that in normal adjacent tissues (Figures 1(e) and 1(f)). These data suggest that HMGA1 may play an important role in the pathogenesis of breast cancer.
High mRNA Level of HMGA1 Predicts Poor Survival of Breast Cancer Patients.
To systematically evaluate the association between HMGA1 expression and patient survival in breast cancer, we performed the survival curves from Kaplan-Meier plotter and bc-GenExMiner online database. We found higher HMGA1 expression predict poor prognosis: the OS (Figure 2 Figure 2). These finding indicate that HMGA1 is a potential oncogene in breast cancer.
Association between HMGA1 Expression and Clinical
Characteristics in Breast Cancer. The association between HMGA1 mRNA expression and the clinical characteristics was investigated using mRNA expression z score (U133 microarray only) data available from cBioportal, and the genome profiles of 2,509 BC patients were analyzed. As shown in Figure 3, HMGA1 expression was significantly correlated with ER (Figure 3(a)), PR (Figure 3(b)), HER2 (Figure 3(c)), and grade ( Figure 3(d)) in BC patients. We also used bc-GenExMiner which contained molecular subtyping of 4,384 breast cancers to analyze the relationship between HMGA1 expression and clinical characteristics. As expected, the consistent results were gotten from bc-GenExMiner (Figures 3(e)-3(h)). Additionally, high HMGA1 was significantly related with lymph node metastasis and Nottingham Prognostic Index (NPI). It was worth mentioning that HMGA1 expression was obviously lower
Disease Markers
in luminal A BC than in the other subtypes in cohort from both bc-GenExMiner and cBioportal, and it was obviously higher in basal-like breast cancer than in the other subtypes (Supplementary Figure 3).
PI3K/AKT pathway has been reported playing a vital role for tumor initiation and progression in many cancers, such as uveal melanoma, pancreatic adenocarcinoma, and hepatocellular carcinoma [15][16][17]. Therefore, we further assessed the impact of HMGA1 on PI3K/AKT/MMP-9 pathway in breast cancer cells. Downregulation of HMGA1 expression was observed in MCF-7 cells and MDA-MB-231 cells transfected with HMGA1 siRNA by western blot. Subsequently, we find significant decrease in the expression of PI3K, p-PI3K, AKT, p-Akt, and MMP-9 in MCF-7/ MDA-MB-231 cells transfected with si-HMGA1 (all P < 0:05) ( Figure 5(i)). Therefore, our data show that HMGA1 is a regulator of the PI3K/ATK/MMP-9 pathway, as predicted by our GO analysis.
Discussion
In recent years, HMGA1 was reported to play regulatory roles in various diseases. For example, it was reported that the expression of HMGA1 was upregulated in hepatocellular carcinoma and related to prognosis [18]. Downregulation of HMGA1 expression inhibited the proliferation, migration, and invasion of thyroid cancer cells [19]. Similarly, we had reported that HMGA1 exacerbates tumor growth and accelerates migration/invasion of cervical cancer [11], suggesting that HMGA1 might be a target oncoprotein. However, the expression pattern of HMGA1 in most human tumors and its prognostic values remain unclear. Qi et al. reported that HMGA1 expression was closely associated with the clinical stage and histological grade of breast cancer in 169 breast cancer tissues and 37 normal breast tissues [20]. Gorbounov's article mentioned that high expression of HMGA1 in breast cancer predicted poor overall survival [21]. However, the specific function and mechanism of HMGA1 still need further exploration in breast cancer. Here, we analyzed the data from online datasets to compare the expression of HMGA1, and found higher expression was observed in 1085 tumor tissues when compared with 112 normal tissues, indicating that it might be a novel oncogene. HMGA1 expression was obviously high in breast cancer compared with normal tissue and the adjacent tissues according to TCGA data. Furthermore, we verified the above conclusions by immunohistochemistry.
The KM plotter was used in our study, which can evaluate the correlation between gene expression and survival in samples from 21 tumor types including breast cancer [22]. Affymetrix ID is valid: 206074_s_at (HMGA1). The survival curves showed that, for thousands of breast cancer patients, higher HMGA1 mRNA levels were associated with worse OS, worse RFS, worse DMFS, and worse PPS. To systematically test the association between HMGA1 expression and specifical receptors, 2509 breast cancers in "cBioportal" and 4384 breast cancers in "bc-GenExMiner" were analyzed, respectively, and got the consistent conclusions; high HMGA1 expression was found in ER-negative group, PRnegative group, and HER2-positive group and was significantly related with high-grade pathological group and lymph node metastasis. NPI is a clinicopathological classification system based on tumor size, histological grade, and lymph node status, and our study also showed a positive association between HMGA1 expression with NPI. Moreover, HMGA1 was obviously higher in basal-like breast cancer than in the other subtypes, which dictated therapeutic guidance and portended prognosis.
In addition, we utilized functional and pathway enrichment analysis to explore the potential mechanisms of HMGA1 in breast cancer. The results showed that high expression of HMGA1 was associated with cell cycle transition, DNA replication, chromosomal region, protein serine/ threonine kinase activity, and ATPase activity in breast cancer. HMGA1 has previously been reported to be related to malignant cellular behavior in human cancers [23][24][25]. Although extensive correlative evidences indicated that HMGA1 play a role in tumor metastasis, few studies have shown the direct functional relationship between HMGA1 expression and invasion/metastasis in breast cancer. By gene silencing experiments, we found that HMGA1 downregulation could inhibit cell proliferation through inducing G1 phase arrest and S phase inhibition, induce cell apoptosis, and weaken the migrating and invasive ability of breast cancer cells.
PI3K is a key downstream signal of growth factor tyrosine kinases, participating in the recruitment and activation of multiple cellular targets including AKT [26]. In turn, AKT activation helps regulating cell growth, cell survival, and cell mobility [27]. Besides, accumulating studies suggest that MMPs could involve in the early stage of cancer metastasis [28][29][30]. PI3K/AKT/MMP-9 pathway has been gradually recognized to play an indispensable role in cell growth, proliferation, and differentiation [31][32][33]. Previous studies have reported that the PI3K/AKT/MMP-9 pathway is a unique downstream pathway of HMGA1, which is critical for uveal melanoma cell proliferation, survival, and migration [32]. Our study showed that the downregulation of HMGA1 inhibits proliferation, invasion and metastasis, and induce apoptosis of breast cancer cells and provides evidence that HMGA1 expression mediates cellular malignant biological behavior through PI3K/Akt/MMP-9 dependent pathway, which is consistent with previous findings in uveal melanoma. The existing findings indicate a key role of HMGA1 in regulating tumor metastasis and predicting prognosis. However, the detailed mechanism of HMGA1 in breast cancer still needs further exploration.
Disease Markers
In summary, our results showed that the HMGA1 level was significantly upregulated in breast cancer tissues and closely related to clinical feature. Higher HMGA1 predicted poor survival in breast cancer patients. Downregulation of HMGA1 induces apoptosis and cell cycle arrest and inhibits cell proliferation, migration, and invasion in breast cancer.
Our findings indicate that HMGA1 may be a critical prognostic indicator and potential therapeutic target of breast cancer.
Data Availability
The data used to support the findings of this study are included within the article and the ementary information files.
|
v2
|
2022-12-01T12:07:27.507Z
|
2022-11-26T00:00:00.000Z
|
254120335
|
s2orc/train
|
The Regulatory Network of Gastric Cancer Pathogenesis and Its Potential Therapeutic Active Ingredients of Traditional Chinese Medicine Based on Bioinformatics, Molecular Docking, and Molecular Dynamics Simulation
Objective This study aims to investigate the functional gene network in gastric carcinogenesis by using bioinformatics; besides, the diagnostic utility of key genes and potential active ingredients of traditional Chinese medicine (TCM) for treatment in gastric cancer have been explored. Methods The Cancer Genome Atlas and Gene Expression Omnibus databases have been applied to analyze the differentially expressed genes (DEGs) between gastric cancer and normal gastric tissues. Then, the DEGs underwent Gene Ontology and Kyoto Encyclopedia of Genes and Genomes enrichment analyses using the Metascape database. The STRING database and the Cytoscape software were utilized for the protein-protein interaction network of DEGs and hub genes screening. Furthermore, survival and expression analyses of hub genes were conducted using Gene Expression Profiling Interactive Analysis and Human Protein Atlas databases. By using the Comparative Toxicogenomics Database, the hub genes interconnected with active ingredients of TCM were analyzed to provide potential information for the treatment of gastric cancer. After the molecular docking of the active ingredients of TCM to specific hub gene receptor proteins, the molecular dynamics simulation GROMACS was applied to validate the conformation of the strongest binding ability in the molecular docking. Results A total of 291 significant DEGs were found, from which 12 hub genes were screened out. Among these hub genes, the expressions of five hub genes including COL1A1, COL5A2, MMP12, SERPINE1, and VCAN were significantly correlated with the overall survival. Furthermore, four potential therapeutic active ingredients of TCM were acquired, including quercetin, resveratrol, emodin, and schizandrin B. In addition, the molecular docking results exhibited that the active ingredients of TCM formed stable binding with the hub gene targets. SERPINE1 (3UT3)-Emodin and COL1A1 (7DV6)-Quercetin were subjected to molecular dynamics simulations as conformations of continuing research significance, and both were found to be stably bound as a result of the interaction of van der Waals potentials, electrostatic, and hydrogen bonding. Conclusion Our findings may provide novel insights and references for the screening of biomarkers, the prognostic evaluation, and the identification of potential active ingredients of TCM for gastric cancer treatment.
Introduction
Gastric cancer, as a malignancy occurring in the gastric mucosal epithelium, is the ffth most frequent cancer and the third most common cause of cancer deaths worldwide [1], with 1.48 million new cases annually. Te occurrence and development of gastric cancer is a complicated process involving multiple factors, steps, and genes, whilst the etiology and pathogenesis have not been fully elucidated so far. It is well accepted that the risk factors of gastric cancer contain diet, lifestyle (smoking and alcohol consumption), and Helicobacter pylori infection [2]. Te main therapeutic approaches for gastric cancer in recent years were endoscopic resection [3], surgery [4], radiotherapy [5], neoadjuvant chemotherapy [6], immunotherapy [7], and traditional Chinese medicine (TCM) [8]. Early gastric cancer is difcult to be diagnosed due to its insidious onset, resulting in a large number of patients missing the golden treatment period and even approximately 70% of patients with gastric cancer at an advanced stage of diagnosis [9], which severely limits the efcacy of surgery and radiotherapy [9]. Although conventional chemotherapeutic agents, such as cisplatin and 5-fuorouracil, have provided enormous clinical benefts for patients with advanced gastric cancer, they pose a huge challenge to treatment because of their resistance and cytotoxicity [10,11]. Terefore, the search for genes tightly related to the development of gastric cancer is highly valuable for clarifying the pathogenesis of gastric cancer and dissecting potential drugs to prevent and treat gastric cancer.
TCM has historically been known for its multitargeting and low adverse efects, which has great advantages in improving the quality of life of patients with digestive system diseases [12,13]. Of note, a large number of studies have reported that TCM combined with chemotherapeutic drugs improves the survival and prognosis of patients with gastric cancer [14][15][16]. Mechanistic research [16] has manifested that TCM and its active ingredients can exert antitumor efects through various mechanisms, such as inhibition of cell proliferation, interference with angiogenesis, repression of cell motility, and regulation of infammation-related factors. Terefore, it is evident that the antigastric cancer efects of TCM and its active ingredients cannot be underestimated. Tis study set out to dissect the hub genes afecting gastric carcinogenesis by mining diverse bioinformatics databases and to search for potential therapeutic targets to provide a bioinformatics basis for the discovery of active ingredients of TCM, which were fnally confrmed by molecular docking and molecular dynamics simulation techniques.
Data Collection.
Te transcriptome data of the tumor tissues of 375 patients with gastric cancer and 32 matched normal tissues were downloaded from Te Cancer Genome Atlas (TCGA) database (https://cancergenome.nih.gov, it was accessed on November 15, 2021). Te Gene Expression Omnibus (GEO) database (https://www.ncbi.nlm.nih.gov/ gds/, it was accessed on November 20, 2021) was utilized to fnd datasets (GSE103236 and GSE54129), which matched the requirements of this study, of diferentially expressed gene (DEG) profles between gastric cancer and adjacent normal tissues that with gastric cancer as the keyword. Among them, the GSE103236 microarray data contained 10 gastric cancer samples and 9 normal tissue samples, and the GSE54129 microarray data consisted of 111 gastric cancer samples and 21 normal tissue samples.
Screening of DEGs between Gastric
Cancer and Adjacent Normal Tissues. DEGs in gastric cancer were screened in the transcriptome data of tumor tissues of patients with gastric cancer and 32 matching normal tissues downloaded from the TCGA database using the R language software with |log2 fold change (log2FC)| ≥ 2 and false discovery rate (FDR) < 0.01 as screening criteria. Te expression matrices of gastric cancer and normal tissues in GSE103236 and GSE54129 microarray samples were differentially analyzed by GEO 2R with the screening criteria of |log2FC| ≥ 1 and FDR < 0.05, respectively, followed by the comparison of the DEG datasets between gastric cancer and normal groups in the two sets of microarray data. Ten, the combination was conducted on the DEGs obtained from the data of the two microarray samples. Finally, the DEGs harvested from TCGA were intersected with the DEGs attained from the 2 sets of GEO microarray samples, followed by the plotting of the Veen diagram to acquire the intersecting genes, that is, gastric cancer-related DEGs.
Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) Pathway Enrichment Analyses.
Metascape (https://metascape.org/, it was visited on November 25, 2021) is a repository that annotates the biological functions of genes and proteomes. In this study, the Metascape database was employed to perform the GO and KEGG enrichment analyses on the obtained DEGs. In addition, P < 0.05 was adopted as the basis for determining the specifcity of signifcant DEGs in the pathway enrichment analysis, biological process (BP), molecular function (MF), and cell components (CC).
Construction of the Protein-Protein Interaction (PPI)
Network and Acquisition of Hub Genes. Te intersecting genes were imported into the STRING database (https:// stringdb.org/, which was visited on December 5, 2021). Te PPI network of signifcant DEGs was constructed by setting the interaction score threshold to >0.400, limiting the study population to human species, and hiding the free genes disconnected from the networks, followed by the exportation of the string-interactions fle. Te string-interactions fle was imported into the Cytoscape software. Afterward, the PPI network was scored twice using the CytoNCA plug-in for betweenness (BC), closeness (CC), degree (DC), eigenvector (EC), local average connectivity-based method (LAC), network (NC), subgraph (SC), and information (IC). Te hub genes of the PPI network were retrieved based on the genes with scores greater than the median value.
Survival Analysis and Validation of Hub Genes.
Te Gene Expression Profling Interactive Analysis (GEPIA) database (https://gepia.cancer-pku.cn, it was accessed on December 15, 2021) [17] is a database containing gene expression profles of various tumors and cancers, which can be utilized to assess the mRNA expression of genes in the prognosis of gastric cancer and explore the impact of high and low expression of genes on the overall survival of patients with gastric cancer. Te hub genes obtained from 1.2.3 were sequentially imported into the GEPIA database. Te patients in the corresponding dataset were arranged into high and low-expression groups as per the median gene expression, followed by statistical analyses using the logrank test. In the analyses, P < 0.05 was considered statistically signifcant and acted as a basis for identifying whether hub genes were correlated with the prognosis of patients, and the hazard ratios (HR) indicated the probability of cancer progression or death in patients with a high gene expression relative to those with low gene expression. Te GEPIA database was adopted to verify the expression of the hub genes in gastric cancer and normal gastric tissues detected by RNA sequencing, with the results shown in box plots.
Te Pathology Section
Assay of the Hub Genes. Te expression of the proteins encoded by the hub genes in gastric cancer and normal gastric tissues was examined using the Human Protein Atlas (HPA) database (https://www. proteinatlas.org, it was accessed on December 25, 2021), with the collection of representative immunohistochemistry staining images.
Screening of Active Ingredients of TCM Targeting Core
Pathogenic Genes of Gastric Cancer. Te Comparative Toxicogenomics Database (CTD, https://ctdbase.org, it was visited on December 30, 2021), as an innovative digital ecosystem that relates toxicological information for chemicals, genes, phenotypes, diseases, and exposures, can be applied for the research of the interaction between gene targets and active ingredients of TCM [18]. Te hub genes were imported into the search box to retrieve the compounds interacting with the hub genes with humans as the species. Tereafter, the compounds were exported in the form of an Excel sheet to analyze the involved active ingredients of TCM using the interaction value >1 as the screening criteria.
Molecular Docking.
Te structural formulas of active components were downloaded from the PubChem database (https://pubchem.ncbi.nlm.nih.gov/, it was accessed on January 5, 2022). Te corresponding three-dimensional (3D) structures were created by the Chem3D software and exported to mol2 format. Ten, the PDB format of the hub protein domain was downloaded from the Protein Data Bank database (https://www.rcsb.org/). Te protein was dehydrated and dephosphorized using the PyMOL software, and AutoDockTools1.5 was used. Te software was employed to convert the PDB format of active components of drugs and hub gene fle to the pdbqt format and search for the active pocket. Finally, the Vina script was run to calculate the molecular binding energy, followed by the display of the molecular docking results. Meanwhile, the Discovery Studio 2019 was run to fnd the docking sites and calculate the fexible binding LibDockScore. Te output molecular docking results were imported into the PyMOL software for the display of molecular docking conformations. If the binding energy was less than 0, the ligand and the receptor could bind spontaneously. When the Vina binding energy was less than −5.0 kcal·mol −1 and the LibDockScore was greater than 100, the ligand-receptor complex formed a stable docking. Te molecular docking results of the ligand-receptor complex were displayed in 3D and 2D to evaluate the reliability of bioinformatics analyses and predictions.
Molecular Dynamics
Simulation. Te optimal conformation in the molecular docking was utilized as the initial structure for further molecular dynamics simulations. Based on the docked complex, the all-atomic molecular dynamics simulation was carried out using the classical molecular dynamics simulation software GRO-MACS (2020.06), analyzing the existing mechanism and verifying the reliability of the binding model. Te Amber99SB-ILDN force feld parameters were utilized for receptor proteins and ligand molecules, and the ligand molecular topology fle was generated using Antechamber and ACPYPE programs. After the dodecahedral solvation box was selected, the nearest distance between the system boundary and the complex was set as 1.5 nm. Ten, the TIP3P water model was selected and Na + or Cl − was randomly added to the complex system using the VERLET truncation method to counteract the charge carried by the system. Te energy of the system was reduced. NVT was in charge of the system's temperature regulation, which was kept at 300 K. Te pressure was controlled by NPT to make the pressure constant at 101.325 kPa. Based on the abovementioned equilibrium, the free kinetic simulation was implemented for 100 ns. Te root mean square deviation (RMSD) was adopted to represent the degree of molecular structure changes to measure the stability of the complex system. In the meantime, the root mean square fuctuation (RMSF) and the radius of gyration (Rg) were utilized to analyze the fuctuation of protein structures and folding tightness. Te change in the protein binding cavity was refected by the solvent accessibility surface area (SASA). Subsequent to the analysis of changes in the number of hydrogen bonds between receptor proteins and ligand molecules with simulation time, the receptorligand binding free energy was calculated using the molecular mechanics Poisson-Boltzmann surface area (MM-PBSA) method, and the trajectory data were analyzed by using the Molecular Dynamics module.
Selection of DEGs between Gastric Cancer and Adjacent
Normal Tissues. Te 501 and 3893 statistically signifcant DEGs obtained from the GSE10323 and GSE54129 datasets, respectively, were merged and de-duplicated to obtain 4249 genes. In addition, 2891 DEGs that conformed to the screening criteria were acquired from the TCGA database. Te 2 sets of data were entered into the Draw Venn Diagram for a map analysis, which fnally yielded a total of 291 intersecting genes in the GEO and TCGA data, that is, signifcant gastric cancer-related DEGs ( Figure 1).
GO and KEGG Enrichment Analyses of Signifcant DEGs in Gastric Cancer Tissues versus Adjacent Normal Tissues.
Te results of the GO analysis showed that DEGs were mainly involved in an extracellular matrix (ECM), a collagen-containing extracellular matrix, a structural molecule activity, and an external encapsulating structure ( Figure 2).
Te KEGG analysis results manifested that DEGs were majorly enriched in various signaling pathways, including IL-17 signaling pathway, TNF signaling pathway, protein digestion and absorption, gastric acid secretion, transcriptional misregulation in cancer, ECM-receptor interaction, focal adhesion, PI3K-Akt signaling pathway, cell cycle, and p53 signaling pathway ( Figure 3).
Te Survival Analysis and Verifcation of Hub Genes.
Te prognostic value of 12 hub genes was scientifcally evaluated using the GEPIA database, displaying that fve hub genes, SERPINE1, COL1A1, MMP12, COL5A2, and VCAN, exerted an obvious efect on the overall prognosis and survival of patients ( Figure 5). In Figure 5, the log-rankP < 0.05 represented that the prognosis and survival of patients with high gene expression were statistically diferent from those of patients with low gene expression. HR stood for the probability of cancer progression or death in patients with high gene expression relative to those with low gene expression. For instance, HR � 1.5 suggested that the risk of cancer progression or death in patients with high gene expression was 1.5 times higher than that in patients with low gene expression. Te results documented that the high expression of SERPINE1, COL1A1, COL5A2, and VCAN was associated with poor overall survival (P < 0.05; HR > 1), whereas the high expression of MMP12 predicted a favorable prognosis (P < 0.05; HR < 1). Furthermore, the diferences in the expression of these fve genes between gastric cancer and normal gastric tissues were further confrmed in the GEPIA database, which depicted that the mRNA levels of the abovementioned fve genes were substantially higher in gastric cancer samples than in normal gastric samples (P < 0.05; Figure 6).
Verifcation of Hub Genes by the Pathology Section Assay.
In addition to studying the mRNA levels of the hub genes, their protein levels were also measured using immunohistochemistry analysis through the HPA database. Due to the lack of immunohistochemistry staining information for the gastric cancer-related COL5A2, MMP12, and SERPINE1, the representative staining results of COL1A1 and VCAN were selected and are exhibited in Figure 7. Tere existed more positive expression results of COL1A1 and VCAN in gastric cancer tissues than in normal gastric tissues, indicating elevated protein levels of COL1A1 and VCAN in gastric cancer tissues. Tese results were concordant with the results of mRNA levels and validated our fndings in another way.
Retrieval of Active Ingredients of TCM Targeting Genes
Closely Related to Gastric Carcinogenesis. Based on the CTD database, the active compounds of TCM that acted on SERPINE1 comprised quercetin, resveratrol, and emodin. Te active compounds of TCM that targeted COL1A1 incorporated quercetin, resveratrol, and schisandrin B (Table 1).
Results of Molecular Docking.
Te results of the Vina docking showed that the hub proteins (SERPINE1 and COL1A1) could form stable t-docking with the corresponding active compounds of TCM, with a binding energy of lower than −5.0 kcal·mol −1 ( Table 2). In addition, the active ingredients of TCM were docked with corresponding target proteins using the Discovery Studio 2019 software, followed by the calculation of the LibDockScore. Te docking sites were observed for all hub proteins (SERPINE1 and COL1A1) and active ingredients of TCM. Among them, the docking models formed by SERPINE1 with quercetin, resveratrol, and emodin and COL1A1 with quercetin all had larger than 100 of LibDockScore, whereas the docking models formed by others possessed less than 100 of Lib-DockScore. Finally, the compound results output by the Vina was introduced into the PyMOL software, and 3D and 2D molecular docking with protein ligands was displayed using the Discovery Studio 2019 software. Figure 8 depicts the best combinations of the docking between target proteins and active compounds: SERPINE1 (3UT3)-Emodin and COL1A1 (7DV6)-Quercetin. performed on the abovementioned conformations as follows: SERPINE1 (3UT3)-Emodin and COL1A1 (7DV6)-Quercetin. RMSD stands for the distance between the same atoms at diferent simulation times, which can reveal the position changes between the protein conformation and the initial conformation during the simulation process. Te changing trend of RMSD of proteins and ligands is also a momentous index to judge whether the simulation is stable or not. Te analysis manifested that the SERPINE1-Emodin complex exhibited a certain degree of stability during the simulation, with the mean RMSD of 0.215 nm (max � 0.284 nm, min � 0.102 nm). Te value of the system increased slowly within 5-40 ns, and the curve tended to be stable after 40 ns. Meanwhile, it was also noted that there was a peak fuctuation in the RMSD curve of all complexes with SERPINE1 protein after 80 ns, whilst the curve of emodin was still stable. It was speculated that there might exist a certain conformational transformation of the protein at this time (Figure 9(a)), not the disturbance caused by the unstable binding of emodin. Te value of RMSD in the COL1A1-Quercetin complex system was in the range of 0.162-0.286 nm (mean � 0.229 nm). Moreover, the value of RMSD was elevated continuously within 0-20 ns. Te curve converged and maintained stably after 20 ns and fuctuated (max � 0.284 nm) after 90 ns, which was also caused by the conformational change of the protein itself. It was worth noting that emodin and quercetin molecules showed a high degree of stability throughout the simulation process, further confrming the reliability and stability of the binding (Figure 9(b)).
Results of RMSF.
RMSF is the average atomic position change for the time, which can characterize the fexibility of protein structure and the intensity of motion throughout the simulation. In this study, RMSF values were adopted to ascertain the structural fexibility of protein binding to ligands and the volatility of binding active amino acids. As manifested in Figure 10(a), the SERPINE1 protein contained a variety of fexible regions (max � 0.297 nm) and mainly was the loop structure. In addition, the RMSF values of amino acid residues in other regions were less than 0.2 nm, which demonstrated certain structural stability (mean � 0.095 nm).
As manifested in Figure 10(b), the COL1A1 protein consisted of approximately 5-segment loop structures with obvious volatility, with the highest RMSF value in the free end (max � 0.482 nm). On the other hand, the fuctuation of the residues located in the binding cavity to quercetin (THR325, ALA326, HIS328, and ASN332) was considerably lower than that of the residues in other regions, indicating that the persistent interaction between quercetin and COL1A1 proteins could stabilize the related structures and residues. Evidence-Based Complementary and Alternative Medicine 3.8.3. Hydrogen Bonds. Hydrogen bonds assume a key role in the formation and maintenance of the complex and also afict the stability of ligand-protein binding. Te hydrogen bond formation between ligand molecules and receptor proteins was dynamically observed in the time scale of 100 ns dynamics simulation. Te results documented that the emodin molecule steadily formed one hydrogen bond with the SERPIINE1 protein (Figure 11(a)). In addition, the COL1A1-Quercetin complex formed two hydrogen bonds on average (Figure 11(b)) and continued to form hydrogen bonds with residues HIS328 and ASN332. A certain number of hydrogen bonds also stabilized the binding conformation of the complex.
Rg.
Rg can characterize the compactness of protein structure and also refect changes in a protein-peptide chain looseness during the simulation. Tis study analyzed the compactness of the structure of SERPINE1 and COL1A1 proteins subsequent to ligand binding and then ascertained whether the ligands depolymerized the protein or impacted the normal folding of proteins. Admittedly, the smaller the Rg value, the more normal and stable the structure. However, this value also is infuenced by the structure of the protein itself. Tereby, attention also needed to be paid to the stability of the curve. As described in Figure 12(a), there was no marked change in the conformational folding of SERPINE1 protein binding to the emodin molecule, with the value in the range of 2.129-2.153 nm (mean � 2.113 nm) during the whole simulation. As discovered in Figure 12( be considered that the protein structure was stable and that the binding of quercetin did not afect the conformation of the COL1A1 protein.
Results of SASA.
Te SASA of SERPINE1 protein is detailed in Figure 13(a), with an average value of 163.399 nm 2 (max � 172.691 nm 2 , min � 151.246 nm 2 ) and periodical changes. Tus, it was speculated that the protein had a conformational transition during 25 ns, but the curve remained highly consistent and stable overall. Te correlation of the SERPINE1 protein structure presented that there were several loop structures around the emodin molecules, located binding cavity with certain fuctuations, which infuenced the contact between local solvent molecules and proteins. However, the stable conformation of emodin did not signally change the overall SASA value.
Te SASA value of COL1A1 protein fuctuated in the range of 147.332-168.371 nm 2 (mean � 155.392 nm 2 ). Te (Figure 13(b)). Te result refected that quercetin molecules occupied the protein binding cavity to discharge the existing water molecules inside and thus diminishing its SASA value. Te high stability of the curve demonstrated that quercetin bound stably in the cavity and did not present with obvious conformational changes. In addition, when the SASA value was decomposed into each amino acid residue, it was observed that the residues binding to quercetin (THR325, ALA326, HIS328, and ASN332) had lower SASA values, which could also prove the high stability of the abovementioned binding conformation.
3.8.6. Binding Free Energy. Te binding free energy of the complex in our research was calculated using the widely applied g_mmpbsa script [19]. Te results displayed the specifc values of each energy as shown in Table 3. Also, the binding strength of ligand molecules to target proteins was quantitatively analyzed by ΔG bind . Te binding free energy was −96.588 kJ/mol for the SERPINE1-Emodin complex. Te residue TYR79 (−15.773 kJ/mol) in SERPINE1 protein had the most prominent energy contribution, followed by PHE117 (−6.127 kJ/mol), ARG118 (−4.348 kJ/mol), MET45 (−3.066 kJ/ mol), and LEU75 (−1.928 kJ/mol). Te hot spot residues that interacted with emodin were distributed around it to ensure the stability of the binding during the simulation (Figure 14(a)). Te binding free energy (−114.307 kJ/mol) between COL1A1 protein and quercetin was lower than that of the SERPINE1-Emodin complex. Among hot spot residues, LEU386 (−8.307 kJ/mol), LEU305 (−5.992 kJ/mol), and VAL258 (−5.99 kJ/mol) contributed to outstanding binding free energy and played key parts in maintaining the binding mode of the COL1A1-Quercetin complex (Figure 14(b)).
Discussion
Despite the advances in therapies for gastric cancer, overall survival and prognosis remain unsatisfactory. In recent years, the rapid development of various bioinformatics technologies provides a viable avenue for the discovery of novel tumor-related diagnostic and therapeutic biomarkers.
In this study, DEGs in gastric cancer were frst identifed by analyzing gene expression data from TCGA and GEO databases, which acquired a total of 291 intersecting DEGs. Te GO enrichment analysis revealed that DEGs were primarily enriched in ECM, collagen-containing extracellular matrix, structural molecule activity, and external encapsulating structure. Te KEGG results elucidated that DEGs were predominantly enriched in the ECM-receptor interaction signaling pathway, the PI3K/Akt signaling pathway, the p53 signaling pathway, and so on. Te ECM is physiologically essential for intercellular signal transmission, intercellular interaction, and orchestration of cell proliferation, diferentiation, and migration [20,21]. ECM can impede tumor cell migration and invasion, and when its integrity is compromised, tumor cells are more prone to migrate and invade the microenvironment [22]. Te PI3K/Akt signaling pathway can manipulate a wide range of biological behaviors of cells, and abnormalities in the PI3K/Akt signaling pathway may trigger the development of gastric cancer [23]. In addition, the p53 signaling pathway is one of the most classic antioncogenic pathways, and p53 transcription factors are implicated in the mediation of numerous transcriptional processes and cellular processes, such as maintenance of genomic stability, cell metabolism, cell apoptosis, cell migration/invasion, and other biological processes [24,25]. A prior study [26] has found that p53 overexpression dramatically represses the growth and metastasis of tumor cells, which is due to the molecular basis of the excellent anticancer impact of p53 and explains the mutation of the p53 locus in nearly half of cancer patients [24]. In addition, the cell cycle signaling pathway is a fundamental process of cell proliferation, the enhanced activity of which can lead to tumor progression [27]. Of note, the deregulation of the cell cycle signaling pathway is a critical cause of uncontrolled cell proliferation [28]. In summary, massive research has unraveled that the ECM, PI3K/Akt, p53, and cell cycle signaling pathways are tightly associated with the development of gastric cancer, indicating the Residues 240 245 250 255 260 265 270 275 280 285 290 295 300 305 310 315 320 325 330 335 340 345 350 355 360 365 370 375 380 385 390 395 400 405 reliability of the bioinformatics analysis results in this study for the regulatory network of gastric cancer pathogenesis. Our study predicted 12 hub genes with a strong correlation with gastric carcinogenesis. Moreover, combined with the prognostic value, it was observed that the alterations of fve genes, COL1A1, COL5A2, MMP12, SERPINE1, and VCAN, were strongly related to the poor overall survival of patients. COL1A1 and COL5A2 both belong to the collagen family, which is a major component of the ECM [29]. More importantly, the upregulation of collagens assumes a critical role in the promotion of tumor growth. COL1A1, as the most abundant protein in the encoded collagen family, is a primary component of the ECM that can afict cell behaviors and tissue structures [30]. Li et al. [31] concluded that COL1A1 suppressed proliferation, migration, and invasion of gastric cancer cells. In addition, Zhang et al. [32] further demonstrated that ectopic COL1A1 facilitated gastric cancer cell proliferation in vitro. A mechanistic study elucidated that COL5A2 might accelerate tumor progression through hypoxia, coagulation, apical junction, angiogenesis, and apoptosis [33]. Tan et al. [34] discovered that COL5A2 upregulation contributed to the facilitation of gastric cancer cell migration. Together, these studies illuminate that COL1A1 and COL5A2 may not only be reliable biomarkers of gastric cancer cell proliferation and metastasis, and also key predictors of poor prognosis in patients with gastric cancer.
Te dysregulation of MMP12 (also known as human macrophage metalloelastase) has been hypothesized to be linked to all sorts of cancers, such as gastric cancer [35], but it predicts diferent prognoses in diferent tissues. Cheng et al. [36] found that the high expression of MMP12 predicted a good prognosis in gastric cancer due to a tight correlation with reduced angiogenesis and vascular infltration, which could function as a valid predictor for patients with gastric cancer. Consistently, the present study also elaborated that gastric cancer patients with MMP12 high expression had longer overall survival.
A prior study [37] reported that the SERPINE1 gene, also termed PAI-1, was associated with oncogene activation. Another mechanistic study unraveled that SERPINE1 enhanced metastasis in gastric cancer and accelerated peritoneal tumor growth in a mouse model of gastric cancer metastasis [38]. Also, it was clarifed in previous research [39] that SERPINE1 was a potent biomarker correlated with epithelial-mesenchymal transition in gastric cancer. Te research of Yang et al. [40] identifed that SERPINE1 could promote tumor cell proliferation, migration, and invasion by manipulating EMT and that SERPINE1 overexpression culminated in a poorer prognosis and could be an independent prognostic factor for patients with gastric adenocarcinoma.
VCAN, a multifunctional proteoglycan, is a member of the proteoglycan family, which is a main component of the ECM. It has been documented that VCAN is aberrantly expressed in a huge range of tumors, such as breast [41], ovarian [42], and colorectal [43] tumors and plays a pivotal role in tumor cell invasion, metastasis, and immune infltration. Accumulating research [44,45] unveiled that VCAN is highly expressed in gastric cancer and closely related to the survival of patients with gastric cancer patients, which thereby might act as an essential prognostic marker for the survival of patients with gastric cancer. Huang et al. [46] suggested that VCAN might impact the development of gastric cancer by modulating the tumor microenvironment, which might be a potential therapeutic target for gastric cancer. Te prediction in our research is concurrent with the abovementioned fndings and illustrated that VCAN may represent a novel prognostic biomarker for gastric cancer.
Te search for target genes is a very important part of the drug discovery process. Intriguingly, mounting molecules, compounds, and drugs have been noted to share complex relationships with a large quantity of genes and proteins [47][48][49]. TCM and natural compounds contain a large number of active ingredients, which provides more possibilities and opportunities for drug development and use. In this study, a total of four potential active ingredients in TCM were identifed based on the CTD database, including quercetin, resveratrol, emodin, and schisandrin B, all of which could be utilized in the prevention and treatment of gastric cancer.
It is extensively accepted that Vina binding energy to the receptor protein < −5.0 kcal·mol −1 or LibDockScore > 100 indicates the strong binding power of compounds. Our data displayed that all of the four screened active ingredients of TCM had less than −5.0 kcal·mol −1 of binding to the corresponding protein receptor molecules in the docking results. At the molecular level, the aforesaid results illustrated that the potential therapeutic efects of these four active ingredients, especially the SERPINE1-Emodin complex and the COL1A1-Quercetin complex, for gastric cancer not only possessed Vina binding energy < −5.0 kcal·mol −1 but also had LibDockScore > 100. Molecular dynamics simulations help unveil various dynamic interactions between a ligand and receptor, their interaction mechanism, and stability [50]. Here, we found that SERPINE1-Emodin and COL1A1-Quercetin could demonstrate relatively stable binding, which was consistent with the molecular docking results. Of note, Van der Waals potentials, electrostatic, and hydrogen bonding are most critical for their stable binding. SERPINE1 and COL1A1 have high overall fexibility and contain multiple fexible regions, which may be related to the specifc structure of the proteins. Based on this, sufcient attention should be paid to the research of the mechanism of these two complexes in the improvement or the overall pathogenesis and treatment of gastric cancer.
Quercetin is a common favonoid that is an active ingredient in numerous Chinese herbal medicines. Quercetin has been reported to exhibit antioxidant [51], antiinfammatory [52,53], and antimicrobial activities [54,55] and is also considered an anticancer agent [56]. A large body of epidemiological evidence has elucidated that the consumption of quercetin-rich vegetables and fruits may prevent the development of several cancers [57,58]. Quercetin exerts antitumor impacts on gastric cancer cells by inducing apoptosis [59]. Another study [60] manifested that Quercetin could mediate the Akt-mTOR and hypoxia-induced factor 1 α (HIF-1α) signaling pathways to activate the autophagic process in gastric cancer cells and also restrict gastric cancer cell metastasis by blocking the uPA/uPAR function [61].
Emodin, the principal active ingredient of the Chinese herbal medicines, Rheum ofcinale, Polygonum multiforum, and Aloe leaves, is an anthraquinone derivative with various pharmacological activities, including antioxidant, anticancer, and anti-infammatory efects [62]. Notably, prior research [63] has unraveled that emodin can subdue cell proliferation, facilitate cell apoptosis, and alter cell redox status, invasion, metastasis, and tumor angiogenesis. Currently, emodin has been evidenced to impede the growth of cells in lung, colon, and gastric cancers [64,65].
Conclusion
Altogether, we analyzed the prognostic value of the hub genes and elucidated the interactions between the genes in gastric cancer pathogenesis. Te functional analysis revealed the enrichment of ECM-receptor interaction, PI3K/Akt and p53 in gastric cancer by bioinformatics. Besides, we further mined the active ingredients of TCM targeting the hub genes, and it is shown that bioinformatics combined with molecular docking and molecular dynamics simulations can not only screen the hub pathogenic genes and potential active ingredients of medicines but also unveil the binding pattern of small-molecule ligands to protein receptors of the disease. We hope this study could provide a novel perspective for the biomarkers screen and TCM active ingredients' selection in gastric cancer.
Data Availability
Te datasets generated during and/or analysed during the current study are available from the corresponding author on reasonable request.
Conflicts of Interest
Te authors declare that they have no conficts of interest.
|
v2
|
2022-12-04T19:07:09.376Z
|
2022-11-26T00:00:00.000Z
|
254207478
|
s2orc/train
|
Strong Synergic Growth Inhibition and Death Induction of Cancer Cells by Astragalus membranaceus and Vaccaria hispanica Extract
Simple Summary Many anti-cancer drugs were developed from botanicals used in traditional medicine. However, modern anti-cancer therapy is often based on drug combinations that provide synergic anti-cancer effects. The aim of our study was to use costumed activity-based screening of traditionally used botanicals, which were previously screened by us for anti-cancer effects, for synergic anti-cancer combinations. We found a combination of two botanicals with very strong synergic effect on cancer cells. This effect was observed in all tested human cancer cell lines and in primary tumor cells. Our results suggest that the treatment interferes with the cell cycle of cancer cells, causing them to accumulate in the G2 phase of the cell cycle and leading to apoptosis. Further research of this combination may lead to the development of new effective anti-cancer therapies. Abstract We present here a new, classification-based screening method for anti-cancer botanical combinations. Using this method, we discovered that the combination of Astragalus membranaceus and Vaccaria hispanica (AV) has strong synergic anti-proliferative and killing effects on cancer cells. We showed that AV induces the hyper activation of proliferation and survival pathways (Akt and ERK1/2) and strongly downregulates the cell cycle control proteins p21 and p27. Moreover, FACS analyses revealed that AV induces accumulation of cells in G2/M phase, supported by accumulation of cyclin A. Taken together, our results suggest that AV interferes with the cell cycle in cancer cells, leading to accumulation in G2/M and apoptosis. Further studies are needed to validate the generalizability of the anti-cancer effect of the AV combination, to fully understand its mechanism of action and to evaluate its potential as a new anti-cancer treatment.
Introduction
The botanical world is a natural stock of bioactive materials, providing modern medicine with an enormous amount of potentially useful phytochemicals, some of which turned over the years into conventional medications [1]. Among other areas, cancer treatment has been greatly advanced by the development of cytotoxic drugs such as camptothecin derivatives (topotecan, irinotecan), taxanes (paclitaxel, docetaxel), vinca alkaloids (vinblastine, vincristine) and epipodophyllotoxin derivatives (etoposide, teniposide), originating from botanical sources [2]. Discovery of new botanical-derived anticancer drugs is either on single botanicals or on a whole formula [22][23][24]. Thus, non-canonical two-herb combinations usually receive less attention.
In the current study, we employed a new strategy to find potentially useful combinations of medicinal botanicals. Previously we have shown that the majority of plants with an in vitro anti-cancer activity cause cancer cell death through induction of reactive oxygen species (ROS) [25]. We further showed that botanicals with ROS-independent anti-proliferative activity display different sensitivity profiles on a panel of human cancer cell lines, suggesting distinct mechanisms, as opposed to ROS-inducing botanicals, which display similar sensitivity profiles [25]. Classification of botanicals according to their anticancer effect and its dependence on ROS allowed us to perform costumed screening, taking into account the specificity of action of each botanical. Here, we present our findings on a potentially useful combination revealed by this screening and describe our initial findings on the possible mechanism of action.
Cell Culture
Cancer cell lines: A549 lung carcinoma, MCF7 breast adenocarcinoma, T24 bladder transitional cell carcinoma, PANC-1 pancreas epithelioid carcinoma and U-2 OS osteosarcoma were from American Type Tissue Collection (ATCC, USA) and were authenticated using short tandem repeat (STR) analysis. Primary ovarian cancer cells were isolated from ascites fluid, obtained after signing informed consent. All cells were propagated in RPMI1640 supplemented with 10% fetal bovine serum, 2 mM L-glutamine and antibiotics in a 37 • C humidified incubator with 5% CO 2 .
Botanical Extracts
Standardized dried 1:5 water herbal extracts were purchased from BARA (Yokneam, Israel). The dried powder was dissolved in PBS at a concentration of 100 mg/mL, and incubated at 60 • C for 30 min with occasional vortex. The solution was centrifuged at 5000 rpm for 5 min, and the supernatant was filtered through a 0.45 µM Millex PVDF filter (Millipore, Carrigtwohil, Ireland). Solubility was estimated by cryophilization and weighting of the pellet and was estimated to be about 50%. For convenience, the final stock concentration was designated at 100 mg/mL (w/v concentration of dried powder in PBS).
Classification-Guided Two-Botanical Combination Screening
The botanicals were classified into three groups according to their anti-cancer effect and its dependence on ROS induction (Table 1; for detailed classification please refer to [25]): non-toxic botanicals (NT. Botanicals that had no inhibitory effect on cancer cells growth at 2 mg/mL concentration), toxic non-ROS (TNR, botanicals that had anti-cancer effect in vitro, but this effect was not affected by ROS neutralization by pyruvate) and toxic ROS-inducing (TR, botanicals, which anti-cancer effect in vitro could be neutralized by pyruvate addition). Different approaches were used for each kind of combinations: (1) Combinations of NT botanicals (which previously were found to be non-toxic at 2 mg/mL concentration on a panel of several cancer cell lines) were screened by a single dose of 2 mg/mL of 1:1 mix on a panel of cancer cell lines as indicated in the figures. In the case of synergy, the inhibition of growth should appear, and we should be able to detect it on the viability graph. (2) Combinations of TR botanicals, theoretically working through similar mechanism, were tested by comparing dose-effect curves of single botanicals and 1:1 mix. The combination was considered synergic if the mix had stronger effect than each of the individual herbs at similar doses, antagonistic if it had weaker effect than each of the individual herbs and additive if its effect was between the individual botanicals. (3) Combinations of toxic (TNR or TR) botanicals with NT botanicals were tested by comparing the effect of a single 1 mg/mL dose of the toxic botanical to the same treatment with addition of 1 mg/mL of NT botanical. In case of synergy, the effect of toxic botanical should be improved, in case of antagonism-compromised, in case of no effect (or additivity)-unchanged. (4) For combinations of TR and TNR botanicals three parameters were considered: (a) the influence of TNR on the effect of TR in TNR-insensitive cells (similarly to toxic:non-toxic combinations, were the TNR botanical was considered as "non-toxic");
SRB Viability Assay
Cells were plated 3000/w over 96 well plates and allowed to attach and grow overnight. Treatments were added for indicated times. SRB viability test was performed as described [27] in the following way: the cells were fixed for 1 h with 10% trichloroacetic acid (v/v in RPMI1640), washed trice with double distilled water, dried and stained for 30 min with 0.057% SRB (w/v in 1% acetic acid). After staining, the plates were washed trice with 1% acetic acid, dried and 200 µL 10 mM Tris was added to each well to solubilize SRB. Absorbance was measured at 570 nm using Power Wave X 340-I ELISA reader (Biotek Instruments, Winooski, VT, USA). Each experiment was repeated at least three times in triplicates.
FACS Analysis
Cells were plated on a 10 6 /10 cm plate, and treated on the following day. The cells were harvested by trypsinization at indicated times, fixed with 70% ice-cold ethanol, stained with PI/RNAse A/Tryton X-100 mix for 40 min, and used for cell cycle and apoptosis analyses. Cell sorting was performed on a BD FACS Calibur flow cytometer (BD Biosciences, San Jose, CA, USA). Single-cell population was selected on FL-2A/FL-2W dotplot and analyzed on an FL-2A linear scale using a WinMDI 2.9 program (Purdue University Cytometry Laboratories, West Lafayette, IN, USA).
Immunoblotting
Cells were plated at a density of 10 6 /10 cm plate and treated as indicated in the legends on the following day. Protein was extracted using RIPA (150 mM NaCl, 1% NP-40, 0.5% deoxycholic acid, 0.1% SDS, 0.5 M Tris pH 8), supplemented with a complete mini protease inhibitor cocktail and phosphatase inhibitor cocktails 2 and 3. Protein concentration was determined with Pierce BCA protein assay kit (Thermo Scientific, Rockford, IL, USA). Samples (30-100 µg) were resolved on 10-12% SDS PAGE, transferred to Protran BA-83 0.2 µM nitrocellulose membrane (Whatman, Piscataway, NJ, USA), blocked with 5% BSA and immunoblotted with appropriate antibodies. The membrane was then washed thrice with tris buffered saline, with Tween (TBST), incubated with corresponding HRP-conjugated secondary antibodies, probed with EZ-ECL enhanced chemiluminescence detection kit and then exposed to Fuji Super RX film (Fujifilm, Tokyo, Japan).
Statistical Methods
The mean ± standard deviations were calculated for each treatment, performed in triplicates, unless indicated otherwise. p-values were calculated using Student's t-test. All data were collected and analyzed using Microsoft Excel 2007 (version 12.0, Microsoft, Washington, DC, USA).
Screening of Two-Botanical Combinations
We performed classification-guided screening of two-botanical combinations for several botanicals (please refer to Table 1 for full names and acronyms), previously classified by us, according to their anti-cancer effect, into three groups: TR, TNR and NT.
The screening was performed as described in the "Methods" section on A549, MCF7, T24 and PANC-1 human cancer cell lines according to their sensitivity to the tested herbs, obtained in the previous work [25]. MCF7 cells are AME-sensitive; PANC-1 and T24 are VHI-sensitive, A549 cells are insensitive to both. Thus, to show the effect of VHI combinations with NT botanicals, we selected one insensitive (A549) and one sensitive (PANC-1) cell lines. Likewise, for TR combinations, we selected T24 and PANC-1 cells, which are mildly sensitive to ROS, and can provide more stable results. In addition, some combinations of toxic botanicals were tested on primary ovarian cancer cells. Figure 1 shows several examples of this classification-guided screening: (A) 1:1 combinations of eight NT botanicals, screened at a single dose on four cancer cell lines, showing no effect; (B) Influence of eight NT botanicals on the effect of VHI (TNR) in VHI-insensitive A549 cells and VHI-sensitive PANC-1 cells, screened by addition of NT botanicals to a fixed dose of VHI and showing no significant effect. Both TNR botanicals, AME and VHI, were screened in combinations with all NT botanicals on A549, MCF7, T24 and PANC-1 cell lines, neither combination showed clear synergy or antagonism, only selected results (with one sensitive and one insensitive cell lines) are shown; (C) 1:1 combination of TR botanicals (PLW and SSU), tested by comparing dose-effect curves of the mix and single botanicals, displaying expected additive effect (the dose-effect curve of 1:1 mix is between the curves of single botanicals); (D-E) 1:1 combinations of TR and TNR botanicals, tested in rising concentrations on different cells.
As shown in Figure 1D, AME (TNR) blocked the effect of PVU (TR) in AME-insensitive primary ovarian cancer cells, suggesting interference between these two herbs. Similar interference was also observed in VHI-sensitive PANC-1 cells, where the combination of VHI (TNR) and SSU (TR) had lower effect than had each of the single botanicals, and combinational index indicated strong interference.
Synergic Growth Inhibition and Cancer Cells Death Induction by AME:VHI Extract
The synergic effect of AME:VHI (AV) extract was initially discovered in primary ovarian cancer cells, and lately observed during two-herb combinations screening in several cancer cell lines, as described in the previous section. Human A549 (NSCLC), U-2 OS (osteosarcoma), MCF7 (breast adenocarcinoma), T24 (bladder transitional cell carcinoma) and PANC-1 (pancreas epithelioid carcinoma) cell lines were treated with rising concentrations (0.125-2.0 mg/mL) of AME, VHI or 1:1 mix (AV). As shown in Figure 2A, AV inhibited growth of all five cell lines at much lower concentrations than either AME or VHI alone. Combinational index, calculated using CompuSyn program, confirmed that the combined effect was either synergic (U2-OS, PANC-1) or strongly synergic (A549, MCF7 and T-24). Strong synergic effect was achieved with primary ovarian cancer cells, insensitive to both botanicals ( Figure 2B). To further investigate the mechanism of the synergy, we selected three cell lines showing strong synergic inhibition and lower sensitivity to single botanicals: A549 (almost insensitive to both botanicals), MCF7 (AME-sensitive, VHI-insensitive) and T-24 (VHI-sensitive, AME-insensitive). This was done to filter as much as possible the "noise" from single botanicals effect and get a better chance to find markers relevant for the synergy. Several experiments were also performed on VHI-sensitive, AME-insensitive PANC-1 cells.
Since viability experiments at a single time point provide only relative viability of control and treated populations, and cannot distinguish between growth inhibition and cell death, we performed cell cycle analysis of AV-treated cells. Cell death through apoptosis induction was shown by elevated sub-G1 population in cells treated with AV for 72 h ( Figure 2C, cell cycle analysis by FACS) and confirmed by PARP-1 cleavage ( Figure 2D, Western blot). Interestingly, cell cycle analysis showed elevation of G2/M phase in all cells, and of S phase in A549, T24 and PANC-1 ( Figure 2E); these results were further supported by accumulation of cyclin A, a marker of cell cycle progression and especially G2 phase, in AV-treated cells ( Figure 2D). Further, we evaluated time-dependent effect of AV and compared it to the effect of single botanicals by treating A549, MCF7, T24 and PANC-1 cells with 2 mg/mL of AME, VHI or AV for 264 h (the treatments were replaced by fresh ones every 72 h). As shown in Figure 3, even cells sensitive to AME or VHI alone overcame the inhibiting effect of single botanicals over time. On the contrary, AV treatment induced time-dependent cell death in three cell lines (A549, MCF7 and PANC-1), reducing cell population far below the pre-treatment values. T24 cells entered growth arrest after 72 h of treatment.
Sub-G1 0% 15%
PANC-1 T-24 MCF7 A549 Taken together, these results demonstrate that AME and VHI synergically induce growth arrest and death of cancer cells in vitro.
AV's Effect on Proliferation Pathways and Cell Cycle Progression
To address the molecular mechanism underlying AV's effect, we first analyzed the key enzymes in major proliferation and survival pathways, commonly activated in cancer cells, PI3K/Akt/mTOR and MAP kinase pathways [28,29]. Surprisingly, AV induced hyper phosphorylation of Akt (on both Ser473 and Thr308) in all three cell lines and ERK1/2 hyper phosphorylation in A549 and MCF7 cells at 24 h treatment ( Figure 4A top). In T24 cells ERK1/2 hyper phosphorylation was observed after 72 h of treatment ( Figure 4B), consistent with delayed effect of AV on these cells (Figure 3). Interestingly, AV treatment had much lower effect, if any, on the phosphorylation of MEK1/2, an upstream activator of ERK1/2. Simultaneously, 24 h treatment reduced the level of cell cycle progression inhibitors p21 and p27 in all cells ( Figure 4A top). Cell cycle analysis showed that 24 h AV treatment elevated the proportion of cells in G2/M phase in all three cell lines, and in S phase in A549 and T24 ( Figure 4A bottom), similarly to the results seen upon 72 h treatment ( Figure 2E). This is consistent with the growth curves ( Figure 3) which showed that all cells continued to proliferate during the first 24 h of treatment. Similar effect of AV on cell cycle distribution was observed under serum starvation conditions (Figure 4C top). AV abrogated the starvation-induced reduction in the G2/M phase in all three cell lines, and reduction in the S phase in A549 and T-24. Coherently, starvation did not rescue the cells from AV-induced death ( Figure 4C bottom), but rather had an additive effect with AV treatment.
Altogether, these results suggest that AV's mechanism of action may involve aberration of cell cycle progression signals and/or checkpoints.
IGF1-R Inhibitor AEW-541 Attenuates AV's Effect
To test the role of Akt and ERK1/2 hyper activation in AV's effect on cancer cells, we utilized inhibitors of Akt and ERK1/2 upstream activators, namely, a MEK1/2 inhibitor, Selumetinib (MEK1/2 is ERK1/2 direct upstream activator), a PI3K inhibitor, ZSTK474 (PI3K is an upstream activator of Akt), and IGF1R inhibitor AEW-541 (IGF1R activates both Akt and ERK1/2 pathways). As shown in Figure 5B, inhibition of MEK1/2 and PI3K successfully blocked AV-induced hyper phosphorylation of ERK1/2 and Akt, respectively, but failed to rescue the cells ( Figure 5A). On the contrary, AEW-541 drastically attenuated the effect of AV on the viability of the cells ( Figure 5C). Moreover, AEW-541 also attenuated the VHI effect on VHI-sensitive T24 and PANC-1 cells, but not the AME effect on AMEsensitive MCF7 cells, suggesting that rescue of the cells by AEW-541 may be due to the blockage of the VHI effect on the cells. Consistently, AEW-541 treatment blocked Akt and ERK1/2 hyper phosphorylation and restored p21 and 27 levels in AV-treated cells ( Figure 5D).
Discussion
We present here a new method to screen potential anti-cancer botanical combinations, based on their classification according to ROS involvement in their mechanism of action. Since ROS involvement in anti-cancer activity of botanicals is very common, as shown previously [25,30], our classification and screening method can be a very effective tool in future finding of new potentially useful combinations. The main idea of this screening method is at the first step to distinguish between toxic (to cancer cells) and non-toxic botanicals by simple viability assay after treatment with the botanicals of choice; then to repeat the assay with potentially toxic botanicals using a ROS-neutralizing agent pyruvate [8], thereby distinguishing between ROS-dependent and ROS-independent botanicals. At the third stage, the costumed screening presented here have the following advantages: (1) It allows to avoid multiple dose points required for CI calculations when at least one of the botanicals is non-toxic, and to perform the synergy screen by single-dose treatment; (2) It allows similar one-dose screening for TNR and TR botanicals pairs in TNR-insensitive cells; (3) Suggests that ROS inducing botanicals (TR) probably have an additive effect, as expected from substances with similar mechanism of action [25]. Altogether, our screening method allows a simple, organized and effective way for screening of potentially synergic combinations and suggests including the analysis of ROS involvement as a necessary step, since according to our previous finding, the majority of potentially anti-cancer botanicals work through this mechanism.
This approach led us to the discovery of a strong synergic combination of two botanicals-Astragalus membranaceus and Vaccaria hispanica, AV. Both botanicals were previously shown to inhibit cancer cells proliferation [4,[13][14][15][16][17]20,31,32]. However, the combined effect of A. membranaceus and V. hispanica is investigated here for the first time. We previously showed that both botanicals inhibit cancer cells through ROS-independent mechanisms [25]. Moreover, since they selectively inhibit different sets of cells [25], they probably work through different mechanisms.
Dose-effect and time-effect curves showed that the AV combination is not only much more effective than each of the botanicals alone, but is also effective against cells insensitive to either of them. There are two possible explanations for this phenomenon: either one of the botanicals accelerates\improves the action of the other, thereby turning it effective against previously insensitive cells, or the combination works through a different mechanism. Additional studies are required to answer this question.
Cancer cells are often characterized by hyper activation of proliferation and survival pathways. Consequently, investigators of new drugs usually expect to find inhibition of these pathways [33]. However, here we observed a very different situation: Akt and ERK1/2 pathways were hyper activated by AV treatment, while the cell cycle control proteins p21 and p27 were strongly down regulated, but despite this apparent stimulation of key proteins in proliferation and survival pathways, the AV treatment led to the inhibition of proliferation and induction of apoptosis. Moreover, the cells accumulated in G2/M phase of the cell cycle, as shown by cyclin A accumulation and FACS analysis. Altogether, these results suggest that AV treatment interferes with cell cycle, possibly pushing cells to proliferate beyond their ability. The fact that AV treatment abrogated starvation-induced slow-down of proliferation, further supports this hypothesis. Pushing cancer cells to proliferation by loosening checkpoint proteins in order to increase replicative stress has been proposed previously as a potential anti-cancer strategy [34]. However, there are currently no available drugs working through such mechanism.
Interestingly, prevention of AV-induced Akt or ERK1/2 hyper activation by PI3K and MEK1/2 inhibitors, respectively, did not rescue the cells. However, IGF1R inhibitor AEW-541 rescued all AV-treated cells and VHI-treated PANC-1 and T24 (VHI-sensitive) cells, suggesting that the VHI anti-cancer mechanism may be part of AV's effect. As expected, AEW-541 prevented hyper activation of Akt and ERK1/2 and partially abrogated p21 and p27 down regulation. However, additional studies are needed to address the role of these proteins in the AV mechanism of action.
The major limitation of this study is mainly descriptive and initial nature of the investigation of the mechanism of AV action. The second limitation is the lack of the studies of the effect of each individual botanical and its constituents (which can vary depending on the climate change, geographic region, harvesting process and so on) on the biological effect of AV and the analyzed pathways. Isolating the relevant compounds may enhance the observed synergistic effect and promote the investigation of exact mechanism of action by reducing the influence of irrelevant compounds. In addition, we have to validate our findings in an in vivo system. These issues will be addressed in further studies.
Conclusions
Altogether, our results show that the AV combination, discovered through our classificationbased screening method, has strong synergic anti-cancer effects, probably involving interference with the cell cycle and loosening cell cycle checkpoints. Additional studies are required to validate the effect of the AV combination on a wide range of cancer cell types, in order to better understand its mechanism of action and its potential as an anti-cancer therapy. Informed Consent Statement: Informed consent was obtained from all subjects involved in the study.
Data Availability Statement:
The data presented in this study are available on request from the corresponding author.
Conflicts of Interest:
The authors declare no conflict of interest.
|
v2
|
2022-12-12T05:22:30.322Z
|
2022-11-26T00:00:00.000Z
|
254535148
|
s2orc/train
|
The Chick Embryo Xenograft Model for Malignant Pleural Mesothelioma: A Cost and Time Efficient 3Rs Model for Drug Target Evaluation
Simple Summary Malignant pleural mesothelioma is a cancer of the lung lining, normally caused by asbestos, that develops decades after exposure. Chemotherapy, and recently more targeted drugs, show some benefit although only a minority of patients respond and invariably the cancer eventually escapes control. Several key genetic changes in mesothelioma differ from patient to patient, which may influence how their cancer responds to treatments. We have developed a new preclinical model using fertilised hen’s eggs as an alternative to laboratory rodents. Mesothelioma cells are labelled to allow monitoring of tumour growth and/or regression using fluorescence and longitudinal bioluminescence imaging in addition to histology. All cell lines tested efficiently form tumour nodules within seven days, supported by a blood supply and stromal chick cells. The model is rapid, cost effective, scalable, and adaptable with multiple potential endpoints, to enable evaluation of drug targets against the range of common mesothelioma genetic backgrounds. Abstract Malignant pleural mesothelioma (MPM) has limited treatment options and poor prognosis. Frequent inactivation of the tumour suppressors BAP1, NF2 and P16 may differentially sensitise tumours to treatments. We have established chick chorioallantoic membrane (CAM) xenograft models of low-passage MPM cell lines and protocols for evaluating drug responses. Ten cell lines, representing the spectrum of histological subtypes and tumour suppressor status, were dual labelled for fluorescence/bioluminescence imaging and implanted on the CAM at E7. Bioluminescence was used to assess viability of primary tumours, which were excised at E14 for immunohistological staining or real-time PCR. All MPM cell lines engrafted efficiently forming vascularised nodules, however their size, morphology and interaction with chick cells varied. MPM phenotypes including local invasion, fibroblast recruitment, tumour angiogenesis and vascular remodelling were evident. Bioluminescence imaging could be used to reliably estimate tumour burden pre- and post-treatment, correlating with tumour weight and Ki-67 staining. In conclusion, MPM-CAM models recapitulate important features of the disease and are suitable to assess drug targets using a broad range of MPM cell lines that allow histological or genetic stratification. They are amenable to multi-modal imaging, potentially offering a time and cost-efficient, 3Rs-compliant alternative to rodent xenograft models to prioritise candidate compounds from in vitro studies.
Introduction
Malignant pleural mesothelioma (MPM) is an aggressive cancer of the lung lining, mainly caused by environmental exposure to asbestos. Despite strict asbestos regulation in most high-income countries, the global incidence of MPM has not yet peaked, and it is predicted to remain a significant cause of morbidity and mortality for decades [1]. MPM is commonly categorised as three main histopathological types, epithelioid, sarcomatoid or biphasic, which may represent a continuous spectrum of disease [2]. Invasion into the surrounding stroma is a diagnostic criterion [3]. MPM has extensive interactions with immune and stromal cells in the tumour microenvironment, in particular fibroblasts and endothelial cells. Asbestos causes fibrotic disease, with a desmoplastic reaction often evident in MPM that suggests involvement of cancer-associated fibroblasts (CAFs) [4]. Indeed, MPM recruits and activates CAFs to promote tumour progression through growth factor and cytokine networks in murine models [5]. Tumour angiogenesis also plays an important role in the pathogenesis of MPM, which commonly express vascular endothelial growth factor (VEGF) [6].
MPM is almost invariably incurable, even in early presentation, and chemotherapy benefits are very modest. Combination cisplatin and pemetrexed was the mainstay of treatment for over 20 years [7], with potential additional benefit from the VEGF antibody bevacizumab [8], until the recent licencing of immunotherapy. Combined nivolumab and ipilimumab treatment provides real clinical benefit [9], however not all patients are eligible, and most who are treated progress within a year. Therefore, an urgent need for further treatment options remains. Other targeted therapies have been slow to emerge for MPM, which lacks common oncogenic drivers, and instead is characterised by loss-offunction mutations in tumour suppressors, most commonly BAP1, P16 and NF2 [10,11]. Nevertheless, genetic loss of tumour suppressors or other epigenetic alterations may sensitise MPM to targeted therapies, with arginine deprivation and CDK4/6, PARP or EZH2 inhibitors now showing promise in early phase trials [12][13][14][15]. However, benefits vary widely with histological and genetic features in this heterogeneous disease and may be restricted to a small percentage of patients, whilst robust predictive biomarkers remain elusive. As more complete understanding of MPM biology emerges this offers hope for new therapeutic strategies and suitable patient stratification. However, to realise this potential, effective preclinical models are required to translate discovery science into clinical application.
Preclinical models that are currently used or in development for MPM were recently reviewed [16,17]. More than 100 cell lines derived from human MPM are available for in vitro culture to investigate cell biology or drug sensitivity [16]. Their inherent drawbacks, such as adaptation during two-dimensional (2D) culture, and a lack of heterogeneity, 3D architecture or microenvironment interactions, may be partially mitigated by using a sufficient number and diversity of low passage cell lines, growth as spheroid cultures [18], or co-culture with immune or stromal cells [19,20]. Organoid or explant models that better recapitulate tumour heterogeneity, 3D structure, and microenvironment in vitro require access to fresh MPM patient tissue. Explant cultures have been used successfully in MPM [21,22] although explants typically retain tumour architecture for just a few days and are prone to necrosis [23]. In contrast, proposed organoid cultures for MPM [16] could be sustained in longer term culture but lack contextual architecture. Currently, a vascularised 3D architecture and microenvironment can only be achieved using in vivo models in protected animals. Established human MPM cell lines or patient-derived tissues may be used for sub-cutaneous or orthotopic xenografts in immune compromised mice, although this typically precludes study of tumour/immune cell interactions [24][25][26]. Alternative immunocompetent in vivo MPM models rely on induction by asbestos or long carbon nanotubes in rodents, which can accelerate MPM development in genetically engineered mice with mutation of relevant tumour suppressor genes [27][28][29][30][31][32]. However, in addition to being expensive and slow to establish, these models often rely on procedures of high severity, and their utility may be limited by variable histopathology and species-specific gene associ-ations [16]. Thus, a spectrum of MPM preclinical models is required for prioritising new therapeutic candidates and modelling different aspects of the human disease, to deliver meaningful preclinical data whilst supporting the replacement, reduction, and refinement of the use of animals (3Rs). Notably, a 3Rs compliant in vivo model that recapitulates aspects of 3D tumour architecture and microenvironment is currently lacking for MPM.
Fertilised hen's eggs provide a non-protected in vivo model that does not require an animal licence until a specified stage of embryonic development, as defined by national regulations; in the UK this is two thirds of the gestation period. The chick embryo chorioallantoic membrane (CAM) is a rich source of oxygen and growth factors [33,34] and was first used to grow chicken sarcoma cells over a century ago [35]. A wide range of human cancer cells including melanoma, neuroblastoma, breast, colorectal and pancreatic cancer have subsequently been xenografted on the CAM [33]. However, despite one study providing proof of principle for use of patient-derived mesothelioma tissue [36], this has not been adopted by the field, and no CAM models have yet been developed with MPM cell lines. For other cancers, 3D vascularised tumours form within days, providing a rapid and costeffective alternative to rodent xenografts. The chick embryo model allows monitoring of the major hallmarks of cancer including proliferation, angiogenesis, invasion, and metastasis, whilst recent studies demonstrate the feasibility of drug administration and utility of preclinical imaging [33,34,[37][38][39][40]. We propose that incorporating such methodology into new MPM-CAM models will enhance the drug testing pipeline, for example by providing initial in vivo evaluation to reduce the use of protected animal models. We set out to develop robust standard operating protocols (SOPs) for establishing MPM-CAM xenograft models and to characterise the biology of the tumour nodules, which could in future enable a stratified approach to drug assessment.
Accordingly, we report here validated protocols that allow the efficient generation of xenografts on the CAM using a panel of well-characterised low passage MPM cell lines, which represent the spectrum of histopathology and tumour suppressor inactivation seen in the human disease. Importantly, the engrafted MPM nodules exhibit interactions with chick fibroblasts and vasculature, mimicking key facets of clinical MPM that are absent from in vitro cultures and which may influence therapeutic outcomes. We also show that bioluminescence imaging (BLI) can readily be used to evaluate MPM tumour burden over time, reducing inter-egg variability in tumour nodule measurements to minimise the number of embryos required to power studies. The protocols we describe for this new MPM-CAM preclinical model make it amenable to rapid, medium throughput evaluation of MPM cell biology in relation to genetics or therapeutics. Readouts, including multimodal imaging, transcriptional and histopathological analysis can be combined to monitor tumour size, survival, vascularisation, invasion, stromal composition, and proliferative capacity, and may in future be expanded to include markers of drug sensitivity or target engagement.
Dual Labelling of Cell Lines
Mesothelioma cell lines were transduced with lentiviral particles carrying pHIV-Luc-ZsGreen (a gift from Bryan Welm; RRID: Addgene_39196). Lentiviral particle generation and cell line transduction were performed as previously described [45]. Transduction efficiency was assessed via fluorescence using a Nikon Eclipse Ti and CFI Plan-Fluor 10X (N.A.0.3) objective (Nikon, Tokyo, Japan).
In Vitro Bioluminescence Measurement
Dual labelled cells were seeded in 96 well plates (black walled, clear bottom; Corning, Glendale, AZ, USA; cat#3603) using a 1:2 serial dilution to give a range of 500 to 500,000 cells/well. The luciferase assay was performed after 4 h once cells had adhered to the plate. Media was replaced with 100 µL media containing 150 µg/mL luciferin (Promega, Madison, WI, USA; E1605). After 10 min incubation at room temperature, the bioluminescence signal was acquired using an IVIS Spectrum In Vivo Imaging System (Perkin Elmer, Waltham, MA, USA; Open filter, FOV = C, Imaging subject: in vivo). All bioluminescent signal was quantified using the Living Image Software (IVIS Imaging Systems, Perkin Elmer, Waltham, MA, USA).
Xenograft Generation
Fertilised Bovan Brown eggs (Henry Stewart Co., Ltd., Fakenham, UK) were incubated at 37 • C and 45% humidity (embryonic day 0; E0) in a specialised poultry incubator (Brinsea OvaEasy 380 Advance EX Series II Automatic Egg Incubator). Eggs were laid horizontally in incubation trays (Brinsea, Weston-super-Mare, UK), and the upward facing side marked to indicate the location for the window to be cut. For the duration of E0-E3, the incubator shelves were set to alternate tilting 45 degrees every 45 min. For in ovo experiments, E3 eggs were windowed by puncturing the wide base of the egg (air cell) with an egg piercer to remove about 5 mL of albumen with a 23 G needle, before sealing the hole with Nev's Ink tape. Another hole was pierced on the labelled side of the egg, a 3 cm piece of 25 mm 3 M Scotch Magic invisible tape applied, and sharp scissor tips inserted into the pierced hole to carefully cut three sides (2 cm × 1 cm × 2 cm) of a rectangle to create a window in the eggshell. The fenestration area was sealed with approximately 4 cm of 25 mm 3 M Scotch Magic invisible tape, leaving a small tab to enable re-opening of the window, and eggs were placed back into the incubator until E7.
For ex ovo experiments, eggs were gently cracked at E3 and the contents transferred to UV-sterilised black weighing boats (Starlab, Hamburg, Germany). These were placed inside sterile 150 cm 2 tissue-culture flasks with re-closable lids (Techno Plastic Products AG, Trasadingen, Switzerland) containing sterile water to maintain humidity and incubated until E7 in a Brinsea OvaEasy 360 incubator.
Prior to implantation on E7, cells were collected by trypsinisation, counted, washed in sterile phosphate-buffered saline (PBS), and pelleted via centrifugation. Experiments were optimised by implanting between 0.5 × 10 6 and 2 × 10 6 cells per egg in 10-15 µL; with 2 × 10 6 cells implanted on a minimum of 12 eggs per cell line for the main experiments. Prior to adding the cells, the CAM was traumatised using a 1 cm wide strip of sterile gauze swab, causing a small bleed. The cells were directly pipetted onto this region of the CAM, without any support structure such as Matrigel or a silicon ring. Eggs were resealed and incubated until E14. Chick survival and tumour progression were monitored during experiments, with bioluminescence imaging (BLI) performed prior to fluorescence imaging and tumour dissection at E14.
In Vivo Bioluminescence Imaging (BLI)
Prior to dissection on E14, viability of tumours was routinely assessed by BLI with images acquired using an IVIS Spectrum In Vivo Imaging System (Open filter, FOV = C, Imaging subject: Other). For BLI, 250 µL of 15 mg/mL luciferin (Promega, Madison, WI, US; E1605) was injected into the yolk sac using a BD Micro-Fine 0.5 mL insulin syringe with 29 G needle (BD Biosciences, Franklin Lakes, NJ, USA), avoiding blood vessels. To determine the optimal post-injection timepoint for in vivo imaging, a chick with a visible tumour nodule at E14 was selected for each dual-labelled cell line and bioluminescence images acquired every 3 min for 2 h. A steady state maximal signal was reached by 45 min in each case, so this timepoint was used for all image acquisition. Where longitudinal BLI was carried out, the same procedure was followed on the indicated days. Bioluminescent signal was reported as total flux (radiance: p/sec/cm 2 /sr).
Fluorescence Imaging and Tumour Dissection
Following BLI at E14, tumours were imaged under a Leica M165FC fluorescence stereomicroscope with 16.5:1 zoom optics, fitted with a Leica DFC425 C camera (Leica Biosystems, Wetzlar, Germany). Tumours were imaged in ovo on the CAM and then dissected. Briefly, extra-fine straight-tip tweezers were utilised to manipulate the CAM to allow a sizeable circumference to be cut around the tumour nodules with spring bow micro scissors. Excised tumour nodules were placed in sterile PBS for ex ovo imaging. After removing any excess CAM, dissected tumours were weighed on a fine balance, and processed for immunohistochemical or transcriptional analyses. Following removal of the tumour, embryos were terminated in accordance with the UK Animals Scientific Procedures Act 1986 (amended 2012), under which the chick embryo is classified as non-protected until two thirds of gestation is reached at E14. No home office approval is required, and procedures were reviewed by the Liverpool Animal Welfare and Ethical Review Body.
Immunohistochemistry
Immediately after dissection tumour samples were placed in 1 mL 10% neutral Louis, MO, USA). Images of the slides were acquired using digital slide scanners (Leica Aperio CS2 digital slide scanner or Zeiss Axioscan Z1).
Digital Image Analysis of Ki-67
Digitalised whole slide images of tumour nodules stained for Ki-67 were scored using open-source, digital pathology software QuPath version 0.2.0-m7 [46]. Briefly, 10 DABpositive and 10 DAB-negative cells were manually selected as a training cohort to identify Ki-67 positive and negative cells, respectively. The tumour nodule was delineated manually using the wand tool prior to watershed nucleus detection (settings: requested pixel size 0.5 µm; background radius 8.0 µm; sigma 1.5 µm; min/max area 10/400 µm; threshold 0.1; maximum background intensity 2.0; and cell expansion 5 µm), which was optimised visually. The detection threshold value for Ki-67 positive cells (nucleus DAB OD mean) was manually set to 0.1 for all slides, following visual assessment. All measurements were exported into Excel to calculate the percentage of Ki-67 positive cells.
Analysis of CAM Vasculature
Microscopy RGB images of tumour nodules on top of the CAM were cropped to an area of approximately 1000 µm around the tumour nodule. A region of interest excluding the tumour was selected for analysis. The IKOSA CAM Assay (KML Vision, Graz, Austria) was used to determine the mean vessel thickness, as well as the total vessel area, total vessel length, and number of branching points normalised to the area analysed.
Magnetic Resonance Imaging (MRI)
MRI was performed using a horizontal bore 9.4 T Bruker Biospec 94/20 USR system (Bruker Scientific Instruments, Billerica, MA, USA). Following 10 min incubation at 4 • C, the egg was placed in a custom-built cradle, and an actively decoupled 3 cm diameter surface coil was affixed on the eggshell above the site of the tumour. An 86 mm volume coil was used for signal transmission, while the surface coil was used for signal detection. Initially scout images were acquired using a three-plane gradient echo sequence to localise the tumour. High resolution 3D images were subsequently acquired using a 3D Turbo-RARE (spin-echo, T2-weighted) pulse sequence with the following parameters: field of view 40 mm × 40 mm, matrix size 400 × 400 × 20, TR/TE = 1800/6.8 ms, effective TE: 80.74 ms, echo train length 8, slab thickness = 2 mm, averages 1, flip angle 90, scan time of approximately 8 min.
Statistical Analysis
Statistical analyses were performed in GraphPad Prism version 9 for Mac (GraphPad Software, San Diego, CA, USA). Distribution of data was assessed by Shapiro-Wilk test and data were analysed by parametric or non-parametric tests as appropriate. The number of independent samples, definition of error bars, and the statistical test employed are described in relevant figure legends. p values less than 0.05 were considered significant.
Dual-Labelled MPM Cell Lines Efficiently Engraft on the CAM to Form Tumour Nodules
We selected ten MPM cell lines to test their establishment as CAM xenografts. The majority were quite newly established well-characterised early passage cell lines sourced through Mesobank [44], but we included the MSTO-211H cell line as a comparator that was established in long term culture several decades ago [41]. Together the ten cell lines represent the three major histological subtypes of MPM and common combinations of intersectional inactivation for the three key tumour suppressors ( Figure 1A). All cell lines were dual-labelled with luciferase and ZsGreen, a human codon-optimised variant of Zoanthus sp. green fluorescent protein with bright fluorescence and high expression in mammalian cells. Labelling efficiency was around 90% in each cell line as assessed by fluorescence microscopy (Figures 1B and S1A). Co-labelling with Firefly luciferase enabled BLI on addition of luciferin to measure cellular ATP as an estimate of viable MPM cell content within tumour nodules ( Figures 1C and S1B).
were dual-labelled with luciferase and ZsGreen, a human codon-optimised variant of Zoanthus sp. green fluorescent protein with bright fluorescence and high expression in mammalian cells. Labelling efficiency was around 90% in each cell line as assessed by fluorescence microscopy ( Figures 1B and S1A). Co-labelling with Firefly luciferase enabled BLI on addition of luciferin to measure cellular ATP as an estimate of viable MPM cell content within tumour nodules ( Figures 1C and S1B). The methodology for establishment of MPM-xenografts is fully described in the methods section and illustrated in Figure 2. Briefly, to initiate development at E0 fertilised hen's eggs were placed in an egg tray in a specialised poultry incubator ( Figure 2A). On E3, a rectangular window was cut in the eggshell to make the CAM accessible and allow observation of tumour formation, progression, and embryo health ( Figure 2B,C). This was reattached with tape ( Figure 2Civ) and eggs immediately placed back into the incubator. The window was opened on E7 to check embryo survival and any dead or unfertilised eggs were discarded. Viable eggs with a properly developing embryo ( Figure 2D) were used for implantation of MPM cells onto the CAM, then placed back into the incubator. On E14, eggs were examined under a fluorescence stereomicroscope to identify potential tumour formation. The use of ZsGreen-labelled cells allowed sensitive detection of even small tumour nodules, although in most instances MPM nodules were of substantial size and easily visible by eye ( Figure 2E). The methodology for establishment of MPM-xenografts is fully described in the methods section and illustrated in Figure 2. Briefly, to initiate development at E0 fertilised hen's eggs were placed in an egg tray in a specialised poultry incubator (Figure 2A). On E3, a rectangular window was cut in the eggshell to make the CAM accessible and allow observation of tumour formation, progression, and embryo health ( Figure 2B,C). This was reattached with tape ( Figure 2Civ) and eggs immediately placed back into the incubator. The window was opened on E7 to check embryo survival and any dead or unfertilised eggs were discarded. Viable eggs with a properly developing embryo ( Figure 2D) were used for implantation of MPM cells onto the CAM, then placed back into the incubator. On E14, eggs were examined under a fluorescence stereomicroscope to identify potential tumour formation. The use of ZsGreen-labelled cells allowed sensitive detection of even small tumour nodules, although in most instances MPM nodules were of substantial size and easily visible by eye ( Figure 2E).
We initially selected four cell lines to optimise the number of MPM cells for efficient in ovo implantation. In each case, 0.5, 1 or 2 million cells were implanted at E7, and the number of eggs with a visible tumour nodule and BLI signal was monitored at E14. Before taking experimental readings, the in vivo kinetics of xenograft bioluminescence was determined for each MPM cell line following injection of luciferin into the yolk sac (example in Figure S1); in every case steady state was reached by 45 min. At least 1 million cells were required for MPM#34 and MPM#26 to form nodules, whilst for most cell lines 2 million cells yielded the best engraftment on the CAM, producing more viable tumour nodules of a sufficient size for post-processing ( Figure 3A). This protocol and cell number were therefore adopted for implantation of the other MPM cell lines, all of which we found could form vascularised tumours on the CAM, irrespective of histological subtype or genetic background ( Figure 4). For embryos that survived until E14 (Table S1) engraftment rates, based on the formation of a viable 3D nodule, ranged from 43% to 85% and were highest for the epithelioid cell lines, which ranged from 75% to 85% with a mean nodule formation rate of 80% ( Figure 3B). , a hole is made in the wide base of the egg (i; arrowhead) to allow 5 mL albumin to be removed and then sealed with Nev's label tape (ii); (C) To create the window, a hole is pricked in the eggshell as a starting point (arrowhead) and a piece of Scotch tape placed over the area where the window is to be cut (i). Scissors are used to the cut the window (ii) leaving one side attached (iii). The window is then sealed shut with Scotch tape (iv); (D) Cells are implanted on E7 by removing the window (i) to expose CAM underneath (ii). Once cells have been added to the CAM, the window is sealed shut again (Civ); (E) At E14 the window is enlarged (i) to allow inspection of the embryo and imaging of tumour nodules (ii).
We initially selected four cell lines to optimise the number of MPM cells for efficient in ovo implantation. In each case, 0.5, 1 or 2 million cells were implanted at E7, and the number of eggs with a visible tumour nodule and BLI signal was monitored at E14. Before taking experimental readings, the in vivo kinetics of xenograft bioluminescence was determined for each MPM cell line following injection of luciferin into the yolk sac (example in Figure S1); in every case steady state was reached by 45 min. At least 1 million cells were required for MPM#34 and MPM#26 to form nodules, whilst for most cell lines 2 million cells yielded the best engraftment on the CAM, producing more viable tumour nodules of a sufficient size for post-processing ( Figure 3A). This protocol and cell number were therefore adopted for implantation of the other MPM cell lines, all of which we found could form vascularised tumours on the CAM, irrespective of histological subtype or genetic background (Figure 4). For embryos that survived until E14 (Table S1) engraftment rates, based on the formation of a viable 3D nodule, ranged from 43% to 85% and were highest for the epithelioid cell lines, which ranged from 75% to 85% with a mean nodule formation rate of 80% ( Figure 3B). , a hole is made in the wide base of the egg (i; arrowhead) to allow 5 mL albumin to be removed and then sealed with Nev's label tape (ii); (C) To create the window, a hole is pricked in the eggshell as a starting point (arrowhead) and a piece of Scotch tape placed over the area where the window is to be cut (i). Scissors are used to the cut the window (ii) leaving one side attached (iii). The window is then sealed shut with Scotch tape (iv); (D) Cells are implanted on E7 by removing the window (i) to expose CAM underneath (ii). Once cells have been added to the CAM, the window is sealed shut again (Civ); (E) At E14 the window is enlarged (i) to allow inspection of the embryo and imaging of tumour nodules (ii). Table S1. The number of viable engrafted eggs at E14 for each cell line is shown above the bars on each graph. All experiments were in ovo. Table S1. The number of viable engrafted eggs at E14 for each cell line is shown above the bars on each graph. All experiments were in ovo.
Different MPM Cell Lines Establish Morphologically Distinct CAM Nodules That Exhibit Local Invasion and Recruit Chick Fibroblasts and Vasculature
The size and shape of tumour nodules varied between MPM cell lines ( Figure 4). Nodules were examined in situ from above (overlay, third column), then dissected to view the underneath (overlay, sixth column). In general, the epithelioid cell lines formed larger nodules, whilst biphasic and sarcomatoid cells formed smaller nodules, with the notable exception of the very large nodules formed by the long established biphasic MSTO-211H cell line (Figure 4). Sarcomatoid nodules also appeared less well vascularised than those of other histopathological types.
Two epithelioid cell lines formed nodules with different gross morphology; MESO-12T (P16, NF2 altered) typically formed nodules above the CAM whilst MESO-8T (P16, NF2, BAP1 altered) nodules were often found beneath the CAM (Figure 4). We stained FFPE sections from the nodules to further explore their structure and composition ( Figure 5). MPM cells are typically immunoreactive for pan-cytokeratin [49], staining for which clearly identified the MPM tumour cells and highlighted their morphological arrangement within the nodule. Sagittal sectioning through a MESO-12T nodule showed a raised spherical structure with densely packed tumour cells (Figures 5A and S2A). In contrast, a MESO-8T sagittal section revealed a flat patch of cells having a large plane of contact with the underlying CAM, and local invasion of MESO-8T cells through the chorionic epithelium into the mesenchyme where a nodule of more loosely packed tumour cells formed ( Figures 5B and S3A). In both cases, cytokeratin positive tumours cells corresponded with regions that stained either positive or negative for nuclear BAP1 according to their BAP1 status ( Figures S2A,B and S3C) and were intermingled with cells not stained for cytokeratin ( Figure 5A,B).
Interaction of MPM cells with their microenvironment is crucial to progression of the human disease, where the cancer cells can instigate fibroblast infiltration [5]. We therefore wondered if the cytokeratin-negative cells within CAM nodules may be infiltrating chick fibroblasts. Indeed, profuse infiltration of fibroblast-like cells that stained strongly for αSMA was evident amongst the tumour cells above the CAM in sagittal sections of both MESO-8T and MESO-12T nodules ( Figure 5A right, Figure 5B right). Similar intermingling of the two cell types were evident in transverse sections of additional nodules formed by these and other MPM cell lines ( Figures 5C,D, S3 and S8), with encapsulation of nodules by fibroblast-like cells sometimes observed ( Figure 5D). In all cases, we saw mutually exclusive distribution of the strongly stained αSMA or pan-cytokeratin immunoreactive cells within the CAM nodules, with the strongly αSMA-positive cells displaying different morphology to the tumour cells. To rule out any possibility that these might be MPM cells that had undergone epithelial-mesenchymal transition (EMT), immunofluorescent staining was also performed on a frozen tissue section from MESO-8T nodule ( Figure S4). The αSMA-positive cells exhibit the same morphology seen by IHC and are clearly distinct from the Zs-Green labelled MPM cells, confirming that they derive from the chick.
The chick vasculature is also immunoreactive for αSMA, revealing tumour-adjacent blood vessels within the CAM (Figures 5C, S3A and S6A). Internal vascularisation was also seen within the MPM nodules evidencing tumour angiogenesis; the degree and phenotype of this intratumoural vasculature varied between cell lines and appeared particularly extensive within MESO-8T nodules ( Figures S3A,B and S8).
MPM Tumour Nodules Express VEGF and Remodel the CAM Vasculature
Given the histological evidence for local invasion and tumour vascularisation, we wondered whether the microenvironment on the CAM stimulated an invasive and angiogenic transcriptional program in the MPM cells. RNA was extracted for qRT-PCR from MSTO-211H cells grown either in vitro in 2D, or in ovo as a 3D CAM xenograft. The C q values for ACTB and GAPDH housekeeping genes were unaffected by the switch from 2D culture to 3D CAM ( Figure S5). However, there was a significant increase in expression of both the metastasis-associated matrix metallopeptidase MMP9, and the growth factor VEGF that induces proliferation and migration of vascular endothelial cells ( Figure 6). Interaction of MPM cells with their microenvironment is crucial to progression of the human disease, where the cancer cells can instigate fibroblast infiltration [5]. We therefore Figure S3C. All experiments were in ovo and at least two nodules were examined per cell line. ogenic transcriptional program in the MPM cells. RNA was extracted for qRT-PCR from MSTO-211H cells grown either in vitro in 2D, or in ovo as a 3D CAM xenograft. The Cq values for ACTB and GAPDH housekeeping genes were unaffected by the switch from 2D culture to 3D CAM ( Figure S5). However, there was a significant increase in expression of both the metastasis-associated matrix metallopeptidase MMP9, and the growth factor VEGF that induces proliferation and migration of vascular endothelial cells ( Figure 6). Mean expression shown relative to the mean of ACTB and GAPDH (2 ∆Cq ), error bars SD, unpaired ttest, * p < 0.05, ** p < 0.01. Supporting data for housekeeping genes in Figure S5. All experiments were in ovo.
We also observed that MPM xenografts remodel the typical branching pattern of the CAM vasculature into a radial pattern of vessels recruited into the nodule ( Figure 7A,B). IKOSA CAM assay software was used to create an analysis mask to quantify parameters for vessels on the control CAM or immediately adjacent to the xenografts ( Figure 7C,D). On normalisation to the analysis area, the total vessel lengths measured on tumour bearing CAM were significantly lower than for the control CAM ( Figure 7E). This was We also observed that MPM xenografts remodel the typical branching pattern of the CAM vasculature into a radial pattern of vessels recruited into the nodule ( Figure 7A,B). IKOSA CAM assay software was used to create an analysis mask to quantify parameters for vessels on the control CAM or immediately adjacent to the xenografts ( Figure 7C,D). On normalisation to the analysis area, the total vessel lengths measured on tumour bearing CAM were significantly lower than for the control CAM ( Figure 7E). This was generally associated with decreased total vessel area and the density of branching points around MPM CAM xenografts and a trend towards increased vessel thickness ( Figure 7E). Thus, MPM xenografts typically remodel the surrounding CAM vasculature to recruit large, less branched feeder vessels. This 3D vascular network around the xenograft can be visualised by MRI (Figures 7F and S6B). Intratumoural vascularisation shows branching of these feeder vessels occurs within MPM nodules to sustain the xenografts ( Figures 5C, S3A and S8).
Bioluminescence Imaging Estimates MPM Tumour Burden and Viability
The CAM xenografts exhibit size, architecture and microenvironment phenotypes that are in part defined by the MPM cell line. However, all cell lines can form vascularised nodules within 7 days that exhibit some fibroblast-like infiltrate, reflecting key aspects of the human disease and supporting utility of the model for testing therapeutic interventions. We therefore evaluated protocols to facilitate quantitative assessment of tumour burden and viability. For each MPM cell line, engrafted nodules established from 2 million cells were subject to BLI at E14 to assess tumour viability before dissecting the nodules away from the CAM and weighing (Figure 8). The mean tumour weight for many MPM cell lines was between 5 mg and 7 mg, whilst nodules formed by MESO-8T, MESO-12T and MSTO-211H were substantially larger with mean weights between 15 mg and 17 mg ( Figure 8A) reflecting visual assessment (Figure 4).
BLI measurements exhibit a much larger dynamic range ( Figure 8B) but reflect the trends for tumour weight. Interestingly, nodules established by biphasic MPM had proportionally higher mean BLI readings relative to tumour weight than epithelioid nodules. As BLI signal is proportional to cellular ATP, this may suggest a generally higher metabolic rate in biphasic compared to epithelioid CAM xenografts. Alternatively, epithelioid nodules may have greater infiltration of chick stromal cells that contribute to tumour weight but not BLI signal. Despite this, comparing individual xenografts across all the cell lines, BLI provided a reasonable estimate of MPM tumour burden compared to tumour weight ( Figure 8C, Spearman r = 0.39, p = 0.0015). This relationship appeared more robust in some cell lines than others ( Figure S7), again likely reflecting the degree to which individual MPM cell lines instigate chick cell infiltration ( Figure 5) and their proliferative capacity on the CAM (Figure 9). Therefore, in addition to being very sensitive and relatively high throughput, BLI can provide additional information to interpret MPM xenograft growth or regression, especially if used longitudinally and in combination with end-point histological markers to assess nodule composition and proliferation. generally associated with decreased total vessel area and the density of branching points around MPM CAM xenografts and a trend towards increased vessel thickness ( Figure 7E). Thus, MPM xenografts typically remodel the surrounding CAM vasculature to recruit large, less branched feeder vessels. This 3D vascular network around the xenograft can be visualised by MRI (Figures 7F and S6B). Intratumoural vascularisation shows branching of these feeder vessels occurs within MPM nodules to sustain the xenografts (Figures 5C, S3A and S8). burden and viability. For each MPM cell line, engrafted nodules established from 2 million cells were subject to BLI at E14 to assess tumour viability before dissecting the nodules away from the CAM and weighing (Figure 8). The mean tumour weight for many MPM cell lines was between 5 mg and 7 mg, whilst nodules formed by MESO-8T, MESO-12T and MSTO-211H were substantially larger with mean weights between 15 mg and 17 mg ( Figure 8A) reflecting visual assessment (Figure 4). BLI measurements exhibit a much larger dynamic range ( Figure 8B) but reflect the trends for tumour weight. Interestingly, nodules established by biphasic MPM had proportionally higher mean BLI readings relative to tumour weight than epithelioid nodules. As BLI signal is proportional to cellular ATP, this may suggest a generally higher metabolic rate in biphasic compared to epithelioid CAM xenografts. Alternatively, epithelioid nodules may have greater infiltration of chick stromal cells that contribute to tumour weight but not BLI signal. Despite this, comparing individual xenografts across all the cell lines, BLI provided a reasonable estimate of MPM tumour burden compared to tumour weight ( Figure 8C, Spearman r = 0.39, p = 0.0015). This relationship appeared more robust in some cell lines than others ( Figure S7), again likely reflecting the degree to which individual MPM cell lines instigate chick cell infiltration ( Figure 5) and their proliferative capacity on the CAM (Figure 9). Therefore, in addition to being very sensitive and relatively high throughput, BLI can provide additional information to interpret MPM xenograft Immunohistological staining for Ki-67 is widely used to estimate the proliferative index for FFPE tissue [50]. CAM nodules established from different MPM cell lines exhibit large differences in the percentage of tumour cells staining positive for Ki-67 at E14 (Figures 9A, S2, S3 and S8). Intriguingly, despite forming viable nodules two BAP1 negative cell lines, MESO-8T and MPM#2, had low Ki-67 staining, potentially indicating they spend longer in G0/G1 [51]. As the Ki-67 antibody did not stain chick cells, and we wanted to compare whole nodule measurements of weight, BLI and Ki-67 staining, QuPath was trained to derive the percentage of Ki-67-positive cells within representative nodules derived from three biphasic MPM cell lines ( Figures 9B and S9). We compared the MPM#2 xenografts (P16, NF2 and BAP1 altered) that had a very low percentage of tumour cells staining positive for Ki-67, to MPM#26 xenografts (P16 and NF2 altered) which stained moderately for Ki-67, and MSTO-211H xenografts (P16 altered) that had an extremely high frequency of Ki-67 staining. Importantly, the Ki-67 scores were highly correlated with BLI measurements for nodules from these cell lines ( Figure 9C, Pearson r = 0.96, p = 0.0023), reinforcing the utility of BLI as a live measurement for CAM xenografts that reflects not only tumour size but also tumour cell content and proliferative capacity. Considering the higher sensitivity of the BLI assay it may have utility even in less proliferative nodules where Ki-67 is hard to score.
Given the variability in both tumour weight and BLI signal for xenografts established from 2 million cells of any given cell line ( Figure 8A,B), we investigated the possibility of using longitudinal BLI to monitor nodules over time. Measurements can be taken at E10 and subsequently at two-day intervals to generate growth curves ( Figure 10A,B) although regular handling of the eggs with repeated luciferin injection into the yolk sack may reduce embryo survival. Mesothelioma is relatively resistant to standard chemotherapy, with cisplatin/pemetrexed showing only very modest clinical benefits and limited activity in vivo even with extended dosing [52,53]. While we have previously shown activity for cisplatin in CAM xenografts for a breast cancer cell line, our preliminary experiments showed no demonstrable activity in mesothelioma CAM xenografts. To develop a protocol for use in therapeutic testing, where eggs also need to be handled to dose with drugs, we therefore trialled an experimental timeline with vehicle control only ( Figure 10C). PBS was injected into the yolk sac of established MSTO-211H xenografts at E10 and E12. Two BLI measurements were taken, at E10 pre-treatment, and at E14 post-treatment ( Figure 10D). In this experiment, there was 80% survival between E10 to E14, and in 7 tumours the BLI signal increased by a mean of 4.40-fold (SD 1.82). Designing strategies using pre-and post-dosing BLI could reduce the effect of inter-egg variability on estimation of tumour burden, and so reduce the number of chick embryos required to fully power studies in line with 3Rs principles. Immunohistological staining for Ki-67 is widely used to estimate the proliferative index for FFPE tissue [50]. CAM nodules established from different MPM cell lines exhibit large differences in the percentage of tumour cells staining positive for Ki-67 at E14 (Figures 9A, S2, S3 and S8). Intriguingly, despite forming viable nodules two BAP1 negative BLI measurements were taken, at E10 pre-treatment, and at E14 post-treatment ( Figure 10D). In this experiment, there was 80% survival between E10 to E14, and in 7 tumours the BLI signal increased by a mean of 4.40-fold (SD 1.82). Designing strategies using preand post-dosing BLI could reduce the effect of inter-egg variability on estimation of tumour burden, and so reduce the number of chick embryos required to fully power studies in line with 3Rs principles.
Discussion
MPM remains an area of critical unmet clinical need, despite a growing understanding of the processes driving its development and spread. Capitalising on this is unfortunately slow and costly, with drug development often taking 10 years or more from concept to clinical application, and with an estimated cost of around a billion dollars in research costs for each drug entering practice. Research performed using cultured cell lines, or rodent models, has historically corresponded poorly to outcome in eventual clinical trials. Thus, a continuum of preclinical models is required to embody different aspects of a human disease to screen and validate drug responses. Here, we describe protocols and analysis for a novel 3Rs-compliant CAM model for MPM that is rapid, economical, scalable, and adaptable, and which covers the spectrum of MPM histopathological types and common genetic alterations. It provides a wide range of in vivo readouts of tumour biology and viability within days rather than months lending itself to development as a useful preclinical model.
The CAM proved to be a conducive environment for MPM, as all 10 cell lines that we tested engrafted very effectively, particularly the epithelioid MPM where, on average, viable nodules formed in 80% of cases. As the CAM model is very economical compared to in vivo approaches in rodents, this facilitates use of a sufficient number and diversity of low passage cell lines to capture some of the heterogeneity of MPM and encompass the common genetic changes. For future evaluation of therapeutics, this could facilitate identification of relatively small subgroups that are likely to respond and may prevent discard of viable compounds. The diverse readouts available for CAM xenografts can be tuned depending on the experimental question, enabling specific hallmarks of cancer to be monitored, for example when assessing anti-proliferative, anti-invasive or anti-angiogenic therapeutic compounds.
Xenografts are less able to recapitulate the histology of the original tumour when derived from cell lines established in 2D culture, compared to fresh patient derived samples, whatever the host organism. However, the CAM model enables MPM cell lines to adopt a 3D architecture, which is characteristic for each cell line and partly addresses the importance of the tumour microenvironment. We observed pronounced interaction of MPM tumour nodules with chick fibroblasts as well as the chick vasculature. Comparing MSTO-211H xenografts in SCID mice [5] with MSTO-211H CAM xenografts shows the same diffuse infiltration of morphologically similar αSMA-stained fibroblast-like cells ( Figure S8). This could therefore provide a more holistic model to assess drug responses and potentially facilitate testing of therapeutics targeting fibroblast and MPM interactions, or tumour angiogenesis, which are less easily modelled in vitro. For example, CAFs in MPM produce CTGF, which promotes MPM growth and correlates with survival outcomes, providing a potential therapeutic target [4,54]. The VEGF inhibitor bevacizumab improves chemotherapy outcomes for some patients [8] and, although other anti-angiogenic therapies have not been successful in trials, there remains an interest in targeting abnormal tumour vasculature in MPM [55].
Like immunodeficient mouse models, at early stages of embryonic development the chick lacks a fully functioning immune system which facilitates engraftment of human tumour cells on the CAM. The chick immune system develops during the period when tumour nodules grow, and by E18 fully immunocompetent chick lymphocytes can be detected [56]. However, in the UK non-protected models are terminated at E14 and, although immune cells including macrophages and lymphocytes are observed earlier in development [56], their presence in CAM xenografts at E14 has not been reported. Thus, in common with rodent flank xenografts in non-humanised models, CAM xenografts of cancer cell lines cannot be used to test immune modulators or inhibitors at E14. There is however potential to further increase the complexity of the CAM tumour microenvironment, by coculture of MPM cells with autologous or heterologous human immune cells to investigate cellular interactions and potentially allow limited assessment of the effects of drugs on this interaction.
One challenge in fully realising the potential of CAM models in assessing drug responses is selecting the best methodology to evaluate tumour growth or regression. Tumour dimensions may be estimated, or excised nodules weighed, however these methods have limitations. Using dual-labelled MPM cell lines allowed tumours to be monitored by both fluorescence and bioluminescence, and we found the latter invaluable in distinguishing viable tumour nodules that were fully engrafted and vascularised during the experimental timeline. Although the utility of BLI could potentially be limited by the transduction efficiency, our experience is that many cell types transduce with high efficiency, as was the case with all the MPM cell lines tested. The reliance of BLI on ATP makes it superior to fluorescence imaging as BLI only detects metabolically active tumour cells, whilst the reliance on transduced luciferase ensures that only tumour cells and not chick cells are quantified. The latter is particularly important for MPM CAM xenografts, where we saw substantial infiltration of fibroblast-like chick cells. Importantly, whilst the BLI signal showed moderate correlation with tumour weight, we found a high correlation of BLI with Ki-67 staining as an endpoint measure of viable tumour cells. BLI methods have been published for other CAM xenografted cancer cell types, for example urothelial carcinoma [39] and pancreatic ductal adenocarcinoma [37]. However, our methodology differs in using yolk sac injection of luciferin, rather than topical application, to provide reproducible delivery into viable vascularised tumours and facilitate longitudinal measurement of tumour viability.
In other studies, CAM xenografts have been successfully treated with drugs administered by topical application [37], intravenous injection [57], or allantoic/yolk sac injection [40]. The choice of administration route is in part influenced by the nature of the drug and any delivery vehicle. Whilst topical application is simple, it is less amenable to accurate dosing. Intravenous injection provides direct administration of drug via the tumour vasculature, but is technically challenging and may preclude multiple dosing, whilst allantoic/yolk sac injection is an easier route to enable drug delivery via the tumour vasculature that is more amenable to repeat dosing. Here, for the purposes of establishing an experimental timeline, we demonstrate yolk sac administration of both luciferin for BLI monitoring and double injection of a vehicle treatment. Using pre-and post-dosing BLI can substantially reduce the effect of inter-egg variability on estimation of tumour response to drugs, and so reduce the number of chick embryos required to fully power studies in line with 3Rs principles. Further studies will be required to refine drug delivery approaches using agents with greater activity in MPM.
While the MPM-CAM xenograft model cannot fully replace rodent or other higher organismal model systems, it provides a complementary 3Rs compliant model to study tumour biology that we believe will in future allow more efficient screening of targets and help identification of subgroups more likely to benefit from therapy. Our studies suggest that certain MPM cell lines with highly responsive BLI signals may be most amenable for testing anti-proliferative therapies, including MESO-7T, MESO12-T and MSTO-211H. In contrast, for anti-invasive therapies histological analysis of MESO-8T nodules would be preferable, whilst many cell lines appear appropriate for evaluating antiangiogenic therapies using IKOSA CAM analysis combined with immunohistochemistry. Furthermore, these initial MPM-CAM xenograft models for cultured MPM cell lines open the door to ongoing development that can incorporate further aspects of the MPM tumour microenvironment and architecture, for example by co-engrafting MPM cell lines together with human fibroblasts and/or immune cells, and engrafting patient-derived cells or tissue explants coupled with alternative preclinical imaging methods.
Conclusions
MPM-CAM xenografts can be efficiently established using MPM cell lines derived from tumours with a range of histopathological sub-types and tumour suppressor inactivation. These xenografts can mimic stromal and vascular interactions of clinical MPM lacking in 2D and most 3D cell cultures. Bioluminescence imaging can be readily used to evaluate MPM tumour burden over time, and is readily combined with multimodal imaging, transcriptional and histopathological analysis to determine tumour size, vascularisation, invasion, stromal composition, and proliferative capacity. The MPM-CAM model could therefore provide an invaluable component of the drug development pathway for MPM, and the methods for combined readouts could be extrapolated for use in multiple cancer types.
Author Contributions: S.E.B. conceived, designed, and performed experiments, analysed data, and wrote the manuscript. A.H. contributed to conceiving and supervising the study, designing, and performing experiments, and data interpretation. L.S. performed experiments, and analysed data.
|
v2
|
2022-12-24T05:09:13.532Z
|
2022-11-26T00:00:00.000Z
|
254997423
|
s2orc/train
|
Radiotherapy Side Effects: Comprehensive Proteomic Study Unraveled Neural Stem Cell Degenerative Differentiation upon Ionizing Radiation
Cranial radiation therapy is one of the most effective treatments for childhood brain cancers. Despite the ameliorated survival rate of juvenile patients, radiation exposure-induced brain neurogenic region injury could markedly impair patients’ cognitive functions and even their quality of life. Determining the mechanism underlying neural stem cells (NSCs) response to irradiation stress is a crucial therapeutic strategy for cognitive impairment. The present study demonstrated that X-ray irradiation arrested NSCs’ cell cycle and impacted cell differentiation. To further characterize irradiation-induced molecular alterations in NSCs, two-dimensional high-resolution mass spectrometry-based quantitative proteomics analyses were conducted to explore the mechanism underlying ionizing radiation’s influence on stem cell differentiation. We observed that ionizing radiation suppressed intracellular protein transport, neuron projection development, etc., particularly in differentiated cells. Redox proteomics was performed for the quantification of cysteine thiol modifications in order to profile the oxidation-reduction status of proteins in stem cells that underwent ionizing radiation treatment. Via conjoint screening of protein expression abundance and redox status datasets, several significantly expressed and oxidized proteins were identified in differentiating NSCs subjected to X-ray irradiation. Among these proteins, succinate dehydrogenase [ubiquinone] flavoprotein subunit, mitochondrial (sdha) and the acyl carrier protein, mitochondrial (Ndufab1) were highly related to neurodegenerative diseases such as Parkinson’s disease, Alzheimer’s disease, and Huntington’s disease, illustrating the dual-character of NSCs in cell differentiation: following exposure to ionizing radiation, the normal differentiation of NSCs was compromised, and the upregulated oxidized proteins implied a degenerative differentiation trajectory. These findings could be integrated into research on neurodegenerative diseases and future preventive strategies.
Introduction
Radiation therapy (RT) is one of the most effective treatments for primary and secondary brain tumors in adult and pediatric patients. However, cranial irradiation induces cognitive decline and intellectual dysfunction, such as impaired learning and memory. The adverse effects are more pronounced in children, especially when the temporal lobe, where the hippocampus is located, is irradiated [1][2][3][4][5]. Due to the widespread application of RT treatment, the quality of life of an expanding number of long-term survivors is garnering increasing concern.
Neural stem cells (NSCs) in the hippocampus are capable of self-renewal and differentiation into neurons, astrocytes, and oligodendrocytes [6,7]. Contrary to mature neurons, which are considered to be in an irreversible state of growth arrest, the rapidly dividing and undifferentiated NSCs are more susceptible to irradiation. Several studies have indicated that irradiation of the hippocampus induced apoptosis in the subgranular zone of the Dentate gyrus (DG) [8], diminished the proliferation of the surviving NSCs [9], and impeded the differentiation of NSCs into neurons [10]. These irradiation-induced alterations which inhibit neurogenesis have been implicated in cognitive impairment [11][12][13], and elucidating the mechanisms underlying damage to NSCs could enable the discovery of strategies to optimize cognitive brain function and lessen RT-induced adverse effects.
Similarly, to various other cellular stress factors, ionizing radiation damages DNA strands by disrupting their sugar-phosphate backbone and induces overall cellular toxicity, thereby driving cells towards apoptosis, necrosis, autophagy, or senescence [14][15][16][17][18][19][20][21][22][23]. Another consequential effect of irradiation on cellular macromolecules is the generation of reactive oxygen species (ROS) and reactive nitrogen species (RNS), which are predominant sources of damage to normal tissue [24,25]. There are reports that the reduction and oxidation (redox) systems play a critical role in acute radiation syndrome and are responsible for several early and late-stage side effects [26,27]. To date, published studies have elucidated the influence and functions of free radicals in radiation-induced pressure, as well as the association between redox and mitochondrial functions. Notably, some studies applied the redox theory to discover new chemicals to enhance RT sensitivity [28][29][30][31]. However, due to the characteristics of protein modification, it is challenging for conventional omics research to profile the transcriptomic and proteomic variations in cells undergoing a redox process. The redox states of whole cellular proteins in irradiated NSCs still remain unclear.
In the present study, mouse neural stem cells were exposed to X-ray irradiation to establish the cell stress model; concurrently, fetal bovine serum (FBS) was utilized to induce differentiation. iodoTMT was employed to label-free sulfhydryl groups on cysteine residues; a proteome-wide screening was conducted, followed by a comprehensive analysis of the redox patterns. Differentially expressed proteins were identified in NSCs subjected to X-ray irradiation and induced to differentiate. From a redox-MS perspective, under sustained irradiation-induced pressure, NSCs' natural differentiation capability could be disrupted. Furthermore, the emergence of heavily oxidized proteins in NSCs was indicative of these cells' susceptibility to degeneration.
NSC Proteomic Pattern Profiling Following Different Treatments
In order to elucidate the proteomic influence of irradiation on neural stem cell (NSC) proliferation and differentiation, the present study is designed in the following way (Figure 1A). The embryonic mouse brain derived NSCs were initially maintained in the medium supplemented with a cocktail of growth factors. Subsequently, the NSCs were divided into four treatment-specific groups: NSCs cultured with growth factors without additional treatment ("ctrl"); growth factor cocktail medium replaced by DMEM+FBS for differentiation ("FBS_ctrl"); NSCs cultured with growth factors subjected to a dose gradient X-ray irradiation, but without differentiation induction ("1Gy_ctrl" and "5Gy_ctrl"); and growth factors replaced with DMEM+FBS immediately following irradiation ("1Gy+FBS_ctrl" and "5Gy+FBS_ctrl"). The "1Gy+FBS_ctrl" and "5Gy+FBS_ctrl" group's purpose was to investigate the impact of irradiation on NSCs' differentiation. Approximately 6300 proteins were identified by mass spectrometry in the different groups, and a heatmap of the protein expression profile indicated that the treatments induced proteomic alterations in NSCs ( Figure 1B). Principal component analysis (PCA) of the entire proteome dataset revealed that FBS and irradiation affect protein expression patterns. Two distinct clusters were distinguishable based on FBS treatment, and within each group, X-ray irradiation caused a further division into subgroups ( Figure 1C); these indicated that FBS was the principal influencing factor. Afterward, a correlation analysis based on group-specific protein expres-sion data was performed. Significant correlations were observed between 1 Gy and 5 Gy treatments for different radiation doses with or without FBS stimulation ( Figure 1D,E). of proteomic expression profile among groups; six groups were separated by two main factors: the presence or absence of FBS. "-FBS-IR" represents the "ctrl" group, "-FBS+IR" denotes the "1Gy_ctrl or 5Gy_ctrl" group, "+FBS-IR" represents the "FBS_ctrl" group, and "+FBS+IR" represents the "1Gy+FBS_ctrl or 5Gy+FBS_ctrl" group. (D) Scatter plot of protein abundance correlation between expressed proteins in each group, the proteomic detections were performed 36 h after each treatment (red, upregulated; blue, downregulated). (C) Principal component analysis (PCA) of proteomic expression profile among groups; six groups were separated by two main factors: the presence or absence of FBS. "-FBS-IR" represents the "ctrl" group, "-FBS+IR" denotes the "1Gy_ctrl or 5Gy_ctrl" group, "+FBS-IR" represents the "FBS_ctrl" group, and "+FBS+IR" represents the "1Gy+FBS_ctrl or 5Gy+FBS_ctrl" group. (D) Scatter plot of protein abundance correlation between the 1Gy_ctrl and 5Gy_ctrl groups. (E) Scatter plot of protein abundance correlation between the 1Gy+FBS_ctrl and 5Gy+FBS_ctrl groups. (F) Scatter plot of protein abundance correlation between the FBS_ctrl and 5Gy+FBS_ctrl groups. (G) Venn diagram illustrating the overlap of up or downregulated proteins among different groups.
Notably, significant correlations also existed between FBS with IR and FBS without IR ( Figure 1F). Consistent with PCA, these indicated that FBS treatment, which promotes cell differentiation, was the predominant contributor to the protein expression pattern in NSCs, and that irradiation did not impact the proteomic profile. In order to clarify the role irradiation might play in NSCs' proliferation and differentiation, further proteome data mining was conducted. Venn analysis illustrated that compared with the control group, in both the post-IR differentiation (5Gy+FBS_ctrl) and untreated differentiation groups (FBS_ctrl), 1096 proteins were similarly altered, of which 672 were upregulated and 424 were downregulated. In the upregulated proteins fraction, a considerable number of differentially expressed proteins (DEPs) were observed: 578 proteins were exclusive to the 5Gy+FBS_ctrl group, and 272 proteins belonged to the FBS_ctrl group. The downregulated protein fraction demonstrated a comparable phenomenon ( Figure 1G). Information on these DEPs would facilitate the quest to unravel the protein interaction networks of IR-induced effects on NSCs differentiation.
Functional Annotation of Differentially Expressed Proteins
In order to determine the biological functions of the differentially expressed proteins screened above ( Figure 1G), gene ontology (GO) analysis was performed. Following treatment with X-ray only, the upregulated proteins in NSCs were implicated in cell adhesion, negative regulation of neuron projection development and nitric oxide, etc.; conversely, the downregulated proteins were enriched in cell division, the cell cycle, and DNA replication ( Figure 2A). These are indicative of the overall adverse effects of irradiation on cells.
When NSCs were treated with FBS, the upregulated proteins were predominantly enriched in neuron projection development, cell polarity, and negative regulation of cell growth and migration; meanwhile, the downregulated proteins were associated with the cell cycle, cell division, and cell proliferation, which was representative of the prodifferentiation effects of FBS ( Figure 2B). Subsequent analysis focused on comparisons of DEPs between the FBS individual treatment group and the post-IR FBS treatment group. As described in Figure 2C, the upregulated proteins in the 5Gy+FBS group were principally enriched in oxidative stress, aging, mitochondrial alterations, and neuron remodeling. The downregulated proteins were specific for RNA processing, cell development, cell adhesion, and the mitotic cell cycle. The above findings demonstrated that irradiation impacted NSC proliferation and differentiation, and the most probable mechanism underlying this influence is oxidative stress. The redox patterns of post-IR differentiation were further investigated in the next analysis.
Irradiation Influenced the Proliferation Capacity, Cell Cycle, and Stemness of NSCs
For a comprehensive determination of the effects of IR on NSCs' properties, cell cycle and proliferation assays were conducted, and the expression levels of the relevant genes
Irradiation Influenced the Proliferation Capacity, Cell Cycle, and Stemness of NSCs
For a comprehensive determination of the effects of IR on NSCs' properties, cell cycle and proliferation assays were conducted, and the expression levels of the relevant genes were analyzed. Irradiation and FBS treatment inhibited NSC proliferation and decreased Ki-67 expression; the suppressive effects were more pronounced in the 5Gy+FBS group ( Figure 3A). A similar phenomenon was also observed in the BrdU proliferation assay ( Figure 3F). p21, which engenders cell arrest following DNA damage, exhibited a dosedependent upregulation 24 h after X-ray irradiation, and FBS treatment diminished the increase in p21 ( Figure 3B). The mRNA expressions of two other cyclin-dependent kinase inhibitors (CKIs), p27 and p57, were unaffected by X-ray but upregulated by FBS. Since increasing p27 and p57 have been reported to be associated with cell differentiation [32,33], the downward trends in the IR + FBS groups indicated the impact of X-ray intervention on cell differentiation ( Figure 3C,D); no significance was observed for p27, but p57 decreased significantly in IR + FBS group in comparison with ctrl + FBS group. Furthermore, the cell cycle phases of NSCs were also affected by X-ray and FBS. Both irradiation and FBS hindered DNA synthesis, thereby occasioning S phase-inducing arrest ( Figure 3E), while the FBS group presented with a relatively longer G1 phase which was indicative of continuous cell development [34]. Combination treatment with irradiation and FBS interventions demonstrated stronger suppression at the S phase and a reduced population at G1 ( Figure 3E), implying that irradiation disrupted the normal differentiating cell cycle patterns of NSCs. FBS promoted NSC differentiation and affected cell pluripotency, as evidenced by the downregulation of Nestin and Sox2 and upregulated Neurog-1 ( Figure 3G-I).
Compared to the FBS group, the irradiation group revealed moderate impacts on neural progenitor identity-related genes. When NSCs were subjected to X-ray, nestin was downregulated, while Sox2 and Neurog-1 remained unchanged ( Figure 3G-I). In summary, both irradiation and differentiation influenced NSCs' cell cycle and the expression of stem cell marker genes, albeit differently. The X-ray-induced aberrant cell cycle reflects the detrimental impact of irradiation on NSC differentiation.
Irradiation Impeded NSC Differentiation and Altered Neurogenesis-Associated Protein Expression
Neural stem cell fate decisions are crucial for neurodevelopment and neurogenesis, which may contribute to cognitive processes, especially in irradiated brains. In order to address whether irradiation affects NSC differentiation at a protein level, NSCs were pre-treated with or without X-ray irradiation (1 Gy or 5 Gy), then allowed to differentiate in an FBS-containing DMEM medium. The mRNA expressions of cell type markers were significantly altered 24 h after DMEM + FBS medium replacement. The mRNAs of βIIItubulin and GFAP, neuron and glial cell markers, were markedly upregulated in the FBS group, indicating that the NSCs were beginning to differentiate. When irradiation was involved, βIII-tubulin expression slightly increased, while GFAP expression diminished ( Figure 4A-C). Conversely, Olig expression was not affected by FBS stimulation, and only 5 Gy irradiation upregulated its mRNA expression level. Following combination treatment with irradiation and FBS (1Gy+FBS and 5Gy+FBS groups), Olig2 expression decreased significantly ( Figure 4D). Overall, during FBS-induced differentiation, irradiation interfered with the expression of cell-type marker genes by suppressing the expression of glial cells and oligodendrocyte-specific genes and promoting neural marker gene expression.
To further validate the expression pattern of these marker genes, the corresponding protein expression data were selected from our MS/MS spectra dataset. GFAP and Olig protein expressions were consistent with their mRNA expressions ( Figure 4C-E). βIII-tubulin was not detected in MS/MS, but another neuron-specific protein was identified: tubb2b. In FBS-induced differentiation, irradiation significantly downregulated tubb2b expression ( Figure 4E). Meanwhile, FBS-induced differentiation was conducted for 5 days, and the irradiation-induced NSC lineage commitment was evaluated with immunofluorescence. Similar to mRNA and protein results, more cells were beta3-tubulin + , and IR decreased gliagenesis and oligodendrogenesis ( Figure 4F). Concurrently, the neurogenesis protein profile was identified by proteome analysis. As illustrated in the heatmap, the neurogenesis-related proteins' expressions among each group were clearly distinguished. Notably, ptn and cdk5rap2, which were demonstrated to be associated with Alzheimer's disease, were upregulated in the IR+ differentiation group. Additionally, SOD1, the oxidative stress-related protein, promotes amyotrophic lateral sclerosis (ALS) [35]. HDAC4 was only upregulated in the differentiation group (DMEM+FBS) and was downregulated by irradiation. The inhibition of HDACs may impair neural stem cell activity [36]. Nrcam (neuronal cell adhesion molecule), a protein essential for neuron-neuron adhesion and which was also reported to be related to autism [37], was significantly downregulated in the IR + differentiation group. Pafah1b1, which was significantly downregulated in the IR + differentiation group, is a gene critical for brain development and is responsible for Lissencephaly [38]. Irradiation could hamper the proper differentiation of NSCs, and drive neurogenesis-related proteins to be expressed in a pattern of neurological diseases.
Construction of the Redox-Protein Profile in Irradiated NSCs Via Iodoacetyl-Labelled Mass Spectrometry
In the previous section, the GO enrichment analysis revealed that the proteins specific for irradiated NSCs' proliferation were tightly associated with oxidative stresses. Therefore, we next aimed to evaluate the extent of redox and identify the proteins with vital roles. As illustrated in the schematic diagram, the iodoTMTs were initially utilized to label all protein homogenates; thus, the basal level of free sulfhydryl groups among each treatment group could not be assessed (label 1). Subsequently, disulfide bonds were reduced, and the released sulfhydryl groups were classified as label 2. The intensities of label 1 and label 2 proteins were detected via MS/MS. The relative oxidation levels were obtained by calculating the label 2/ (label 1 + label 2) ratio and protein samples were collected 36 h after each treatment ( Figure 5A). Data for co-expressed proteins were merged, and relative oxidation state proportions among different experimental groups were counted. Principal component analysis (PCA) indicated that the redox level of the same protein varied based on the different treatments ( Figure 5B). Furthermore, the total label 2/(label1+label2) index in each group was calculated, and the relative oxidation percentage of the FBS+IR group was significantly higher than for other treatments ( Figure 5C). 873 proteins were detected in both the control and IR group. Compared to ctrl, the log2 redox percentages of most irradiated proteins (766) were greater than zero ( Figure 5D). This demonstrated that irradiation induced a more substantial increase in protein oxidation activation in NSCs. Significantly oxidized proteins were chosen for an analysis of their bio-functions; the oxidized proteins were enriched for aging, cell differentiation, cell adhesion, and RNA processing ( Figure 5E). Importantly, evident oxidation also occurred in differentiating NSCs: 589 proteins were identified in the FBS and FBS + IR groups, and 92.5% of these proteins (545) were oxidized ( Figure 5F). GO analysis indicated that significantly oxidized proteins could regulate neurons, brain development, cell adhesion and polarity, and cytoskeleton organization ( Figure 5G). This strongly suggested that when irradiation disrupts the normal NSC differentiation process, these oxidized proteins play a deleterious function during this disruption. Subsequently, detectably expressed proteins and redox proteins in NSCs under IR+FBS treatment were compared; 589 redox proteins and 6183 expressed proteins were detected, respectively ( Figure 5H). The two protein clusters shared 530 common proteins, and 59 were proteins exclusively detected by the redox method. GO enrichment of these 59 proteins did not yield significant evidence, only general information such as heterocyclic compound binding and ion binding function ( Figure S1). Another notable concern was the association between upregulated and oxidized proteins after IR+FBS treatment. The 530 common proteins were analyzed using expression fold change (FC) and the percentage of oxidation ( Figure 5I). At thresholds of |log2FC| > 0.5 and log2 oxidation % > 0.5, 8 upregulated and 10 downregulated oxidized proteins were identified. The biological processes and KEGG enrichment of the downregulated oxidated proteins focused predominantly on synapses, postsynaptic density, nitrogen compound metabolism, and ribosomes ( Figure S2). Interestingly, the upregulated oxidized proteins possessed a strong association with the neurodegenerative pathways in KEGG, such as those involved in Parkinson's disease, Huntington's disease, and Alzheimer's disease ( Figure 5J,K). Overall, in post-irradiation exposure to NSC differentiation, certain highly expressed proteins were also considerably oxidized, indicating the activation of reverse pathways that may culminate in NSC degeneration. represents the "ctrl" group, "-FBS+IR" denotes the "5Gy_ctrl" group, "+FBS-IR" represents the "FBS_ctrl" group, and "+FBS+IR" represents the "5Gy+FBS_ctrl" group. (C) Bar Graph showing the relative oxidation percentage of proteome-wide sulfhydryl groups among different treatment groups; data were represented as Mean ± SEM; n = 3; ** p < 0.01, *** p < 0.001 as compared with (B) Principal component analysis (PCA) of proteomic oxidation profile among groups, "-FBS-IR" represents the "ctrl" group, "-FBS+IR" denotes the "5Gy_ctrl" group, "+FBS-IR" represents the "FBS_ctrl" group, and "+FBS+IR" represents the "5Gy+FBS_ctrl" group. (C) Bar Graph showing the relative oxidation percentage of proteome-wide sulfhydryl groups among different treatment groups; data were represented as Mean ± SEM; n = 3; ** p < 0.01, *** p < 0.001 as compared with the "-IR-FBS" group, # p < 0.05 for comparisons between indicated groups. (D) Volcano plots exhibit the oxidation levels of detected proteins, the Y-axis represents the negative log10 of the p value, and the X-axis represents the log2 of the oxidation fold change between the IR and control groups. (E) The scatter plots illustrate the significantly enriched GO terms for oxidized proteins between the IR and control groups. (F) Volcano plots depict oxidation levels of detected proteins, the Y-axis represents the negative log10 of the p value, and the X-axis represents the log2 of the oxidation fold change between the IR+FBS and FBS groups.
Discussion
Ionizing radiation of the developing or adult brain is acknowledged as a potential cause of cognitive impairment and neurodegeneration, particularly when neural stem cells are affected [39][40][41][42]. Elucidating the mechanism underlying irradiation-mediated NSC injury would contribute to alleviating the side effects of radiotherapy and demystifying the induction of neural inflammation, brain development, and even neurodegenerationassociated mechanisms [43][44][45]. The substitution models employed in preclinical radiation research vary from cultured cells to small or large animals [46,47]; the majority of these models have been established according to the linear quadratic (LQ) model [48]. Currently, the emergence of 3D tissue models and organoids has been beneficial in understanding radiation-induced tissue response and in precision medicine [49,50].
With the advent of sequencing technology, neural stem cells have been investigated from a system-wide perspective, including transcriptomics, proteomics, and metabolomics, shedding new light on their complex regulatory mechanism [51][52][53][54]. Taking into consideration the properties and limitations of radiobiology models, as well as the complexity of the neural stem cell microenvironment in the brain, we sought to determine how NSCs respond to X-ray irradiation stress in the absence of cellular interactions. Therefore, in the present study, we designed a neural stem cell in vitro radiation model and integrated expression and redox proteomic techniques to analyze global protein expression in differentiated neural stem cells following X-ray irradiation. The proteomic expression profile demonstrated that irradiation impaired NSC proliferation, the cell cycle, and differentiation; in particular, the oxidation of those upregulated proteins posed an extremely high risk of neurodegeneration.
Proliferating neural stem cells or progenitor cells are tremendously sensitive to ionizing radiation-induced DNA damage and apoptosis [55,56]. This phenomenon was also reflected in our BrdU assay. When DNA damage is induced, the replication checkpoint initiates the DNA repair response and delays the cell cycle progress. In neural stem cells, the cell cycle is also associated with cell differentiation: prolonged G1 and upregulated p57 enable cells to respond to signals rapidly and differentiate properly [56][57][58][59]. The manipulation of the G1 phase by CDKs could regulate the NSCs' fate, proliferation, or differentiation [60][61][62]. After irradiation, the G1 phase was shortened in differentiating NSCs, suggesting that irradiation disrupted the conditions for normal NSC differentiation. Nestin, an intermediate filament protein, is universally considered a marker of neural stem/progenitor cells [63]. Upregulated nestin expression was detected in stem/progenitor cells during the early development stage in which cells are engaged in active proliferation. Once these cells ceased dividing and initiated differentiation, nestin expression became downregulated [64]. Nestin expression is representative of NSCs' pluripotential. It has been reported that irradiation significantly reduced the nestin-positive cells in the mouse brain's dentate gyrus [65]. When co-cultured with irradiated vascular endothelial cells, nestin-positive NSCs exhibited a marked decline [66]. In this study, nestin mRNA expression was similarly downregulated when NSCs were subjected to X-ray irradiation, indicating a deleterious effect of irradiation on NSCs' stemness. Under pathological conditions, nestin should be re-expressed for the repair process to be initiated [67]. However, it is difficult to determine whether those nestin-deficient NSCs are capable of completing the repair task in irradiationinduced brain injury.
The predominant cytotoxic effects of irradiation are DNA damage and cell cycle arrest [68,69]; another adverse effect of irradiation that could cause cognitive impairment is reduced neurogenesis. Irradiation induces apoptosis in dividing cells, reduces the pool of mitotic NSCs, hampers the generation of new neurons [3], affects the microenvironment of the targeted brain tissue site, and alters the NSC niche [70,71]. The expression of neurogenesis-related proteins in our proteomic datasets also reflected the detrimental effects of irradiation. Cyclin-dependent kinase 5 regulatory subunit-associated protein2 (CDK5RAP2) has been implicated in the proliferation of neuronal progenitors in the developing neocortex [72] and was also shown to cause Seckel syndrome [73]. Justin Miron et al. reported that CDK5RAP2 was prevalent in the hippocampus of brains that develop Alzheimer's disease (AD). Notably, we also detected increased CDK5RAP2 expression in irradiated NSCs. Similar characteristics seem to occur for other neurological disease-related genes. Appb1, which interacts with amyloid precursor protein in Alzheimer's disease, was downregulated in irradiated NSCs. Appb1 deletion was discovered to increase the risk of AD [74]. Likewise, Appb1 knockout in mice resulted in impaired learning and memory [75]. SOD1, a superoxide scavenger, is frequently upregulated during redox reactions [76]. We found that SOD1 was upregulated in irradiated NSCs, and chiefly attributed this to the IR-induced ROS. SOD1 was also upregulated in amyotrophic lateral sclerosis (ALS) patients [77], which indicates potential connections between irradiation and neurodegenerative disorders. Nrcam, a cell adhesion molecule, has been associated with autism spectrum disorders (ASD) [78]. Nrcam-knockout mice demonstrated autism-related behaviors, such as impaired sociability, cognitive rigidity, and repetitive behavior [79]. In the present study, Nrcam expression was also decreased in irradiated NSCs. Numerous neurogenesis-associated proteins altered by IR could not all be listed here. Nevertheless, IR's impact on NSCs is considerably more complex than appreciated, especially the potential risk for neurodegeneration.
Beta tubulin III, also known as Tuj-1, a class III member of the beta tubulin protein family, is regarded as a neuron-specific marker to detect progenitor cell differentiation. Consistent with Hyeon Soo Eom et al.'s study [80], we observed upregulated Tuj-1 in irradiated NSCs. MAP2, another neuron marker, was upregulated in our MS/MS detection; however, Anggraeini Puspitasari et al. demonstrated that MAP2 expression was upregulated during the early stage of irradiation (4 days) and progressively diminished in the subsequent 20 days [81]. Recent research suggested that the two markers belong to two distinct types of neurons: Tuj1 are from pan-neurons, and MAP2 are from mature neurons [82]. The inconsistency between results for Tuj-1 and MAP2 expressions indicated that during NSCs differentiation, IR's effects on neurons might vary depending on cell types; nonetheless, the specific mechanisms warrant further investigation.
Reactive oxygen species (ROS), a group of aerobic respiration metabolic byproducts, are responsible for cellular redox homeostasis. During exposure to ionizing radiation, abundant quantities of ROS and reactive nitrogen species (RNS) are generated by extracellular water radiolysis and mitochondrial membrane destruction [83,84]. ROS and RNS are the principal sources of oxidative damage to normal tissues. Concurrently, excessive ROS or RNS causes the oxidation of lipids, DNA, and proteins [85][86][87]. The oxidation of protein cysteine by ROS or RNS has been recognized as a prominent class of protein posttranslational modifications, which are heavily associated with aging and multiple diseases [88][89][90]. Two kinds of protein oxidative modifications exist irreversible oxidation and reversible oxidation. Irreversible oxidation results in protein dysfunction. In comparison, reversible oxidation, primarily of cysteine residues, could regulate the activity, the redox balance, and signaling cascades [91,92]. In the present study, we utilized cysteine-reactive tandem mass tags (iodo TMT) to detect reversible oxidation. The LC-MS/MS data could provide a proteome-wide protein oxidation profile beneficial for the analysis of the adverse effects of IR-induced oxidative stress.
Ionizing radiation significantly elevated the protein oxidation level in differentiating NSCs. The proteins with a dual increase in expression and oxidation levels, especially Sdha, Atp5a1, and Ndufab1, have been documented in studies of neurodegenerative diseases [93][94][95][96][97]. Nevertheless, the oxidation of these disease-marker proteins received scant attention. IRinduced proteome-wide protein oxidation could be associated with an increased risk of neurodegeneration, whereas limiting the oxidation of certain risk proteins would provide an auxiliary strategy for alleviating radiotherapy-induced brain injury.
In recent years, the majority of patients worldwide have turned toward photon therapy, and the utilization of charged particle therapies, including proton and carbon ion therapy, has substantially expanded [98]. Particle therapy treatment could substantially diminish the exposure of healthy tissue to radiation and long-term side effects [99,100], particularly among pediatric patients, in whom exposure of healthy organs to radiation doses can induce long-term detrimental effects [99]. We also have been conducting a collaborative Boron neutron capture therapy (BNCT) research project with the institute of high energy physics of the Chinese Academic of Sciences (CAS). Referring to economic considerations and indications such as meningiomas, ionizing radiation still has clinical utility. Investigations of radiation-induced injury could enable a deeper understanding of our coping mechanism when subjected to stressful radioactive rays and the progression of senescence. It is anticipated that the survival rates of cancer patients will continuously improve due to the constant evolution of modern radiotherapy.
Cells and X-ray Irradiation
GFP-transfected C57BL/6 mouse neural stem cells (NSCs), derived from 12.5 dpc embryos, were purchased from Cyagen Biosciences (MUBNF-01101, Guangzhou, China). The NSCs were maintained in a humidified incubator with 5% CO 2 at 37 • C in Cyagen recommended medium (OriCellTM Neural Stem Cell Growth Medium, MUCMX-90011). The medium was changed every 2 days. Oricell Neural stem cell growth medium was replaced by 10% fetal bovine serum (FBS)/DMEM-F12K (Gibco) for differentiation. For X-ray irradiation (IR) treatment, the cells were irradiated at 1 Gy or 5 Gy with an Xstrahl X-ray system, Model CIX2 (Xstrahl, Walsall, West Midlands, UK). The follow-up procedures are described in subsequent sections.
qRT-PCR Analysis
The experiment was conducted for six groups, namely: ctrl, differentiation group (NSCs treated with FBS), irradiation group (cells exposed to X-ray,1 Gy or 5 Gy), differentiation after IR group (after 1 Gy or 5 Gy irradiation, the culture medium was immediately changed to FBS/DMEM-F12K). Total RNA extraction was performed at 24 h post-X-ray irradiation or cell differentiation using TRIzol Plus RNA kit (Invitrogen, Carlsbad, CA, USA). cDNA was prepared using the iScript cDNA synthesis kit (Bio-Rad, Hercules, CA, USA). The RT-PCR reaction was performed using Universal SYBR Green Supermix (Bio-Rad, Hercules, CA, USA) according to the manufacturer's instructions. Information on the primers is listed in Supplementary Table S1. The statistical analysis was performed using GraphPad Prism 8.0 Software. The results were presented as the Mean ± standard error of the mean. Student's t-test was used to compare values between the two groups. Differences were considered statistically significant when p values were <0.05.
Cell Cycle Analysis
The experimental groups and study design were consistent with the statements mentioned above. 24 h after each specific treatment, cells were collected via trypsinization. Furthermore, supernatants and PBS used during wash steps were kept ensuring the collection of both adherent and detached cells. After collection, the cells were fixed in ice-cold 70% ethanol at 4 • C overnight. Subsequently, the cells were stained with PI solution (50 µL PI and 50 µL RNase A in 10 mL PBS) for 30 min at room temperature before measurement. The data were obtained using a flow cytometer (Beckman Coulter, Brea, CA, USA) and analyzed using the ModFitLT software (Version 5.0; Verity Software House, Topsham, ME, USA).
BrdU Assay
NSCs were seeded in 96-well plates and subjected to specific stimulation (mentioned above). 24 h after treatment, the NSCs' proliferation in each well was evaluated using a Cell Proliferation ELISA BrdU Kit (Roche, Mannheim, Germany) according to the manufacturer's protocol. The absorbance, which represents BrdU incorporation during DNA synthesis, was measured at 450 nm using a microplate spectrophotometer (Thermo, Swedesboro, NJ, USA)
Immunofluorescence Staining
Neurospheres were trypsin-digested into a single-cell suspension and cultured on 0.01% poly-L-lysine (Sigma-Aldrich, St. Louis, MO, USA) pre-coated coverslips in a 24-well plate. The cells were induced to differentiate following 0 Gy, 1 Gy, or 5 Gy irradiation. After 5 days of differentiation, the cells were fixed with 4% Paraformaldehyde (PFA), followed by PBS washing thrice and blocking for 1 h with 0.5% bovine serum albumin (BSA) and 0.1%Triton X-100. The blocking solution was also used for antibody dilution: Rabbit anti-GFAP (1:1000, Abcam, Cambridge Biomedical Campus, Cambridge, UK), Mouse anti-O4 (1:1000, R&D systems, Minneapolis, MN, USA), and Mouse anti-beta 3 tubulin (1:1000, Sigma), and the primary antibodies were incubated at 4 • C overnight. After several washes with TBS, the corresponding secondary antibodies were added for 2 h at room temperature. The utilized secondary antibodies are as follows: Donkey anti-mouse IgM Alexa 555 and Donkey anti-rabbit IgM Alexa 633 (Thermo, Waltham, MA, USA). The cell climbing slices were mounted on glass slides with an antifade reagent mounting medium (BOSTER Biological Tech, Wuhan, China). All the stained fluorescent markers were captured using an LSM 700 laser scanning confocal microscope (Axio-observer Z1; Carl Zeiss, Oberkochen, Germany) and analyzed using the software ZEN lite (Zeiss, https: //www.zeiss.com/microscopy/en/products/software/zeiss-zen-lite.html/, accessed on 18 March 2020)
Protein and LC MS/MS and TMT Label
Protein sample preparation. 36 h after corresponding treatments, all NSC samples were lysed in RIPA buffer with PMSF (Abcam), then centrifuged at 12,000× g for 10 min at 4 • C; the supernatants containing total proteins were collected. The protein concentration per sample was determined using Pierce BCA Protein Assay Kit (Thermo scientific, Rockford, IL, USA) according to the manufacturer's protocol. Aliquots of 50 µg proteins were used for proteomics analysis. Proteins' disulfide bonds were reduced with 10 mM Dithiothreitol for 45 min at 55 • C, then alkylated with 25 mM iodoacetic acid for 30 min in the dark, followed by overnight acetone precipitation. The obtained precipitants were dissolved in EPPS (Thermo Fisher Scientific, Rockford, IL, USA) and re-dissociated with Trypsin overnight at 37 • C. Peptide and the sulfhydryls of cysteine-containing peptides labeling were performed using TMT10-plex and iodoTMT Mass Tag Labelling Kit (Thermo Fisher Scientific, Rockford, IL, USA) following the manufacturer's protocol. The labeled samples were acidified with trifluoroacetic acid, followed by a desalination procedure using a C18 Sep-pak column, and then vacuum dried.
LC-MS/MS analysis. The peptide samples were dissolved in 0.1% formic acid, then preconcentrated and desalted using PepMap C18 nanotrap column (Thermo Fisher Scientific, Rockford, IL, USA) A reversed-phase analytical column (EASY-Spray C18, Thermo Fisher Scientific, Rockford, IL, USA) was utilized for peptide separation in a binary solvent system. Gradient conditions were: 4-26% solvent B for 120 min and 26-95% B for 10 min. The peptides were analyzed using a data-dependent acquisition method at a resolution of 120,000, a scan range of 375-1500 m/z, and at a resolution of 60,000 with a target value of 2 × 10 5 ions and a maximum injection time of 120 ms. The fixed first m/z was 100, and the isolation window was 1.2 m/z units. The raw data files were processed using the Andromeda search engine in MaxQuant 1.5.6.5 software (https://www.maxquant.org/, accessed on 11 November 2019)
Bioinformatic Analysis
All statistics of protein expression data were computed using Excel software (Microsoft Excel, version 2013), and the differentially expressed (DE) proteins were screened via the t-test (p < 0.05) and Log2 fold change (Log2fold change>|0.5|); related expression volcano plots were generated using GraphPad Prism V 7.0. The clustered heatmap profile of protein expression among each group was conducted using the "pheatmap" package (version 1.0.12, https://cran.rstudio.com/web/packages/pheatmap/index.html/, accessed on 15 February 2022) in R.
The principal component analysis of protein expression patterns among groups was performed using the "FactoMineR" package (version 2.4, https://cran.r-project.org/web/ packages/FactoMineR/index.html/, accessed on 15 February 2022) in R, and the output data were plotted using GraphPad Prism. For correlation analysis, the normalized protein expression values of particular experimental groups were transformed on a Log2 scale, then analyzed and visualized with GraphPad Prism.
Conclusions
We utilized mouse neural stem cells to establish an X-radiation injury cell model and introduced FBS to simulate the differentiation process. Mass spectrometry protein profiling and redox proteomic techniques were applied to analyze global protein expression in differentiated neural stem cells upon X-ray irradiation. LC-MS/MS permitted the detection of a series of significantly expressed proteins related to alterations of the cell cycle, impaired proliferation, and differentiation in NSCs. These results evidenced the deleterious effects of irradiation on neural stem cells at a protein level. Furthermore, we first employed iodoTMT labeling techniques to obtain a redox protein profiling of differentiating NSCs under irradiation stress. The joint analysis of expressed and redox protein profiles have identified highly upregulated and oxidized proteins associated with neurodegenerative disease. From a redox perspective, irradiation could impede the normal processes involved in NSC differentiation, thereby resulting in degenerative differentiation.
Patents
This section is not mandatory but may be added if there are patents resulting from the work reported in this manuscript.
|
v2
|
2022-12-28T16:09:24.572Z
|
2022-11-26T00:00:00.000Z
|
255180804
|
s2ag/train
|
Dosimetric Comparison of IMRT Versus 3DCRT for Post-mastectomy Chest Wall Irradiation: An Analytical Observational Study
Purpose: To compare the dose distribution of three-dimensional conformal radiation therapy (3DCRT) with intensity-modulated radiation therapy (IMRT) for post-mastectomy radiotherapy (PMRT) to left chest wall. Materials and Methods: 30 post-MRM female breast cancer patients with histologically confirmed infiltrating ductal carcinoma of unilateral left breast without evidence of distant metastasis or second malignancy were found eligible during January 2017 to December 2021. All patients received 45 Gy in 20 fractions. Planning target volume (PTV) parameters -D2, D98, Dmean, V95, and V107—homogeneity index (HI), and conformity index (CI) were compared. The mean doses of lung and heart, percentage volume of ipsilateral lung receiving 5 Gy (V5), 20 Gy (V20), and 49 Gy (V49) and that of heart receiving 5 Gy (V5), 25 Gy (V25), and 42 Gy (V42) were extracted from dose-volume histograms and compared. Results: PTV parameters were comparable between the two groups. CI was significantly improved with IMRT (1.118 vs. 1.224, p < 0.04) but HI was similar (0.0951 vs. 0.0962, p = 0.125) compared to 3DCRT. IMRT in comparison to 3DCRT significantly reduced the high-dose volumes of lung (V20, 24.52% vs. 29.62%; V49, 3.56% vs. 6.42%; p < 0.001) and heart (V25, 5.89% vs. 8.24%; V42, 1.64% vs. 6.12%; p < 0.001); mean dose of lung and heart (10.21 vs. 11.96 Gy and 3.86 vs. 7.42 Gy, respectively; p < 0.001).Conclusions: For left sided breast cancer, IMRT significantly improves the conformity of plan and reduce the mean dose and high-dose volumes of ipsilateral lung and heart compared to 3DCRT, but 3DCRT is superior in terms of low-dose volume.
|
v2
|
2022-11-27T16:25:17.713Z
|
2022-11-27T00:00:00.000Z
|
254004617
|
s2orc/train
|
Development and future perspectives of natural orifice specimen extraction surgery for gastric cancer
In recent years, natural orifice specimen extraction surgery (NOSES), a novel minimally invasive surgical technique, has become a focus in the surgical field, and has been initially applied in gastric surgery in many national medical centers worldwide. In addition, this new surgical technique was launched in major hospitals in China. With an increasing number of patients who have accepted this new surgical technique, NOSES has provided new prospects for the treatment of gastric cancer (GC), which may achieve a better outcome for both patients and surgeons. More and more experts and scholars from different countries and regions are currently paying close attention to NOSES for the treatment of GC. However, there are only a few reports of its use in GC. This review focuses on the research progress in NOSES for radical gastrectomy in recent years. We also discuss the challenges and prospects of NOSES in clinical practice.
INTRODUCTION
Gastric cancer (GC) is a very common malignancy worldwide. It is reported that the incidence rate of GC ranks fourth among all malignancies in the world and is the second most common cause of cancerrelated death [1]. GC has been a focus of research in the field of gastrointestinal tumor surgery, as surgery is considered to be the most important part of GC treatment plans, especially in advanced GC. With the rapid development of surgical techniques, minimally invasive surgery has played an important role in the development of surgery. In 1994, Kitano et al [2] performed laparoscopic distal gastrectomy for early GC for the first time. Thereafter, with the development of laparoscopic surgical techniques over the next 20 years, treatment for GC has gone through a series of stages from laparotomy to laparoscopy, porous laparoscopic surgery (mostly five holes), and single hole laparoscopic surgery [3][4][5]. In terms of minimally invasive surgery and aesthetics, natural orifice specimen extraction surgery (NOSES) has the advantages of combined traditional laparoscopic techniques and minimally invasive surgery, including minimal cutaneous trauma and postoperative pain, fast postoperative recovery, short hospital stay, and a positive psychological impact [6]. Technical innovation of NOSES has resulted in better treatments for patients.
It is worth mentioning that all the natural orifice transluminal endoscopic surgery (NOTES) procedures are performed through a natural cavity, without any visible scars on the surface of the body. The abdominal incision is completely eliminated as it is a minimally invasive surgical technique. However, it is difficult to perform this surgical technique using current medical technology [6,7]. It requires surgeons to be skilled in laparoscopic techniques, especially in laparoscopic reconstruction of the digestive tract. For this reason, NOTES is carried out on a relatively modest scale.
NOSES makes full use of the latest laparoscopic instruments and techniques, and specimen extraction is achieved by taking specimens from a natural cavity (mouth, rectum, and vagina) of the human body, followed by complete reconstruction of the digestive tract. This avoids abdominal incision for specimen extraction. Technically, it is easily performed by skilled surgeons. NOSES is a bridge between conventional laparoscopic surgery and NOTES [8]. Compared with traditional laparoscopic surgery, the minimally invasive effect of NOSES is much more significant, and postoperative recovery is faster[9,10]. It can eliminate the risk of abdominal incision-related complications, relieve pain, and achieve a better abdominal cosmetic effect.
CURRENT SITUATION OF NOSES
NOSES can complete various conventional surgical techniques (resection and reconstruction) in the abdomen and pelvis using laparoscopic instruments, robots, transanal endoscopic micro-surgery or soft endoscopy and other equipment platforms. Specimens are extracted from a natural cavity (rectum, vagina, or oral cavity)[6]. This is an emerging minimally invasive surgery without an abdominal incision[6]. NOTES is a type of NOSES. In the early 1990s, a few cases with specimen extraction through a natural cavity were reported [11,12]. In 2008, the first attempt of transvaginal specimen extraction during laparoscopic colorectal cancer surgery in seven female patients was carried out by Palanivelu et al [13], which resulted in a new era of minimally invasive gastrointestinal surgery. In 2011, Wang et al [14] reported two female patients who underwent radical resection of rectal cancer using the transvaginal approach. There were no visible scars on the abdomen or incision-related complications. This is the first report of the operation and specimen extraction performed via a vaginal approach in China. In 2012, the robot platform was used in the radical resection of rectal cancer for the first time in China, and specimen extraction was also performed through a natural cavity (anus) [15]. Over the next few years, NOSES gained more interest from Chinese experts and scholars. This new surgical technique was also performed in major hospitals in China. There are now increasing numbers of related reports and patients undergoing this operation. Tang et al [16] found that the NOSES group had advantages in terms of reducing postoperative complications and postoperative pain, faster recovery of gastrointestinal function, and shorter postoperative hospital stay. Most notably, the physical function, role function, emotional function, and overall health status in the NOSES group were significantly better than those in the conventional laparoscopic surgery group. In addition, body image scores were significantly higher in the NOSES group. However, there was no significant difference in long-term survival between the two groups. This operation may lead to the leakage of digestive fluid, abdominal infection, as well as local, rectal, and vaginal incision recurrence[17-20].
RESEARCH PROGRESS AND APPLICATION PROSPECTS OF NOSES IN GC
In 2011, Jeong et al [21] began to apply NOSES in early GC. Following traditional laparoscopic subtotal gastrectomy with regional lymph node dissection, a posterior colpotomy was performed by an experienced gynecologist, who placed the specimen retrieval bag in the abdominal cavity. The specimen and the retrieval bag were then removed via the transvaginal route. The authors pointed out that this new surgical method may be feasible and safe for elderly female patients with early GC. In 2015, a 72year-old female patient underwent total laparoscopic subtotal gastrectomy, regional lymph node dissection, and Roux-en-Y gastrojejunostomy [22]. Similarly, the specimen was extracted through the colpotomy incision. In this case, the diameter of the adenocarcinoma located in the gastric antrum was only 2 cm, thus the extraction was not difficult. Postoperative histopathology of the adenocarcinoma was pT3pN0. During the next 10 mo, the patient received conventional adjuvant chemoradiotherapy, with no postoperative complications. This is the first time that transvaginal extraction was used for an advanced gastric tumor after total laparoscopic gastrectomy. This study demonstrated that NOSES is a safe and feasible procedure for advanced GC. In 2015, the World Journal of Gastroenterology reported for the first time, the application of robotic gastrectomy in eight female patients (aged between 42 and 69 years) using the Da Vinci Robotic System, and transvaginal specimen extraction. The patients were divided into two groups according to the location of the tumor; two cases received robotic total gastrectomy and six underwent robotic distal gastrectomy, with transvaginal specimen extraction in both groups using the same method [23]. The mean total operation time was 224 min, and the mean postoperative stay was 3.6 d. Postoperative gastrointestinal stenosis, anastomotic leakage, and readmission were not reported during the follow-up period. To some extent, this study proved the feasibility and safety of robotic radical gastrectomy with transvaginal specimen extraction for female patients with GC. In 2019, Liu et al [24] reported a case of early gastric angular adenocarcinoma (cT1bN0M0). After total laparoscopic distal gastrectomy and a modified delta-shaped anastomosis, the specimen was extracted from the anus via the anterior rectal wall incision. During this procedure, the rectum was disinfected with iodine water, and iodophor gauze was placed in the anus for full dilation. A 6 cm incision was made on the anterior wall of the upper rectum. The specimen in the retrieval bag was slowly pulled out of the abdominal cavity through the anus to complete the extraction process. After the operation, the patient's vital signs were stable and there were no complications. The patient recovered and was discharged from hospital after 14 d. In December of the same year, Sun et al [25] reported on NOSES gastrectomy in a 64-year-old male patient. After laparoscopic distal gastrectomy, the surgeon placed the retrieval bag in the abdominal cavity to retrieve the specimen, and then performed a modified gastroduodenal triangle anastomosis to complete the reconstruction of the digestive tract. The anorectum was repeatedly rinsed with iodine water, and the anorectal intestinal wall was supported by iodophor gauze after sufficient anal dilation. A 4 cm incision was made in the upper rectum, an oval clamp was inserted through the anorectum, and the specimen bag was pulled out from the incision through the anorectum to complete the removal of the surgical specimens. On the tenth day, the patient recovered and was discharged without any complications or tumor recurrence. Wang et al [26] performed both total laparoscopic subtotal gastrectomy and radical anterior resection in a 65-year-old man, and the extraction of specimens was completed through the anus. The postoperative pathology confirmed that both tumors were moderately differentiated adenocarcinoma, and the lymph node in each specimen was negative. After six cycles of adjuvant chemotherapy, no recurrence was observed during the follow-up period.
The number of patients in the above case reports on GC-NOSES is limited. However, it is the only way for the NOSES technique to become popular in central hospitals and the use of this technique is only beginning. If the surgeon masters this new technique, a stable surgical team can be established. A single center clinical study on GC-NOSES has been launched in recent years.
In 2017, Hüscher et al [27] conducted a prospective, non-randomized single center clinical study of laparoscopic NOSES radical gastrectomy, which was only performed in patients with early GC. After laparoscopic gastrectomy, a 3 cm incision was made on the gastric stump. The specimen was then cut into three small segments, and stitched one by one. Finally, the specimens were removed through the oral cavity. A total of 14 patients with early GC were included in this study and they were followed for 18 mo. One patient died of postoperative pneumonia (mortality 7.14%), and the remaining patients had no serious complications or wound infection. The mean postoperative hospital stay was 4.7 ± 1.0 d. To some extent, this study indicated that the safety and feasibility of NOSES radical gastrectomy for early GC were similar to those of traditional laparoscopic surgery, but the NOSES technique did reduce the mortality and postoperative hospital stay. In the same year, a retrospective study was reported in Polski Przeglad Chirurgiczny, which included 50 patients with gastrointestinal stromal tumors [28]. In this study, 12 patients' specimens were retrieved through the oral cavity and the remaining 38 via a conventional abdominal incision. The statistical results of 12 patients showed that the mean operation time was 92.5 min, the tumor size ranged from 14 mm to 40 mm, and the mean length of hospital stay was 3.2 d. Postoperative pathology confirmed that all the cases showed radical excision. One patient developed a surgical site infection and one patient had fluid collection at the suture site which prolonged hospital stay to 8 d. Following a comparative analysis, the researchers believe that the NOSES technique is a promising, safe, and effective minimally invasive surgery. Recently, Tang et al [16] used a type of NOSES to perform Roux-en-Y reconstruction after laparoscopic total gastrectomy with two circular staplers (one of which was oval). The advantage of this technique is that it can be applied to the tumor located very close to the cardia. Thus, it could obtain a high-quality anastomosis effect, and a laparoscopic suture is not required to close the intestinal common opening. Consequently, the operation time could be significantly shortened and the patient's gastrointestinal function would recover more quickly. NOSES, a new surgical technique, is now carried out in more and more hospitals. However, there is still a lack of standardization in this novel minimally invasive surgery. In June 2017, Professor Xi-Shan Wang and other experts initiated the China NOSES Alliance and the NOSES Special Committee of Colorectal Surgeons Branch of Chinese Medical Doctor Association. In 2019, the NOSES Special Committee issued the International Consensus on NOSES for GC [29]. The consensus systematically named and standardized the NOSES procedure for GC. According to three factors related to the resection range, as well as the type of digestive reconstruction and specimen extraction route, the method of NOSES for GC can be divided into nine types (Table 1)[6]. In addition, the consensus described in detail the indications and contraindications, precautions and approach of surgery, and solutions to the difficulties in specimen extraction of GC-NOSES, which would be instructive for the development of NOSES in clinical practice. In general, there are seven steps in the NOSES procedure: (1) Preoperative course; (2) Positioning and placement of trocars; (3) Localization of the tumor; (4) Laparoscopic subtotal gastrectomy; (5) Trans-natural cavity (mouth, rectum, and vagina) specimen extraction; (6) Digestive tract reconstruction; and (7) Postoperative course. More significantly, the resection range of gastrectomy cannot be intentionally reduced due to specimen extraction through a narrow orifice. Based on different tumor locations, the methods of gastrectomy and reconstruction should be carefully selected to preserve gastrointestinal function. In addition, the anastomosis should be provided with sufficient blood supply and no tension or stenosis [21].
CONCLUSION
NOSES is better than traditional laparoscopic assisted radical gastrectomy for GC in some aspects. For example, it avoids abdominal surgical incision, and eliminates incision-related complications such as incision site infection, difficult or non-healing incision, wound dehiscence, incisional hernia, abdominal incision tumor implantation, and even the pain and scarring caused by the incision [30]. In addition, it can eliminate the incision scar related psychological impact, psychological burden, and psychological trauma of surgery [8]. NOSES for GC also reflects the doctor's pursuit of people-oriented principle, by prioritizing the interests of the patients. However, we should also pay attention to the shortcomings and potential complications of NOSES for GC. For example, due to the unique intraluminal anastomosis and the approach of specimen extraction in NOSES for GC, there are potential risks, such as intraperitoneal exposure and dissemination of tumor cells, intraperitoneal bacterial infection, structural or functional damage of natural lumen, abscission and implantation of tumor cells. Due to the lack of relevant reports on NOSES for GC, we can only learn from other literature reports on gastrointestinal surgery using this technique.
In recent years, specimen extraction via a natural orifice, an emerging minimally invasive surgical technique, has become one of the research hotspots in the surgical field nationally and internationally. This technique has been preliminarily applied to gastroenterological surgery in many national medical centers around the world. With the increasing number of surgical cases, NOSES has gradually become a novel modality for GC treatment, which not only provides a better treatment choice for patients and operators, but has also gained more and more attention and recognition from experts and scholars worldwide.
However, we should also be aware that the clinical development of GC-NOSES is still in its infancy. Research on GC-NOSES has mainly focused on single-center, small sample and retrospective analyses [22,23], indicating a lack of large sample and multi-center prospective studies to support the extensive development of GC-NOSES in evidence-based medicine. In addition, GC-NOSES related complications deserve further investigation, such as abdominal infection, natural orifice injury, tumor implantation metastasis, anastomotic leakage, prognosis and recurrence in patients, and its long-term efficacy.
|
v2
|
2022-11-29T06:16:46.704Z
|
2022-11-27T00:00:00.000Z
|
254043200
|
s2ag/train
|
Diagnosis of Metastatic Lymph Nodes in Patients with Papillary Thyroid Cancer: A Comparative Multi-Center Study of Semantic Features and Deep Learning-Based Models.
OBJECTIVES
Deep learning algorithms have shown potential in streamlining difficult clinical decisions. In the present study, we report the diagnostic profile of a deep learning model in differentiating malignant and benign lymph nodes in patients with papillary thyroid cancer.
METHODS
An in-house deep learning-based model called "ClymphNet" was developed and tested using two datasets containing ultrasound images of 195 malignant and 178 benign lymph nodes. An expert radiologist also viewed these ultrasound images and extracted qualitative imaging features used in routine clinical practice. These signs were used to train three different machine learning algorithms. Then the deep learning model was compared with the machine learning models on internal and external validation datasets containing 22 and 82 malignant and 20 and 76 benign lymph nodes, respectively.
RESULTS
Among the three machine learning algorithms, the support vector machine model (SVM) outperformed the best, reaching a sensitivity of 91.35%, specificity of 88.54%, accuracy of 90.00%, and an area under the curve (AUC) of 0.925 in all cohorts. The ClymphNet performed better than the SVM protocol in internal and external validation, achieving a sensitivity of 93.27%, specificity of 92.71%, and an accuracy of 93.00%, and an AUC of 0.948 in all cohorts.
CONCLUSION
A deep learning model trained with ultrasound images outperformed three conventional machine learning algorithms fed with qualitative imaging features interpreted by radiologists. Our study provides evidence regarding the utility of ClymphNet in the early and accurate differentiation of benign and malignant lymphadenopathy.
|
v2
|
2022-11-29T06:16:46.774Z
|
2022-11-27T00:00:00.000Z
|
254043019
|
s2ag/train
|
Activated fibroblasts induce immune escape of TSCC through CCL25/AKT pathway.
OBJECTIVES
Accumulating evidence suggests that activated fibroblasts are the key cells in the T cell response to tumor immunosuppression. We attempted to investigate the effect of activated fibroblasts on PD-L1 expression and the related immune escape mechanism in tongue squamous cell carcinoma.
METHODS
Western blotting, qPCR and other techniques were used to study the expression of PD-L1 in tongue squamous cell carcinoma cells and the nude mouse model of transplanted tumors in vivo, clinical tissue samples were verified. In addition, we established a direct coculture model of T cells and tongue squamous cell carcinoma cells explore the mechanisms of immune escape.
RESULTS
We found that PDGF-BB induces fibroblast activation by facilitating the oversecretion of chemokine CCL25. Further analysis showed that CCL25 derived from activated fibroblasts activated the Akt signaling pathway to promote PD-L1 expression. The activated fibroblasts inhibited T cell IFN-γ secretion through the CCL25/Akt/PD-L1 pathway, which indirectly inhibited T cell proliferation.
CONCLUSION
Activated fibroblasts can induce the high expression of PD-L1 in the oral and tongue squamous cell carcinoma cell line Cal-27 via the CCL25/CCR9/p-Akt axis, to significantly inhibit the proliferation and IFN-γ secretion of T cells and promote the immune escape of tongue squamous cell carcinoma cells.
|
v2
|
2022-11-30T07:17:31.482Z
|
2022-11-27T00:00:00.000Z
|
254091525
|
s2orc/train
|
New CagL Amino Acid Polymorphism Patterns of Helicobacter pylori in Peptic Ulcer and Non-Ulcer Dyspepsia
Background and Objectives: Helicobacter pylori infection is associated with chronic gastritis, ulcers, and gastric cancer. The H. pylori Type 4 secretion system (T4SS) translocates the CagA protein into host cells and plays an essential role in initiating gastric carcinogenesis. The CagL protein is a component of the T4SS. CagL amino acid polymorphisms are correlated with clinical outcomes. We aimed to study the association between CagL amino acid polymorphisms and peptic ulcer disease (PUD) and non-ulcer dyspepsia (NUD). Materials and Methods: A total of 99 patients (PUD, 46; NUD, 53) were enrolled and screened for H. pylori by qPCR from antrum biopsy samples. The amino acid polymorphisms of CagL were analyzed using DNA sequencing, followed by the MAFFT sequence alignment program to match the amino acid sequences. Results: Antrum biopsy samples from 70 out of 99 (70.7%) patients were found to be H. pylori DNA-positive. A positive band for cagL was detected in 42 out of 70 samples (PUD, 23; NUD, 19), and following this, these 42 samples were sequenced. In total, 27 different polymorphisms were determined. We determined three CagL amino acid polymorphism combinations, which were determined to be associated with PUD and NUD. Pattern 1 (K35/N122/V134/T175/R194/E210) was only detected in PUD patient samples and was related to a 1.35-fold risk (p = 0.02). Patterns 2 (V41/I134) and 3 (V41/K122/A171/I174) were found only in NUD patient samples and were linked to a 1.26-fold increased risk (p = 0.03). Conclusions: We observed three new patterns associated with PUD and NUD. Pattern 1 is related to PUD, and the other two patterns (Patterns 2 and 3) are related to NUD. The patterns that we identified include the remote polymorphisms of the CagL protein, which is a new approach. These patterns may help to understand the course of H. pylori infection.
Introduction
Helicobacter pylori colonizes the gastric mucosa, causing asymptomatic colonization, chronic gastritis, ulcers, or gastric cancer [1]. While many bacteria are only considered infectious agents, H. pylori is well known for causing gastric cancer. The worldwide prevalence of H. pylori infection is important not only for gastric cancer but also for the economic burden of treatment. Although many virulence factors are considered to play a role in H. pylori's pathogenesis, CagA protein and the EPIYA motif coded in cag pathogenicity islands (cagPAI) have been proven to be associated with gastric cancer [2][3][4][5][6]. The colonization of H. pylori is the first step in its pathogenicity, but the events that happen thereafter seem more crucial. Briefly, after passing the mucin barrier, H. pylori colonizes close to the epithelial layer and mostly adheres to epithelial cells. Via the Type 4 secretion system (T4SS), CagA proteins are transferred into epithelial cells [2,7]. In this transfer process, it has been shown that the CagL protein, a T4SS protein, is crucial [8]. After being transferred to the cell, the phosphorylation of the CagA protein on tyrosine residues is associated with the spreading of the cells and thus the development of gastric cancer [3,[9][10][11].
If we focus on H. pylori infection, which starts with the adherence of bacteria to the epithelial cell surface, there are some key events and proteins. CagL protein has been investigated extensively, and the role of different amino acid polymorphisms has been assessed in many studies. One of the motifs on CagL is RGD (arginine, glycine, and aspartate; 76-78th residues on the protein), which interacts with the integrins α5β1, α5β5, and α5β3 on the epithelial cell [12][13][14]. These interactions result in IL-8 secretion, which triggers cell spreading, focal adhesion, and the activation of several tyrosine kinases [15,16]. There is an RGD helper sequence (RHS) that is composed of phenylalanine-glutamic acid-alanine-asparagine-glutamic acid (FEANE 86-90) that helps the RGD sequence bind integrin α5β1 [17]. L79 and L82 (two leucine residues) form another functional motif called LXXL, which allows bacteria to adhere to cell lines via integrin α5β6 [18]. Another motif called TASLI (threonine-alanine-serine-leucine-isoleucine 170-174) binds to integrins in an RGD-independent manner. Its deletion is related to reduced CagL binding to integrins, leading to reduced IL-8 secretion and CagA translocation [8]. Aside from these important motifs, there is a highly variable region on positions 58-62 called the CagL hypervariable motif (CagLHM). It has been shown that polymorphisms in this region affect the binding affinity of CagL to integrin α5β1 [19]. Polymorphisms in this region are quite important, and they are mostly associated with gastroduodenal diseases such as gastric cancer, chronic gastritis, and peptic ulcer [20][21][22][23][24][25][26]. Additionally, CagLHM amino acid polymorphisms show a geographic distribution similar to EPIYA-C/D [27]. Gorrell et al. [27] determined 33 motifs, of which DKMGE, NEIGQ, NKIGQ, and DKIGK are present in 75% of all strains worldwide. DKMGE is especially prevalent in Africa and America, but not in Asia. Other motifs, such as NEIGQ and NKIGQ, are dominant in Europe. CagLHM shows great variability in Asia, and the NEIGQ motif is prevalent in Western Asia, whereas DKIGK is dominant in Eastern Asia. Due to the diversity in this region, IL-8 response also varies between Eastern and Western Asia, as shown by Choi et al. [28].
Although there have been many studies focused on CagL amino acid polymorphisms related to gastroduodenal diseases, it is obvious that many more studies are needed. Although H. pylori infection is widely spread in our region and has been studied well in areas such as epidemiology, antibiotic resistance, and immunopathogenesis, data on CagL amino acid polymorphisms are limited. Due to the lack of data, we aimed to study the association between CagL amino acid polymorphisms and peptic ulcer disease (PUD) and non-ulcer dyspepsia (NUD).
Study Design
This study was planned as a cross-sectional study. Study subjects were selected among patients with dyspepsia symptoms who applied to the endoscopy unit of the gastroenterology clinics at Istanbul Bakirkoy Dr. Sadi Konuk Training and Research Hospital. A total of 99 patients (PUD, 46; NUD, 53) who had been diagnosed by a gastroenterologist via endoscopic evaluation were enrolled in the study. Antrum and corpus biopsy samples were taken from patients between April 2019 and February 2020.
Patients younger than 18 years old who had undergone gastric surgery, received H. pylori eradication treatment, consumed antibiotics in the previous month, consumed anti-secretory drugs, bismuth salts, or sucralfate in the last 2 weeks, or had a history of bleeding and/or coagulation disorders were excluded from this study.
All the patients signed an informed consent form, and the study was approved by the Istanbul Aydin University Ethics Committee (2019/82).
DNA Extraction
In this study, 200 mg of antrum biopsy samples were used for genomic DNA extractions. First, samples were transferred into a lysis solution (0.5 µg/µL Proteinase K, 5% Tween 20, 3 M guanidinium thiocyanate, 20 mM Tris-HCl, pH 8.0) and incubated at 70 • C for 15 min, followed by additional incubation at 95 • C for 5 min. Then, 500 µL of isopropanol was added before being transferred into a silica column and centrifuged at maximum speed for 2 min. DNA columns were washed twice with a washing solution (20 mM NaCl, 2 mM Tris-HCl 80% ethanol, pH 7.5). Then, DNA samples were eluted in 50 µL of elution solution (100 mM Tris-HCl, pH 8.0) and stored at −20 • C until further analysis.
H. pylori Detection
We used qPCR to detect H. pylori DNA in the samples; forward and reverse primers (5 -GCTCTCACTTCCATAGGCTATAATGTG-3 and 5 -GCGCATGTCTTCGGTTAAAAA-3 , respectively) designed by Saez et al. were used to detect the urease gene [29]. qPCR reactions were performed according to the manufacturer's recommendations (Premix Ex Taq Mastermix, Takara Bio Inc., Shiga, Japan) using a BioRad CFX96 Real-Time PCR Detection System (Bio-Rad Laboratories, Hercules, California, USA). The amplification conditions were as follows: initial denaturation at 95 • C for 30 s, 40 cycles of 95 • C for 10 s, and 60 • C for 30 s.
H. pylori cagL Sequencing
The primers cagL-B4: 5 -GCAGAATTCATAACAAGCGGCTTAAAG-3 and cagL-B5: 5 -ATTAGAATTCATAGCCTATCGTCTCAG-3 were used for the amplification of 695 bp of fragments during cagL sequencing [30]. DreamTaq DNA Polymerase (Thermo Fisher Scientific, Waltham, MA, USA) was used for PCR according to the manufacturer's recommendations, with an annealing temperature of 55 • C. PCR amplification was verified on a 2% agarose gel and subjected to Sanger sequencing. The cagL sequence of H. pylori strain P12 (GenBank: ACJ07700.1) was used as a reference. The cagL sequences were translated to corresponding amino acid sequences using the sequence alignment program MAFFT [31], and the detection of polymorphisms was performed and visualized using Jalview v2.11.2.4 [32]. Neighbor-joining phylogenetic trees were constructed from both cagL nucleotides and translated amino acid sequences using the MEGA11 (version 11.0.13) program with the bootstrap method at 500 replications [30].
Statistical Analysis
Statistical analyses were carried out using IBM SPSS Statistics version 25.0 (IBM Corp., Armonk, NY, USA). The association between CagL amino acid polymorphisms and gastroduodenal diseases was evaluated by Fisher's exact test. Risk assessments of specific patterns were calculated by binary logistic regression. All statistical tests were two-sided, and a p value lower than 0.05 was considered statistically significant.
Results
In total, 70 out of 99 samples (70.7%) were positive for H. pylori DNA in this study. We observed that H. pylori DNA positivity was higher in PUD patients, with a percentage of 84.4 (38/46) compared to 60.3 (32/53) in NUD patients.
A positive band for cagL was detected in 42 out of 70 (60%) samples (PUD, 23; NUD, 19), and following this, these 42 samples were sequenced. Sequencing data were aligned against the H. pylori strain P12 ACJ07700 locus and showed >95% homology. A total of 27 different CagL amino acid polymorphisms and their frequencies were determined and are provided in Table 1 Table 2). The DKI sequence, known as the East Asia sequence, was observed at a 9.5% frequency. CagL amino acid polymorphisms 22F and 114M were detected at 100% in both the PUD and NUD patient samples. CagL amino acid polymorphisms and their distributions between groups are given in Table 1. The 84T, 154K, 171V, 172P, and 174V polymorphisms were only detected in PUD patient samples, and the 154Q, 203I, 206S, and 223Q polymorphisms were only detected in NUD patient samples ( Table 1). The CagL amino acid polymorphisms among groups showed variability, but there was no statistical significance in any polymorphism alone (p > 0.05).
The percentages of CagLHM amino acid polymorphisms and sequences in both the PUD and NUD patient samples are given in Tables 1 and 2. The NKMGQ and DKMGE sequences were only detected in NUD patient samples. In our study, we did not find any association between the CagLHM sequences and gastroduodenal diseases (p > 0.05).
Three CagL amino acid polymorphism combinations associated with PUD and NUD were determined ( Table 3). The CagL amino acid polymorphism combinations and their relative risk assessments are given in Table 4. Pattern 1 was only detected in 6 out of 23 PUD patient samples and was associated with a 1.35-fold risk (p = 0.02). Patterns 2 and 3 were found in only four NUD patient samples and were associated with a 1.26-fold risk (p = 0.03). The constructed neighbor-joining trees from cagL nucleotide and amino acid sequences from 42 samples are presented in Figure 1. No characteristic clusters were observed between PUD and NUD for both the DNA and amino acid sequences of CagL.
Discussion
The correlation between H. pylori-related clinical outcomes and many virulence factors is still an important research topic that will help us understand the pathogenesis of H. pylori. Specifically, the EPIYA motif in the cagA gene region of H. pylori has been shown to be associated with gastric cancer. It has been proven that the EPIYA-D segments in eastern strains of H. pylori and the EPIYA-C segments in western strains of H. pylori play a role in the development of gastric cancer [2,3]. T4SS plays an important role in the translocation of CagA to the gastric epithelium, which is essential in the gastric carcinogenesis caused by H. pylori. The interaction of the CagL protein with integrins in the gastric epithelium has an important role in the binding of H. pylori [7,8]. The interaction of CagL with the gastric epithelium and the correlation of CagL amino acid polymorphisms with different clinical outcomes have been investigated in various studies. CagLHM, in particular, is a highly polymorphic region of the CagL protein found between the 58th and 62nd amino acids. It has been reported that H. pylori CagL Y58E59 polymorphisms cause an upward shift in integrin α5β1 in the corpus, causing more severe chronic inflammation in the corpus and increasing the risk of gastric cancer [22]. It has also been shown that H. pylori CagL Y58/E59 still maintains its stronger binding affinity to integrin β1, CagA translocation, and IL-8 secretion activity, even under adverse low pH conditions [23]. However, isogenic CagL Y58/E59 variants of H. pylori 26695 have been reported to significantly block the translocation and phosphorylation of CagA compared to wild-type CagL [33]. Similarly, it was determined that the transfer of H. pylori CagL Y58E59, D58K59, D58E59, N58E59, or N58K59 polymorphisms did not significantly alter CagA translocation and IL-8 secretion [34]. It has been considered that variations at CagL positions 58 and 59 do not affect T4SS function but may instead work in concert with certain polymorphisms elsewhere in CagL to mitigate disease progression [34].
In addition to these, the distribution of the polymorphisms in this region varies among different geographic regions and shows different associations with gastroduodenal diseases. Understanding the association between the geographical differences along with CagL polymorphisms and the clinical outcomes is of great importance, as it can provide very important information about diseases linked to H. pylori. Rizzato et al. [20] showed 74 nucleotide polymorphisms in the cagL gene in H. pylori strains in Mexico and Venezuela and reported that four of them (166, 172, 228, and 516 positions) were associated with gastric cancer. Yeh et al. [22] evaluated residues 58, 59, 122, 201, 210, 216, 221, and 234; and Shukla et al. [21] evaluated residues 35, 58, 59, 60, 62, and 122 in different studies. They showed that polymorphisms in amino acid residues 58 and 59 are associated with gastric cancer risk. Unlike Yeh et al. [22], Shukla et al. [21] reported that D58 and K59 are associated with gastric cancer in India. On the contrary, Cherati et al. [24] reported that the D58 polymorphism is related to PUD but not to gastric cancer in Iran. A study from Mexico stated that D58/K59 polymorphisms are dominant in chronic gastritis patients [26]. A study from Turkey by Ozbey et al. [35] found that D58 polymorphisms are associated with gastric cancer and duodenal ulcers (thesis). Gorrell et al. [27] did not find any association between PUD and CagLHM amino acid polymorphisms in their global analysis. Various correlations of CagLHM amino acid polymorphisms with clinical outcomes in the research show CagL variability in regional H. pylori strains. In this study, the CagL protein (sequence between 21 and 237) of H. pylori in samples from PUD and NUD patients were analyzed. In total, 27 CagL amino acid polymorphisms were detected. Their distribution among groups shows variability, but there was no statistical significance in any CagL amino acid polymorphism evaluated alone (Table 1). Moreover, we did not find any significant relationship between the CagLHM amino acid polymorphisms and the study groups (Table 1). Although there was no significant difference between groups, the dominance of N58, I60, and Q62 in the PUD group and the 100% presence of I60 and Q62 in the PUD group were striking. Although the reported associations between polymorphisms in the CagLHM region in particular and H. pylori-related clinical outcomes have been found in various studies [22,23], the same polymorphism has also been associated with different clinical outcomes [21,24,26], or, similar to our results, no relation has been found [27]. This variability in the association between CagL polymorphisms and clinical outcome suggests that it may be related to factors such as the association of cagL with other gene regions or the association of CagL polymorphisms with other CagL polymorphisms. For example, H. pylori CagL/or f17 genotypes were found to be risk factors for peptic ulcer [36]. Similarly, multiple EPIYA-C repeats and the CagLHM NEIGQ sequence were reported to be correlated with PUD and gastric cancer risk [30]. Tafreshi et al. [34] also determined that the effect of different polymorphisms at positions 58 and 59 of CagLHM on T4SS function was not different. This suggests that combining various data sets to determine the association of CagL polymorphisms with clinical outcome may be beneficial.
Many researchers have described different amino acid sequences for CagLHM, of which DKMGE, NEIGQ, NKIGQ, and DKIGK are the dominant ones, constituting 75% of all amino acid combinations worldwide. In the Americas, DKMGE, NEIGQ, and -IGK are the most frequent sequences. NEIGQ, NKIGQ, and DKMGE are the most frequent sequences in Europe. The most diverse distributions were observed in Asian countries (a total of 27 different variants), in which NEIGQ and DKIGK were the most prevalent sequences [27]. Yadegar et al. [30] reported 10 different variants, with the most prevalent ones being NEIGQ and NKIGQ, with 45.7% and 19.6% frequencies, respectively, in Iran.
Nevertheless, the worldwide distribution of CagLHM amino acid sequences and their significance in duodenal diseases are important and well-studied. Yadegar et al. [30] found that NKMGK is related to PUD, with a 42.8% prevalence. Roman et al. [26] reported the frequencies of DKMGE (75%), NEIGQ (6.1%), and NKMGQ (6.1%) sequences in chronic gastritis patients. In Thailand, Ogawa et al. [37] reported six different sequences and found that all gastric ulcer and duodenal ulcer patients have the same H. pylori with the sequence DKIGK, whereas its frequency in gastritis patients without ulcer is 66.6%. In addition, Ozbey et al. [35] reported a 58-fold risk of gastric cancer in patients infected with the H. pylori strain carrying the DKIGQ sequence in our country but did not report a risk for duodenal ulcer (master's thesis). The distributions of CagLHM amino acid sequences detected in our study were similar in the PUD and NUD groups ( Table 2). In our study, we did not find any association between the CagLHM amino acid sequences and gastroduodenal diseases, but their distribution is similar to that of the Asian profile due to the lower percentage of DKMGE, and the other way around due to the lack of diverse sequences.
Other than CagLHM, there are other CagL amino acid polymorphisms related to gastroduodenal diseases. Cherati et al. [24] reported that N122 and K35 are associated with the risk of developing a peptic ulcer, and V134 and N122 increase gastric cancer risk compared to gastritis patients with CagL amino acid polymorphisms I134 and K122. Similarly, the frequencies of amino acid polymorphisms T88, N101, A141, and E142 were found to be increased in gastric cancer patients, and the D201 and V234 amino acid polymorphisms were found to be increased in non-GC patients [37]. Roman et al. [26] reported that K122, I134, M73, and I175 are common polymorphisms among chronic gastritis patients in Mexico.
No significant association between polymorphisms in cagL and the clinical outcomes found in our study was detected. However, studies have suggested that it would be beneficial to evaluate all polymorphisms together and not just CagL polymorphisms alone. When we evaluate our data from this point of view, although none of the polymorphisms alone are related to PUD and NUD, their combinations showed associations in our study (Table 4). Pattern 1, which includes the K35, N122, V134, T175, R194, and E210 residues, was found to be associated with a 1.35-fold peptic ulcer risk (p = 0.02). The other two patterns were associated with a 1.26-fold NUD risk: pattern 2: V41 and I134 (p = 0.03) and pattern 3: V41, K122, A171, and I174 (p = 0.03). All three patterns were disease-state specific. Pattern 1 was only observed in the PUD group, and patterns 2 and 3 were only observed in the NUD group. These patterns, which were found to be associated with PUD and NUD in our study, show that the evaluation of the association of polymorphisms at different positions outside of CagLHM may contribute to our understanding of the association of H. pylori with clinical outcome. Other CagL polymorphisms, such as the correlation of certain CagLHM polymorphisms with diseases or polymorphisms in other H. pylori proteins, are thought to be extremely important to study together in order to gain a better understanding of the association with clinical outcome. The coexistence of polymorphisms in different regions of CagL may possibly affect the overall activity of the protein. Modeling the effect of different polymorphisms on the overall CagL crystal structure may be useful to evaluate how CagL alters structure and function.
There are some limitations to our study. For example, the number of samples in the study groups is small. With a larger sample size, an association can be determined between single amino acid polymorphisms and clinical outcomes. Additionally, with a larger sample size, different patterns associated with different clinical outcomes can be detected. Another limitation of our study is that it did not include a gastric cancer group. Studies involving patients with gastric cancer may contribute to the association of gastric cancer with CagL polymorphisms.
Conclusions
In conclusion, the diversity of the H. pylori CagL amino acid polymorphisms detected in this study matches both European and Asian H. pylori strains. We observed three new patterns related to gastroduodenal diseases. Using this combination approach, it can be seen that CagL amino acid polymorphisms other than those in the CagLHM region are important as well. Pattern 1 is related to PUD, and the other two patterns (patterns 2 and 3) are related to NUD. Consideration of these patterns and the evaluation of CagL polymorphisms from this perspective may be useful for understanding the course of H. pylori infection. Further investigations on these patterns with a larger sample size that includes gastric cancer patients may be useful in terms of approaches to H. pylori infection.
|
v2
|
2022-11-30T16:09:49.532Z
|
2022-11-27T00:00:00.000Z
|
254090662
|
s2orc/train
|
Impact of Loneliness on Functioning in Lung Cancer Patients
Lung cancer is the leading cause of cancer death and carries a greater degree of stigma. Lung cancer stigma contributes to social isolation and increases loneliness, which has an impact on quality of life, increases depressive symptoms and hence affects all aspects of functioning. Functioning is assessed in five dimensions (physical, psychological, cognitive, social and life roles). The aim of the study was to assess the impact of loneliness on the functioning, nutritional status and quality of life of patients with lung cancer. METHODS. The survey study was conducted among 310 lung cancer patients. The patients were asked to complete the Mini-MAC, HADS-M, MNA, EORTC QoL, AIS and VAS questionnaires. RESULTS. In total, 136 patients were lonely and 174 were married or in a relationship. Lonely patients had significant difficulty accepting their illness and demonstrated higher levels of depression. The factors most strongly associated with loneliness were being unemployed, age 61 or over and a less score in the constructive coping strategies. CONCLUSIONS. Loneliness is a significant factor affecting the functioning of patients with lung cancer. It increases the risk of anxiety and depression, reduces levels of illness acceptance, reduces levels of constructive coping and increases the risk of malnutrition.
Introduction
Lung cancer accounts for 13% (1.6 million) of new cancer cases worldwide (12.7 million). It is the most commonly diagnosed cancer in men and the leading cause of cancer death (1.4 million, 18% of cancer deaths worldwide) [1]. There are many risk factors for lung cancer and a number of clinical conditions that are associated with an increased incidence of the condition. These include idiopathic pulmonary fibrosis, systemic sclerosis, dermatomyositis, ascites and asbestosis [2,3]. With advances in cancer detection and treatment, the number of cancer survivors has been increasing. The improved cancer survival mandates attention to the functioning of patients, their quality of life (QoL), including their mental and physical health, and their experience of loneliness [4]. Functioning is assessed in five dimensions (physical, psychological, cognitive, social and life roles). Functioning in patients with lung cancer is affected as follows: severity of symptoms, increasing disability, inability to fully fulfill family and social roles, sleep and respiratory problems, fatigue related to the disease and burdensome treatment [5]. Despite significant advances in the detection and treatment of lung cancer, the prognosis is often poor [6]. This is due to the severity of clinical symptoms and intensive treatment regimens [7], which significantly affect the mental health and QoL of patients and increase their loneliness [8][9][10]. In addition, patients with lung cancer belong to the group of patients with a relatively high frequency of malnutrition. Low nutritional status also affects the QoL, physical performance and survival rate [11].
Loneliness is a painful experience for patients. We can distinguish loneliness in family and social relationships and loneliness in relationships with healthcare professionals [12]. Loneliness is a very important psychosocial factor for cancer patients. It has a negative impact on their QoL [13,14], precedes sleep difficulties [15], physical [16] and functional inactivity [17], increases their depressive symptoms [18,19] and thus affects all aspects of their functioning [8]. Lung cancer carries a greater degree of stigma than other types of cancer [20]. The stigma results from the fact that lung cancer patients are assumed to be smokers, regardless of whether they have a history of smoking [21,22]. This causes them to feel shame and guilt [21,23]. As a result, patients delay visiting a doctor for their worrying symptoms, which delays the diagnosis and has a negative impact on the prognosis. The stigma contributes to the social isolation of patients, increasing their loneliness.
The aim of the study was to assess the impact of loneliness on the functioning, nutritional status and quality of life of patients with lung cancer.
Materials and Methods
The prospective, cross-sectional, survey study was conducted among 310 patients treated for lung cancer at the Lower Silesian Oncology Centre. The patients were aged between 25 and 87 years (median 64 years). The patients were asked to complete the Mini-MAC, HADS-M, MNA (Mini-Nutritional Assessment) and EORTC QoL questionnaires as well as the Acceptance of Illness Scale (AIS) and the Visual Analogue Scale (VAS), which measures pain intensity. Patients also completed a questionnaire on sociodemographic data such as follows: level of education, domicile, employment status (working professionally or unemployed, on retirement, on benefits or disability pensions, state of relationship (lonely, married or in a relationship). The general and clinical characteristics of the patients studied are shown in Tables 1 and 2. The Mini-MAC scale is used to assess a cancer patient's mental adjustment to their illness. It evaluates the following constructive and destructive cancer coping strategies: anxious preoccupation, fighting spirit, helplessness-hopelessness and positive redefinition. Each category includes 7 items and has a possible score range of 7-28. The higher the score, the stronger the behaviour typical of a given strategy. Scores on the Mini-MAC scale may also serve as a measure of health-related QoL [24].
We assessed the patients for depressive and anxiety symptoms using the HADS scale. The scale consists of 2 subscales, containing 7 items each. Each item is rated on a 4-point scale (0-no, not at all, 1-no, not much, 2-yes, sometimes, 3-yes, definitely). The tool yields separate scores for depression and anxiety. A score of 0-7 is classified as 'normal', a score of 8-10 is classified as a 'borderline' case and a score of 11-21 represents a 'case' of psychological morbidity [25,26].
We assessed the nutritional status using the Mini-Nutritional Assessment (MNA) questionnaire [27,28]. The questions are related to measures such as follows: BMI, mid-arm and calf circumference, weight loss in the past 3 months, lifestyle, dietary habits with the number of meals and fluid intake, mobility level and patient's assessment of his/her health and nutritional status. In this questionnaire a maximum of 30 points can be achieved. Results below 17 points indicate about malnutrition, 17-23,5 about risk of malnutrition and a score of 24-30 points are defined as normal nutritional status.
We assessed the QoL of the patients using the EORTC QLQ-C30 questionnaire, which consists of 30 questions. It is used to assess physical, cognitive, emotional, social functioning and functioning in life roles. Moreover, the instrument has additional symptom scales (fatigue, nausea and vomiting, pain, dyspnoea, insomnia, loss of appetite, constipation, diarrhoea) and incorporates the perceived financial impact of the disease [29,30]. A score range in all sub-scales and individual items is from 0 to 100 points. A better function and a higher quality of life are represented by a higher score. However, a higher score achieved in symptom subscale, the greater severity of symptoms. All items and subscales are considered separately due to the impossibility of evaluating the total score. The scores are evaluated using normative data [31]. 15 (11.0) 13 (7.5) 0.278 * TNM-The TNM classification of malignant tumors, Tx-tumor cannot be assessed; T1-T4-size and/or extension of the primary tumor; Nx-lymph nodes cannot be assessed; N0-no regional lymph nodes metastasis; N1-regional lymph node metastasis present, at some sites, tumor spread to closest or small number of regional lymph nodes; N2-tumor spread to an extent between N1 and N3; N3-tumor spread to more distant or numerous regional lymph nodes, Mx-cancers that cannot be evaluated for distant metastasis, M0-no distant metastasis, M1,M2-metastasis to distant organs beyond regional lymph nodes.
The Acceptance of Illness Scale (AIS) is used to assess the extent to which a patient has accepted their illness. It consists of 8 items with a 5-point scale concerning the negative consequences of illness. The higher the score, the higher the degree of illness acceptance. The scale can be used for any disease. In this study, we used it to assess the degree of lung cancer acceptance [32].
The Visual Analogue Scale (VAS) is used to measure pain intensity. It is a 10 cm line with the following two anchors: 0 = no pain and 10 = worst pain possible. The study was conducted in accordance with the Declaration of Helsinki and approved by the Ethics Committee of Wroclaw Medical University No 729/2019. Statistical methods. Continuous and discrete variables significantly differentiating lonely patients from those who were married or in a relationship were transformed into dichotomous variables. Threshold values were determined based on a ROC curve analysis. The proportions of patients in subgroups differing in marital status and functioning status, as assessed using the Mini-MAC, AIS and HADS questionnaires, results of independence tests and the values of odds ratios are shown in Table 3. The reliability of the Polish version of the AIS is close to the original version in terms of consistency and stability (Cronbach's alpha = 0.82). The Polish adaptation of the AIS scale developed by Juczyński was used in the study [33]. In earlier studies using the AIS scale, a relationship was found between a level of acceptance of the disease and the subjectively assessed quality of life. The MAC (Mental Adjustment to Cancer) scale was developed by M. Watson et al. The Polish language version prepared by Jurczyński has good psychometric properties [34]. The EORTC QLQ-C30 questionnaire is a questionnaire repeatedly used to assess the quality of life of patients with lung cancer. Excellent psychometric properties were used in this study group.
The sample size analysis was carried out based on one of the main primary objectives, which assumed at least 20% less a cancer patient's mental adjustment to their illness in people living alone compared to people who are married or in a relationship. The minimum sample size needed to detect this difference assuming alpha = 5%, power = 80% and confidence level = 95% is 282 patients in total. Additionally, the risk of not completing the questionnaires correctly was assumed at the level of 10%. The final sample size is 310 participants. Sample size analysis was performed using the G*Power program [35].
For descriptive data, proportions for qualitative variables and means with SDs or medians with interquartile ranges (IQR) (25th-75th) for quantitative variables were used. The normality of distribution of variables was assessed using the Kolmogorov-Smirnov test and the Shapiro-Wilk goodness-of-fit test. Comparisons between lonely patients and those who were married or in a relationship were carried out using the Chi-square test or the z-test for two proportions for qualitative variables or the Student's t-test or Mann-Whitney U-test for quantitative variables, as appropriate. Baseline factors associated with loneliness were analysed using univariate and multivariate logistic analysis. Variables yielding p-values of less than 0.2 in the univariate analysis were considered for inclusion in the multivariate analysis. The p < 0.2 level was adopted arbitrarily. The idea was not to overlook factors in multivariate analysis that in univariate analysis weakly correlate with the dependent variable, but in interaction with other independent variables may have a significant impact on the response of the model. The multivariate analysis (Table 4) did not include variables such as male sex (p = 0.564) and living in the city (p = 0.743), which were not significantly related to marital status ( Table 1). The quality of the proposed logistic regression model was assessed using the Hosmer-Lemeshow test. All tests were two-sided at a significance level of 0.05. Statistical analysis was performed using the STATISTICA package, version 13.3 (TIBCO Software Inc., Palo Alto, CA, USA). b-logistic regression coefficient, beta-standardised logistic regression coefficient, OR-odds ratio.
Results
Of the 310 patients studied, 136 (43.9%) were lonely and 174 declared that they were married or in a relationship. Among the surveyed people-patients who declared that they were married or in a relationship-there were no people who declared to feel lonely. Therefore, the groups were divided into subgroups of lonely and married or in a relationship. Men accounted for 55.1% (n = 75) of lonely patients and 58.6% (n = 102) of patients who were married or in a relationship. Only 10.3% of lonely patients were employed. For patients who were married or in a relationship, the percentage was 41.4%. Of the lonely patients, most had vocational education, followed by secondary education, then primary education and tertiary education. Of the patients who were married or in a relationship, the statistics were similar, except that a larger percentage were patients with tertiary education levels than primary education. The exact percentage results are shown in Table 1. The most common cancer stages were T2 and T4. More than 60% of lonely patients and more than 50% of patients who were married or in a relationship did not have distant metastases. The most common metastatic sites were the liver, adrenal gland, bone and brain.
The results are shown in Table 1. Lonely patients with lung cancer were older than patients married or in a relationship by an average of 6 years, had poorer education (p = 0.033) and were more likely to be unemployed (p < 0.001) compared with patients who were married or in a relationship. Lonely patients also tended to have a lower stage of primary cancer (p = 0.082).
General and clinical characteristics are presented in Table 2. In total, 39.7% of lonely patients and 44.8% of patients who were married or in a relationship had a history of smoking. Of the lonely patients, most had a moderate degree of airway obstruction, and a smaller group of respondents had a low degree of airway obstruction and a severe degree of airway obstruction. Comparable results are presented in the group of people married or living in a relationship.
In total, 50% of lonely patients and 48.3% of patients who were married or in a relationship had undergone surgery. The most commonly reported symptoms were chronic cough, dyspnoea, pain in the chest, haemoptysis, recurring infections, superior vena cava syndrome, arrhythmia and hoarseness, the frequency of which is shown off in Table 2.
Of the lonely patients studied, 35.3% had a satisfactory nutritional status, 44.9% were at risk of malnutrition and 19.9% were malnourished. Of the patients who were married or in a relationship, 44.3% had a satisfactory nutritional status, 37.9% were at risk of malnutrition and 17.8% were malnourished.
Lonely patients had more comorbidities and showed a higher degree of limitation in physical activity. Compared with patients who were married or in a relationship, lonely patients had lower scores on the fighting spirit and positive redefinition subscales of the Mini-MAC questionnaire, which measures the degree of mental adjustment to cancer.
Lonely patients were less likely to use the anxious preoccupation, fighting spirit and positive redefinition coping strategies compared with patients who were married or in a relationship. Thus, lonely patients showed lower levels of constructive coping (p < 0.001). Lonely patients had significant difficulty accepting their illness (p = 0.017) and demonstrated higher levels of depression (p = 0.034). A detailed analysis is presented in Table 3.
In our univariate analysis, the factors most strongly associated with being lonely were as follows: being unemployed, being age 61 or over and having a score of less than 41 for the use of constructive cancer coping strategies (Mini-MAC). Loneliness is considered an independent variable, and the dependent variable is defined as "Functioning in lung cancer". As the factors analysed may have been correlated with one another, we performed multivariate analysis, the results of which are given in Table 4, which showed that the following were independent parameters associated with loneliness: being unemployed, having a cancer stage lower than T4 and having a score on the AIS of less than 21.
Discussion
Loneliness (being lonely) is a common experience of distressing social isolation and of one's social needs not being met. It significantly affects daily functioning and has a negative impact on mental and physical health, which reduces patient satisfaction and decreases the Qol [25,36]. Simultaneously, depression is a strong predisposing factor for loneliness [36]. Factors influencing the occurrence of loneliness in our study included the age of 61 years and older, while the Deckx et al. meta-analysis showed no such relationship with age. However, it should be taken into account that in many studies evaluating loneliness in cancer patients, the mean age did not exceed 60 years [4]. The sense of loneliness is particularly acute among cancer patients. Studies have shown that loneliness in cancer patients is associated with both cancer-related factors, such as the stress associated with the diagnosis [37][38][39], the time since diagnosis, the type of cancer and the type and intensity of treatment, and non-cancer-related factors, such as the lack of psychological and social support and being unmarried (patients who have never been married, are widowed or divorced) [4]. Friedman et al. found that approximately 50% of the cancer patients studied felt lonely in situations relating to their illness [40]. Studies have also found that there is a relationship between social constraints and symptoms in cancer patients [41,42]. Lack of support, criticism and minimisation of symptoms may increase the severity of symptoms related to cancer or its treatment, such as fatigue, pain and sleep problems [43]. As a result, patients may use avoidance coping or even choose not to discuss their symptoms with anyone, including a doctor [44].
Loneliness is common among lung cancer patients. The illness carries a significant amount of stigma. Patients with lung cancer are often assumed to be smokers, even though the condition can also be diagnosed in non-smokers. Tobacco smoking is perceived as a poor life choice and those who make it are deemed to be responsible for their diagnosis [45,46]. This causes lung cancer patients to feel guilty. They feel angry, hurt and discriminated against. Moreover, they experience significantly higher levels of mental stress compared with patients with other types of cancer, which leads to social isolation [9,[45][46][47][48][49]. As a result, patients with lung cancer are afraid of seeking help and support. Moreover, they may be afraid of consulting a doctor about their symptoms, which might delay diagnosis [44]. This may have very negative consequences, as rapid tumour growth and a lack of diagnosis significantly worsen the prognosis.
In addition, intensive therapy and exhausting symptoms caused by cancer or the side effects of its treatment make patients even less willing to take part in social interactions, which increases their loneliness. This cause-and-effect chain leads to lower illness acceptance and reduced willingness to maintain proper nutrition and engage in an appropriate amount of physical activity, which may entail malnutrition and depression. The coexistence of a mental disorder, malnutrition and loneliness has a negative impact on the prognosis of cancer patients and shortens their life expectancy. Studies have shown that loneliness is a significant factor predisposing to eating disorders, such as anorexia nervosa and is a significant predictor of malnutrition risk and malnutrition itself [50].
Cancer-related loneliness is associated with the high social expectations of patients. After a cancer diagnosis, patients may have idealised expectations of emotional support and their loved ones may not be able to meet them. When these expectations are not met, patients become distant from their family and friends and their loneliness increases. Cancer patients feel that they have to cope with their difficult diagnosis on their own. Loneliness has a detrimental impact on physical and psychological QoL [44][45][46][47][48][49][50][51]. This leads to a significant increase in the severity of depressive and anxiety symptoms. The results presented in this study show that lonely patients are more likely to have depression. In the available literature, loneliness is also considered a risk factor for depression [8,18,19]. However, it should be remembered that loneliness and depression interact with each other and have a synergistic effect on the deterioration of a patient's well-being [18]. Polański et al. documented that mental disorders such as anxiety and depression may lead to worsening the functioning of the patient [5].
A number of factors have been found to be associated with loneliness. These include, among others, employment status, age, level of education and the type of coping strategy adopted. Economic inactivity and older age are strongly associated with increased levels of loneliness. The financial difficulties faced by those who do not have a job are also risk factors for malnutrition [50,52,53]. This study notes a higher risk of malnutrition as well as malnutrition in people suffering from loneliness. Similarly, in other studies, loneliness was considered a significant risk factor for malnutrition [49]. Lonely people are more likely to eat fewer meals, and they have difficulties in ensuring the right number of vegetables, fruits and proteins in their diet. Help from relatives in preparing meals and caring for a sick person gives better chances for a balanced diet and reduces the risk of malnutrition. It can also have an emotional impact, as the presence of a partner can encourage the patient to eat or even improve his appetite. Additionally, in a paper published by Chabowski et al., it is noted that patients at risk of malnutrition are more likely to suffer from severe depression and anxiety than patients whose nutritional status is normal [54]. Patients with a lower level of education may have difficulty finding information about nutrition after a cancer diagnosis and about coping with and understanding their illness.
Loneliness has a multidimensional impact on the patient because it is more difficult for lonely people to obtain information about nutrition, so they do not know how to take care of their diet. It also affects the patient emotionally and increases levels of anxiety and depression, so the patient has no appetite or motivation to properly take care of his nutritional status.
Driven by this lack of understanding and the feeling of guilt, patients often do not accept their illness. They feel angry and are thus more reluctant to follow their doctor's advice on physical activity, a balanced diet and psychological support.
The constructive cancer coping model has a positive impact on illness acceptance and increases life satisfaction in patients [54]. In our study, lonely patients are less likely to choose constructive coping strategies such as positive redefinition and fighting spirit. Moreover, our analysis showed that a score of less than 41 for the use of constructive cancer coping strategies (Mini-MAC) is most strongly associated with being lonely. A positive coping strategy reduces the risk of social contact avoidance and thus lowers the risk of loneliness. As a result, patients are more willing to seek support from their family and friends as well as from a psychologist or a psychiatrist [55].
According to the authors, it is extremely important to teach the patient how to cope with cancer and always take into account that loneliness could limit the choice of a positive strategy. Knowing that constructive strategies have a positive impact on the quality of life and life satisfaction, health providers should strive to achieve them. It will allow them to achieve the greatest possible benefits for the patient and even avoid the effects of destructive strategies and loneliness that may intensify the negative coping strategies. The QoL of these patients can be improved through the provision of an appropriate level of support, balanced diet programmes aimed at preventing malnutrition, cancer adjustment and acceptance programmes, as well as through the prevention and treatment of anxiety and depression.
Achieving a better understanding of lung cancer and lung cancer stigma, including the impact of patient stigmatisation on loneliness, QoL and functioning, is important for healthcare professionals. It may enable the development of appropriate educational programmes and awareness-raising campaigns, which could be effective in improving the QoL of patients with lung cancer [45].
Authors suggest that there is a need to introduce screening for loneliness in cancer patients, along with tailored strategies for coping strategies and proper emotional support [36]. Clinicians should ensure support from patient's family and their loved ones and take care to stop stigmatizing lung cancer patients. All the factors presented in this study affect the occurrence of loneliness, which affects the deterioration of the QoL, functioning in the five assessed dimensions (physical, psychological, cognitive, social and life roles), and even the level of nutrition. Therefore, we believe that the presented subject is an important issue to be used in everyday medical practice. Appropriate care for loneliness will ensure a fully holistic approach to cancer patients.
Conclusions
Loneliness is a significant factor affecting the functioning of patients with lung cancer. It increases the risk of anxiety and depression, reduces levels of illness acceptance, reduces levels of constructive coping and increases the risk of malnutrition.
Loneliness is an important clinical issue and should be taken into consideration when assessing the QoL and prognosis for the patient.
|
v2
|
2022-12-02T04:09:37.379Z
|
2022-11-27T00:00:00.000Z
|
254137330
|
s2orc/train
|
Eriodictyol Suppresses Gastric Cancer Cells via Inhibition of PI3K/AKT Pathway
Gastric cancer (GC) is among the five most common malignancies worldwide. Traditional chemotherapy cannot efficiently treat the disease and faces the problems of side effects and chemoresistance. Polygoni orientalis Fructus (POF), with flavonoids as the main bioactive compounds, exerts anti-cancer potential. In this study, we compared the anti-GC effects of the main flavonoids from POF and investigated the anti-cancer effects of eriodictyol towards GC both in vitro and in vivo. CCK-8 assays were performed to examine the inhibitory effects of common flavonoids from POF on GC cell viability. Colony formation assays were used to determine cell proliferation after eriodictyol treatment. Cell cycle distribution was analyzed using flow cytometry. Induction of apoptosis was assessed with Annexin V/PI staining and measurement of related proteins. Anti-cancer effects in vivo were investigated using a xenograft mouse model. Potential targets of eriodictyol were clarified by network pharmacological analysis, evaluated by molecular docking, and validated with Western blotting. We found that eriodictyol exhibited the most effective inhibitory effect on cell viability of GC cells among the common flavonoids from POF including quercetin, taxifolin, and kaempferol. Eriodictyol suppressed colony formation of GC cells and induced cell apoptosis. The inhibitory effects of eriodictyol on tumor growth were also validated using a xenograft mouse model. Moreover, no obvious toxicity was identified with eriodictyol treatment. Network pharmacology analysis revealed that PI3K/AKT signaling ranked first among the anti-GC targets. The molecular docking model of eriodictyol and PI3K was constructed, and the binding energy was evaluated. Furthermore, efficient inhibition of phosphorylation and activation of PI3K/AKT by eriodictyol was validated in GC cells. Taken together, our results identify eriodictyol as the most effective anti-GC flavonoids from POF and the potential targets of eriodictyol in GC. These findings suggest that eriodictyol has the potential to be a natural source of anti-GC agents.
Introduction
Gastric cancer (GC) ranks as the sixth most common cancer in incidence and the third in mortality among all the malignancies worldwide [1]. As most patients are diagnosed at advanced stages, surgical resection alone of primary tumor and regional lymph nodes usually cannot prevent progress of GC successfully [2]. To overcome the limitations of surgery, chemotherapy is usually applied perioperatively and after surgery. In addition, multiple targeted chemotherapies have been developed and are often used in combination with traditional chemotherapy [3][4][5]. Platinum-based chemotherapy is still used as first-line chemotherapy for patients, especially those with advanced GC. Although it is reported that almost 60% of GC patients respond to available chemotherapy, most patients experience severe side effects and develop chemoresistance eventually [5,6]. Therefore, it is urgent to develop new efficient drugs to treat GC patients.
An increasing amount of evidence has shown that traditional Chinese medicine is a promising source for identifying new agents in cancer prevention and treatment. Polygoni orientalis Fructus (POF), the dried ripe fruit of Polygonum orientale L., is a wellknown medicinal plant and possesses hepatoprotective and anti-cancer activities [7,8]. In POF, the main bioactive compounds are flavonoids, which include quercetin, taxifolin, kaempferol, and eriodictyol. Among these natural flavonoids, the anti-cancer capabilities of quercetin, taxifolin, and kaempferol have been extensively investigated. The chemo-preventive effect of eriodictyol was also identified. In a chemical carcinogen 1,2dimethylhydrazine-induced animal model of colon cancer, through the antioxidant defense mechanism, eriodictyol decreased lipid peroxidation levels and inhibited preneoplastic lesions [9]. This indicates that eriodictyol can be applied in cancer treatment.
In the present study, we compared the inhibitory effects of eriodictyol on cell viability with the three other flavonoids from POF, namely quercetin, taxifolin, and kaempferol. The data demonstrated that eriodictyol inhibited cell viability most effectively among these common flavonoids. Then, anti-GC effects of eriodictyol were further examined both in vitro and in vivo. Safety of eriodictyol treatment in the xenograft mouse model was also evaluated. Finally, the potential targets of eriodictyol to inhibit GC cells were revealed using network pharmacological analysis, evaluated by molecular docking, and validated experimentally. Our results identified the inhibitory role of eriodictyol in GC and the underlying mechanism, supporting eriodictyol as a potential natural compound for chemotherapy in GC.
Eriodictyol Suppresses Cell Viability of GC Cells
The main flavonoids isolated from POF include quercetin, taxifolin, kaempferol, and eriodictyol. The first three of them have been identified as being able to suppress GC efficiently [10][11][12]. Therefore, in this study, we first compared cell inhibition capability of eriodictyol in GC cells with that of quercetin, taxifolin, and kaempferol. CCK-8 assays were performed and the results showed that eriodictyol exhibited the most efficient inhibitory effects among these examined common flavonoids from POF in AGS and HGC-27 cells at different concentrations and different time points ( Figure 1A). Then, inhibition of cell viability by eriodictyol in MKN-45 cells was confirmed ( Figure 1B). In addition, the cytotoxic effect of eriodictyol on human gastric epithelial GES-1 cells was much weaker than that on GC cells ( Figure 1C). This indicated that eriodictyol displayed cytotoxicity selectively against GC cells. Moreover, IC 50 of eriodictyol for the above cells at 24, 48, and 72 h was calculated according to the results of CCK-8 assays (Table 1). In the following experiments, the concentration (150 µM) approximately equivalent to IC 50 at 48 h and two lower concentrations (100 and 50 µM) were applied to AGS and HGC-27 cells. Because IC 50 of eriodictyol for MKN-45 cells is higher than that of the other two GC cells, different concentrations (100, 200, and 300 µM) of eriodictyol were used. Our results demonstrated that eriodictyol could inhibit cell viability efficiently, and the inhibition of GC cells induced by eriodictyol was dose-and time-dependent.
Eriodictyol Inhibits Cell Proliferation of GC Cells
To further examine the inhibitory effects of eriodictyol on proliferation of GC cells, colony formation assays were performed. Eriodictyol treatment significantly reduced the foci numbers as well as sizes in GC cells (Figure 2A,B). The inhibitory effects of eriodictyol on colony formation are dose-dependent in line with those on cell viability. Then, cell cycle analysis was performed, and an obvious increase in cell fractions in the sub-G1 phase was observed, indicating induction of apoptosis ( Figure 2C,D). Moreover, there is a gradual decrease in cell population in the G2/M phase with the increase in eriodictyol concentration ( Figure 2C,D). Our results suggest the anti-proliferation effects of eriodictyol on GC cells.
Eriodictyol Inhibits Cell Proliferation of GC Cells
To further examine the inhibitory effects of eriodictyol on proliferation of GC cells, colony formation assays were performed. Eriodictyol treatment significantly reduced the foci numbers as well as sizes in GC cells (Figure 2A,B). The inhibitory effects of eriodictyol on colony formation are dose-dependent in line with those on cell viability. Then, cell cycle analysis was performed, and an obvious increase in cell fractions in the sub-G1 phase was observed, indicating induction of apoptosis ( Figure 2C,D). Moreover, there is a gradual decrease in cell population in the G2/M phase with the increase in eriodictyol concentration ( Figure 2C,D). Our results suggest the anti-proliferation effects of eriodictyol on GC cells.
Eriodictyol Induces Cell Apoptosis in GC Cells
Further experiments were performed to confirm the effects of eriodictyol on induction of cell apoptosis. Results of flow cytometry indicated that percentages of Annexin Vpositive cells increased gradually when cells were treated with increasing concentrations of eriodictyol ( Figure 3A,B). This suggests that proportions of cells in both the early and the late apoptotic stages increase when treated with eriodictyol. Then, induction of apoptosis in GC cells was investigated with Western blot examination of apoptotic executive proteins. A substantial accumulation of cleaved PARP-1 and Caspase-3 was observed in GC cells due to eriodictyol treatment ( Figure 3C,D). These data demonstrate that eriodictyol induces cell apoptosis in GC cells. The quantitative analysis of cell cycle distribution is demonstrated as a histogram. Three independent experiments were performed, and data are presented as mean ± SD. * p < 0.05, ** p < 0.01, *** p < 0.001, **** p < 0.0001.
Eriodictyol Induces Cell Apoptosis in GC Cells
Further experiments were performed to confirm the effects of eriodictyol on induction of cell apoptosis. Results of flow cytometry indicated that percentages of Annexin Vpositive cells increased gradually when cells were treated with increasing concentrations Three independent experiments were performed, and data are presented as mean ± SD. * p < 0.05, ** p < 0.01, *** p < 0.001, **** p < 0.0001. of eriodictyol ( Figure 3A,B). This suggests that proportions of cells in both the early and the late apoptotic stages increase when treated with eriodictyol. Then, induction of apoptosis in GC cells was investigated with Western blot examination of apoptotic executive proteins. A substantial accumulation of cleaved PARP-1 and Caspase-3 was observed in GC cells due to eriodictyol treatment ( Figure 3C,D). These data demonstrate that eriodictyol induces cell apoptosis in GC cells. Three independent experiments were performed, and data are presented as mean ± SD. ns: no significance, * p < 0.05, ** p < 0.01, *** p < 0.001, **** p < 0.0001.
Eriodictyol Inhibits Tumor Growth In Vivo
To determine the anti-cancer efficacy of eriodictyol in vivo, nude mice were used, and MKN-45 cells were inoculated subcutaneously to establish xenograft tumor models. Cisplatin, as the first-line chemotherapeutic agent, was used as the positive control. All of the nude mice survived to the end of xenograft experiments. Eriodictyol treatment significantly suppressed tumor growth as illustrated by smaller tumor volumes and weights ( Figure 4A,B,D). Eriodictyol efficiently inhibited xenografts growth at both concentrations. In our tests, eriodictyol at higher concentration exhibited similar inhibitory efficiency to cisplatin. In addition, eriodictyol treatment significantly decreased Ki-67-positive cells as visualized by IHC staining, indicating that eriodictyol inhibits proliferation of GC cells in vivo ( Figure 4D,E). Then, safety of eriodictyol treatment was evaluated. No obvious differences in body weights of nude mice were observed when treated with eriodictyol at both concentrations, while a substantial decrease in body weights was identified in cisplatin-treated mice ( Figure 4C). H&E staining indicated that eriodictyol did not cause visible damage to major organs including hearts, livers, and kidneys ( Figure 4F). Moreover, eriodictyol treatment did not make detectable changes in serum levels of AST and ALT, two major enzymes reflexing the liver function ( Figure 4G). Although no obvious changes were found in gross specimens from cisplatin-treated mice, hepatocyte edema was revealed in two of six mice ( Figure 4F). An increase in serum levels of AST and ALT was also identified in mice treated with cisplatin ( Figure 4G). Taken together, these results demonstrated that eriodictyol exerts potent anti-cancer capability in GC and is safe at the treatment dosage in vivo.
Network Pharmacology Prediction of the Possible Pathways Regulated by Eriodictyol
To explore the mechanism underlying inhibitory effects of eriodictyol on GC cells, we used network pharmacology to analyze the potential targets of eriodictyol in GC. A total of 200 drug-associated targets and 11,261 disease-related targets were identified with 131 overlapping potential targets obtained ( Figure 5A). Then, the overlapping targets were imported into the STRING database, and with the minimum required interaction score set as 0.7, 100 enriched targets were obtained and used to construct a PPI network. In this network, the first three core targets were HSP90AA1, AKT1, and SRC ( Figure 5B). Both PIK3CG and AKT1, the key components in the PI3K/AKT pathway, are included in the main nodes of the network ( Figure 5C).
Then, the overlapping targets from the drug of eriodictyol and the disease of GC were used to perform GO and KEGG analysis. The first 10 significantly enriched terms of the biological process, cellular component, and molecular function are shown in Figure 5D. The kinase activity is the main molecular function item that is affected by eriodictyol treatment. Furthermore, the results of KEGG analysis revealed that the PI3K/AKT signaling pathway ranked first among the 20 top terms ( Figure 5E). These data indicate that eriodictyol inhibits GC cell mainly by intervening in the PI3K/AKT pathway. . Data are presented as mean ± SD. ns: no significance, ** p < 0.01, **** p < 0.0001.
Molecular Docking Assessment
Then, molecular docking was performed to confirm the binding modes of eriodictyol with PIK3CG (PDB ID: 1E8X). The results revealed that eriodictyol was docked in a similar
Molecular Docking Assessment
Then, molecular docking was performed to confirm the binding modes of eriodictyol with PIK3CG (PDB ID: 1E8X). The results revealed that eriodictyol was docked in a similar position to ATP. As shown in Figure 6A,B, eriodictyol formed five hydrogen bonds with CYS-275, GLU-302, HIS-304, and GLU-826 in PIK3CG. In addition, the binding energy was calculated to evaluate the degree of complementarity between the component (eriodictyol or ATP) and the PIK3CG protein. The binding energies between eriodictyol and PIK3CG and between ATP and PIK3CG were −5.98 and −3.17 kJ/mol, respectively ( Figure 6C). As the binding energy between eriodictyol and PIK3CG was lower than that between ATP and PIK3CG, our results indicate a more stable conformation between eriodictyol and PIK3CG. These suggest that eriodictyol could compete with ATP, bind to the active sites of PIK3CG, and thus inhibit the activity of PI3K kinase. Figure 6A,B, eriodictyol formed five hydrogen bonds w CYS-275, GLU-302, HIS-304, and GLU-826 in PIK3CG. In addition, the binding ener was calculated to evaluate the degree of complementarity between the component ( odictyol or ATP) and the PIK3CG protein. The binding energies between eriodictyol a PIK3CG and between ATP and PIK3CG were −5.98 and −3.17 kJ/mol, respectively ( Fig 6C). As the binding energy between eriodictyol and PIK3CG was lower than that betwe ATP and PIK3CG, our results indicate a more stable conformation between eriodict and PIK3CG. These suggest that eriodictyol could compete with ATP, bind to the act sites of PIK3CG, and thus inhibit the activity of PI3K kinase.
Eriodictyol Inhibits GC Cells through PI3K/AKT Pathway
PI3K plays a critical role in transmitting oncogenic signals by regulating AKT in G Therefore, with bioinformatics prediction of PI3K as the main target of eriodictyol in G effects of eriodictyol on the PI3K/AKT pathway were evaluated with Western blotting. shown in Figure 7, in GC cells, the phosphorylation (p85 Tyr458/p55 Tyr199) of PI3K w obviously decreased by eriodictyol treatment in a dose-dependent manner. Meanwh treatment with eriodictyol also evidently reduced phosphorylation (Ser473) of AKT. O results suggest that eriodictyol treatment inhibited phosphorylation of PI3K and AK
Eriodictyol Inhibits GC Cells through PI3K/AKT Pathway
PI3K plays a critical role in transmitting oncogenic signals by regulating AKT in GC. Therefore, with bioinformatics prediction of PI3K as the main target of eriodictyol in GC, effects of eriodictyol on the PI3K/AKT pathway were evaluated with Western blotting. As shown in Figure 7, in GC cells, the phosphorylation (p85 Tyr458/p55 Tyr199) of PI3K was obviously decreased by eriodictyol treatment in a dose-dependent manner. Meanwhile, treatment with eriodictyol also evidently reduced phosphorylation (Ser473) of AKT. Our results suggest that eriodictyol treatment inhibited phosphorylation of PI3K and AKT, leading to inactivation of the PI3K/AKT pathway in GC. The relative protein levels of phosphorylated PI3K and phosphorylated AKT were quantified and are demonstrated as a histogram. Three independent experiments were performed, and data are presented as mean ± SD. ns: no significance, * p < 0.05, ** p < 0.01, *** p < 0.001, **** p < 0.0001.
Discussion
GC is the third leading cause of cancer-related deaths worldwide [1]. Late diagnosis and limited chemotherapy options account for the high mortality of GC [3,13]. Although the efficacy of chemotherapy in GC patients is improving, chemoresistance and severe side effects are noted in clinical practice [13,14]. As the 5-year survival rate is less than 10% in advanced GC patients, it is critical to find new anti-cancer drugs for GC patients. In recent years, an increasing amount of evidence suggests that traditional Chinese medicine exhibits efficient anti-cancer capability and is widely used to treat malignancies including GC [15,16]. POF is a traditional herb and has a long history in treating various diseases [17,18]. Previous research work has identified flavonoids as the main and bioactive components of POF. Studies applying combined liquid chromatography and mass spectrometry technology revealed that flavonoids from POF consist of quercetin, taxifolin, kaempferol, and eriodictyol [8,[17][18][19].
Discussion
GC is the third leading cause of cancer-related deaths worldwide [1]. Late diagnosis and limited chemotherapy options account for the high mortality of GC [3,13]. Although the efficacy of chemotherapy in GC patients is improving, chemoresistance and severe side effects are noted in clinical practice [13,14]. As the 5-year survival rate is less than 10% in advanced GC patients, it is critical to find new anti-cancer drugs for GC patients. In recent years, an increasing amount of evidence suggests that traditional Chinese medicine exhibits efficient anti-cancer capability and is widely used to treat malignancies including GC [15,16]. POF is a traditional herb and has a long history in treating various diseases [17,18]. Previous research work has identified flavonoids as the main and bioactive components of POF. Studies applying combined liquid chromatography and mass spectrometry technol-ogy revealed that flavonoids from POF consist of quercetin, taxifolin, kaempferol, and eriodictyol [8,[17][18][19].
Quercetin, taxifolin, and kaempferol are all well-studied flavonoids with established anti-cancer abilities in various malignancies including GC [10][11][12]. To compare the inhibitory effects of eriodictyol with the above three flavonoid compounds, we performed CCK-8 assays. The results showed that among these flavonoids, eriodictyol exhibited the best suppressive ability on cell viability in the different GC cancer cells we examined. However, this is not the case in other malignancies. When eriodictyol was applied in melanoma, contrary results from no, moderate, to strong inhibitory effects were presented by different studies [20][21][22]. The inhibitory effects of eriodictyol are comparable to those of quercetin [23]. In lung cancer and leukemia, IC50 of eriodictyol is comparable to that of quercetin and much lower than that of kaempferol [24]. These studies including our data indicate that flavonoid compounds differ in their suppressive capacities in different cancers. Eriodictyol inhibits GC most efficiently among the flavonoids from POF we explored in this study.
As antioxidants have attracted attention as potential anti-cancer agents, the anti-cancer effects of eriodictyol were evaluated [28]. Eriodictyol was found to decrease chemical carcinogen-induced precancerous lesion in colon and suppress the malignant progression of colorectal cancer cells [9,29]. In mice epithelial cells JB6Cl41, eriodictyol treatment suppresses EGF-induced anchorage-independent colony formation in soft agar, which indicates the inhibitory role of eriodictyol in malignant transformation [30]. Then, the anti-cancer capabilities of eriodictyol were revealed in glioma, lung cancer, and nasopharyngeal cancer [31][32][33]. Nevertheless, the role of eriodictyol in GC has not been explored. In this study, we demonstrated that eriodictyol significantly inhibited cell viability of GC cells, and the inhibitory effect was time-and dose-dependent. Our results indicate that eriodictyol may exert anti-cancer effects on GC. Moreover, we performed further experiments and validated that eriodictyol can inhibit growth of GC cells both in vitro and in vivo.
Besides chemoresistance, another challenge for clinical application of traditional chemotherapy is side effects, especially toxicity to the kidney, liver, and heart [34,35]. Therefore, when seeking new therapeutic agents, it is important to assess the safety of the new drug. The cytotoxic effect of eriodictyol is selective to GC cells and not gastric epithelial cells, which is a promising finding. Moreover, eriodictyol exhibited obvious anti-cancer efficacy in a xenograft mouse model without significant impact on the body weight or obvious toxicity to the critical organs of the treated mice. Consistent with our results, when treating glioma in xenografted mice, eriodictyol was shown to inhibit tumor growth but did not reduce the body weights of model mice [31]. However, the major organs were not examined histologically in that study. To our knowledge, this is the first evaluation of the safety of eriodictyol application in treating malignancy with histological examination and using blood biochemical indexes. For the dosage of eriodictyol, He et al. used 100mg/kg eriodictyol in the mouse model for 45 days, with the total amount being more than that used in our study [25]. The usage of eriodictyol exerted protective effects in lipopolysaccharide-triggered neuroinflammation without obvious influence of food intake and body weights of the treated mice. Furthermore, although MKN-45 [36], the cell line with a higher IC50, was chosen for the xenograft model, the dosage we used in mice is efficient and most importantly, safe. Therefore, our results suggest the promising application of eriodictyol in clinical practice.
The concept of "network pharmacology" was first proposed in 2007 and developed rapidly with advances in bioinformatics and system biology [37,38]. Network pharmacology has become a branch of pharmacology which is often used to reveal the relationship among drugs, diseases, and targets. Network pharmacology is quite different from the conventional "one disease-one target-one drug" pharmacological research strategies and is widely used in identification of natural bioactive compounds. In this study, we deter-mined the targets of eriodictyol and GC and using the overlapping targets obtained a core PPI network. Both PIK3CG and AKT1 are included in the network, and the PI3K/AKT signaling pathway ranks the first in the following KEGG analysis. According to the results of network pharmacology, PI3K is identified as the promising target of eriodictyol related to GC.
Flavonoids are known to compete for the ATP-binding sites of protein kinases and phospholipid kinases and inhibit kinase activities [39][40][41]. Through competing with ATP, quercetin and several other flavonoids work as efficient inhibitors of inositol polyphosphate kinase [40]. Kaempferol was shown to inhibit p21 activating kinase 4 in breast cancer [39]. With a similar structure to kaempferol, eriodictyol was revealed as the inhibitor of ribosomal S6 kinase 2 and suppressed neoplastic transformation in mice epithelial cells [30]. In macrophages, through interacting with the ATP-binding sites of Jun-N terminal kinase, eriodictyol inhibited kinase activity and exerted anti-inflammation potential [42]. After predicting PI3K as the most promising target of eriodictyol, we performed molecular docking to propose a binding model. The docking result indicated that eriodictyol interacted with the ATP-binding site of PI3KCG and possessed lower binding energy and more stable conformation when compared with ATP.
Aberrant activation of the PI3K/AKT pathway has been reported in a variety of malignancies including GC [43]. Once activated by receptor tyrosine kinases, PI3K binds to plasma membrane and transforms phosphatidylinositol-4,5-bisphosphate (PIP2) into phosphatidylinositol-3,4,5-trisphosphate (PIP3). As the secondary messenger, PIP3 interacts with and phosphorylates AKT1, resulting in activation of growth and cell survival. Due to the crucial role of PI3K/AKT signaling in cancer, several inhibitors targeting this pathway have been developed or are under development [44,45]. In this study, after network pharmacology and molecular docking analysis, we performed in vitro validation experiments and confirmed that eriodictyol can efficiently inhibit phosphorylation and activation of PI3K/AKT signaling. Our study not only reveals the anti-cancer potential of eriodictyol but also identifies the main targets of eriodictyol in GC.
CCK-8 Assays
Cells were seeded in 96-well plates at a density of 5000 cells/well the day before assays.
Colony Formation Assays
GC cells were plated in six-well plates at a density of 500 cells/well. After 16 h, cells were treated with a series of concentrations (0, 50, 100, 150 µM for AGS and HGC-27 cells; 0, 100, 200, 300 µM for MKN-45 cells) of eriodictyol and then incubated at 37 • C for 10-14 days. Then, the cell colonies were washed with PBS, fixed with methanol, and subsequently stained with crystal violet. Finally, the cell colonies were photographed, and those with more than 50 cells were counted. The experiments were performed in triplicate.
Cell Apoptosis Assays
Cell apoptosis was measured according to the manual of FITC Annexin V Apoptosis Detection Kit I (BD Biosciences, San Jose, CA, USA). Briefly, the GC cells were plated in six-well plates at a density of 4×10 5 cells/well and cultured overnight. After treatment with different concentrations of eriodictyol for 48 h, the cells were collected, washed with cold PBS, and incubated with 5 µL of FITC Annexin V and 5 µL of propidium iodide (PI) for 15min at room temperature in the dark. Then, the samples were examined using a CytoFLEX flow cytometer (Beckman Coulter, Atlanta, GA, USA). The experiments were repeated three times.
Cell Cycle Analysis
GC cells were plated in six-well plates at a density of 4 × 10 5 cells/well. After treatment with eriodictyol for 48 h, cells were collected, washed with cold PBS, and fixed with 70% ethanol at 4 • C overnight. Then, the cells were treated with PI (Beyotime, Shanghai, China) and analyzed using a CytoFLEX flow cytometer. Cell cycle analysis was performed using Flow Jo 10 software (Becton Dickinson, NJ, USA). The experiments were repeated three times.
Xenograft Tumor Model
Five-week-old male BALB/c nude mice were purchased from Beijing Vital River Laboratory Animal Technology (Beijing, China). MKN-45 cells (4 × 10 5 ) were resuspended in 200 µL PBS and injected subcutaneously into the flank region of each mouse. When the tumor volumes (V = W 2 × L/2) reached 100 mm 3 (regarded as day 0), the mice were randomly assigned to four groups (n = 6 for each group). In Group I, mice were injected intraperitoneally with 0.9% NaCl every 2 days; in group II, mice were injected intraperitoneally with cisplatin (5 mg/kg) every 5 days; in group III, mice were injected intraperitoneally with eriodictyol (100mg/kg) every 2 days; and in group IV, mice were injected intraperitoneally with eriodictyol (200 mg/kg) every 2 days [31]. Tumor volumes were measured every 2 days, and body weights of mice were measured every 5 days. After three weeks, the mice were euthanized. The tumors and major organs including hearts, livers, and kidneys were collected. The blood serum of mice was also collected to determine levels of AST and ALT using a BS-240VET Auto Chemistry Analyzer (Mindray, Shenzhen, China).
Hematoxylin and Eosin (H&E) and Immunohistochemistry (IHC) Staining
The collected organs and tumor tissues were fixed in 4% paraformaldehyde overnight. Then, after dehydration and embedding in paraffin, the tissue sections of hearts, livers, and kidneys were stained with H&E to evaluate the major organs histologically. The tumor sections were used for IHC staining. For IHC staining, the sections were incubated with anti-K-i67 antibody (1:200, Abcam, ab92742). The DAB staining and analysis of K-i67-positive cells were performed as previously described [46].
Network Pharmacological Analysis
The targets of eriodictyol were collected from the following three databases: (1) Then, drug targets and disease targets were crossed to obtain potential targets of eriodictyol for the treatment of GC. The gene symbols of potential targets were uploaded to STRING (https://string-db.org/, accessed on 21 April 2022) to construct a protein-protein interaction (PPI) network. The organism was set to "Homo sapiens", and the minimum required interaction score was set as 0.7. The resultant PPI network was imported into and visualized in Cytoscape 3.9.1 software (Cytoscape Consortium, Seattle, WA, USA). In addition, further Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) analyses were performed for the key targets obtained from the PPI network. The p-value cutoff was set as 0.01. The first 10 processes and pathways of GO, including molecular function, biological process, and cellular component, and the first 20 KEGG pathways were selected to analyze the potential target pathways of eriodictyol for the treatment of GC.
Molecular Docking
The structure of eriodictyol was derived from PubChem website and optimized with Chem3D 2014 software. The PDB file of 3D crystal structures for PIK3CG (1E8X, ligand: adenosine triphosphate, ATP) was downloaded from the Protein Data Bank (https: //www.rcsb.org/, accessed on 17 September 2022). Molecular docking was performed using Autodock software, the binding energy was evaluated, and the docking result was visualized with PyMOL and LigPlot+ tools.
Statistical Analysis
The experimental data are presented as means ± SD. The data were analyzed with GraphPad Prism 8.0.2 software (GraphPad Software, La Jolla, CA, USA) using Student's t-test or one-way ANOVA test. p < 0.05 was considered to indicate statistical significance.
Conclusions
In summary, the present study demonstrated that eriodictyol exhibits the most effective inhibitory effect on cell viability of GC cells among the common flavonoids in POF, which include quercetin, taxifolin, kaempferol, and eriodictyol. Eriodictyol suppresses proliferation of GC cells, induces cell apoptosis, and inhibits tumor growth in vivo. PI3K/AKT signaling ranks first among the anti-GC targets of eriodictyol and was inhibited efficiently by eriodictyol treatment in GC cells (Figure 8). This provides insights into clinical application of eriodictyol in GC treatment.
|
v2
|
2022-12-04T19:07:09.331Z
|
2022-11-27T00:00:00.000Z
|
254207740
|
s2orc/train
|
Induction of Apoptosis via Inactivating PI3K/AKT Pathway in Colorectal Cancer Cells Using Aged Chinese Hakka Stir-Fried Green Tea Extract
Food extract supplements, with high functional activity and low side effects, play a recognized role in the adjunctive therapy of human colorectal cancer. The present study reported a new functional beverage, which is a type of Chinese Hakka stir-fried green tea (HSGT) aged for several years. The extracts of the lyophilized powder of five HSGT samples with different aging periods were analyzed with high-performance liquid chromatography. The major components of the extract were found to include polyphenols, catechins, amino acids, catechins, gallic acid and caffeine. The tea extracts were also investigated for their therapeutic activity against human colorectal cancer cells, HT-29, an epithelial cell isolated from the primary tumor. The effect of different aging time of the tea on the anticancer potency was compared. Our results showed that, at the cellular level, all the extracts of the aged teas significantly inhibited the proliferation of HT-29 in a concentration-dependent manner. In particular, two samples prepared in 2015 (15Y, aged for 6 years) and 2019 (19Y, aged for 2 years) exhibited the highest inhibition rate for 48 h treatment (cell viability was 50% at 0.2 mg/mL). Further, all the aged tea extracts examined were able to enhance the apoptosis of HT-29 cells (apoptosis rate > 25%) and block the transition of G1/S phase (cell-cycle distribution (CSD) from <20% to >30%) population to G2/M phase (CSD from nearly 30% to nearly 10%) at 0.2 mg/mL for 24 h or 48 h. Western blotting results also showed that the tea extracts inhibited cyclin-dependent kinases 2/4 (CDK2, CDK4) and CylinB1 protein expression, as well as increased poly ADP-ribose polymerase (PRAP) expression and Bcl2-associated X (Bax)/B-cell lymphoma-2 (Bcl2) ratio. In addition, an upstream signal of one of the above proteins, phosphatidylinositol 3-kinase (PI3K)/protein kinase B (AKT) signalling, was found to be involved in the regulation, as evidenced by the inhibition of phosphorylated PI3K and AKT by the extracts of the aged tea. Therefore, our study reveals that traditional Chinese aged tea (HSGT) may inhibit colon cancer cell proliferation, cell-cycle progression and promoted apoptosis of colon cancer cells by inactivating PI3K/AKT signalling.
Introduction
Human colon cancer is a malignant tumor with extremely high morbidity and mortality worldwide. The disease thus seriously threatens human health. Although colon cancer has previously mostly occurred in developed countries, the incidence and mortality of this disease have gradually increased in developing countries, including China, probably due to the social development and lifestyle changes in recent decades [1,2]. According to the newly released data, the 5-year survival for patients with metastatic colon cancer is less than 20% and more than 50,000 patients are estimated to have died from colon cancer in 2020 [3]. Surgical resection and chemotherapy are conventional treatments for colon cancer, but postoperative recurrence and adverse drug side effects bring great pain and nightmares to patients [4]. Therefore, novel and effective therapeutic strategies with low side effects are essential to treat the disease and improve patient outcomes.
The uncontrolled growth of colon cancer cells depends on persistent activation of corresponding intracellular proliferative signals. Under the stimulation of various extracellular growth factors, receptor tyrosine kinases (RTKs) are activated to stimulate the subsequent increase in the phosphorylation and activity of phosphatidylinositol 3-kinase (PI3K). PIP3 is phosphorylated by PI3K, which binds to AKT and promotes phosphorylation at Thr308 of AKT [5,6]. Some recent studies have shown that the activation of the PI3K/AKT pathway plays a positive role in the carcinogenesis, cell survival, migration, and metabolism of colon cancer [7][8][9]. Intervention by inhibitors or RNA interference technology, or the PI3K/AKT pathway and related upstream and downstream sites, may block the pathway, inhibit cell proliferation and cycle, and promote cell apoptosis. For example, it was reported that berberine inhibited PI3K and AKT expression and induced apoptosis and cell-cycle arrest in SW480 cells [10]. Small interfering RNA and molecular inhibitors of the mismatch repair gene MutL Homolog 1 (MLH1) suppressed colon cancer sensitivity to cetuximab treatment via PI3K/AKT signalling [11]. As a downstream signal of PI3K/AKT, the progression of cell cycle is necessary for colon cancer proliferation. Several small-molecule inhibitors, such as botulin and periplocymarin, blocked cell-cycle progression in colon cancer cells by silencing PI3K/AKT signalling, accompanied by the expression of cycle-related proteins such as cyclin-dependent kinase (including CDK2, CDK4 and CDK6) and cyclins (Cyclin B1 or D1) [12][13][14]. In addition, the pharmacological inhibition of PI3K/AKT may promote colon cancer cell apoptosis by regulating apoptosis-related proteins such as PARP, Bcl2 and Bax, and show effective antitumor effects [12,15]. The effective mean to target PI3K/AKT is thus the prospect of developing colon cancer therapeutics.
Tea is a traditional functional beverage in which the active ingredients, such as catechins, tea polyphenols, caffeine, and flavonoids, are widely considered to be effective in inhibiting tumor cell proliferation and development [16]. For example, camellia ptilophylla extract significantly promoted colon cancer cell HCT116 apoptosis, which was attributed to a decrease in AKT phosphorylation [17]. However, different varieties of tea, fermentation time or time of aging (years of storage) may have great differences in the production of active ingredient contents and anti-cancer effects. Hakka stir-fried green tea (HSGT) is a traditional tea in Guangdong, China. HSGT is a type of roasted green tea based on the technique of high-temperature and long-time final roasting, and aged HSGT has demonstrated anti-sputum and anti-stasis effects [18,19]. Nonetheless, its potential role in anti-cancer treatment and the influence of different production processes have not been investigated systematically. Herein, we compared comprehensively the active components of HSGT aged for different lengths of time and studied their functions in the regulation of cell proliferation, cell cycle and apoptosis in colon cancer cells (HT-29). Our results showed for the first time that that traditional HSGT, after aging for years, markedly reduced the activity of PI3K/AKT signalling and its downstream target gene clusters from cell cycle or apoptosis.
Cells and Freeze-Dried Powder of Tea Extract
Colon cancer cell line HT-29 was purchased from the National Collection of Authenticated Cell Cultures of Chinese Academy of Sciences (Shanghai, China), and cultured in a medium containing 90% McCoy's 5A Medium (Invitrogen, CA, USA) and 10% FBS (Gibco, CA, USA). The tea samples of Hakka stir-fried green tea (HSGT), from 2003 (03Y), 2007 (07Y), 2011 (11Y), 2015 (15Y) and 2019 (19Y), respectively, were purchased from Meizhou Junbao Industrial Co., Ltd (Meizhou, Guangdong province, China). A certain weight of HSGT was ground into crude powders and then mixed with water using a solid-to-liquid ratio of 1: 20 (gram: mL) at 90 • C. The tea soup was leached for 30 min and immediately filtered, and the above procedures were repeated 3 times. Then, the tea soup was combined and concentrated to 1/10 of the original volume in a steam bath. Finally, the concentrated solution was lyophilized into lyophilized powder.
Analysis of Active Ingredients in Tea Extract
The analytical method for the tea extracts was based on our previous reported study [20]. According to GB/T 8313-2018 and GB/T 8314-2013 standards, we determined the content of tea polyphenols and free amino acids in lyophilized HSGT powders. The content of soluble sugar and flavonoids was determined by the anthrone-sulfuric acid colorimetric method and the aluminum trichloride colorimetric method. The monomer components of catechin, gallic acid and caffeine were measured by a high-performance liquid chromatograph (Agilent 1200 Series, Palo Alto, CA, USA). The chromatographic column used was a phenomenex C18 column (150 × 4.6 mm, 5 µm), and the mobile phase included phase A (containing 0.5% acetic acid, 1% acetonitrile and 2% methanol) and phase B (containing 0.5% acetic acid, 10% acetonitrile and 20% methanol). In the first 30 min of elution, phase A decreased from 72.5% to 20%, while phase B increased from 27.5% to 80%. At 30-35 min of elution time, phase A increased from 20% to 72.5%, and phase B decreased from 80% to 27.5%, and then continued to 40 min. The injection volume was 10 µL. The flow rate was 1.0 mL/min. The temperature was maintained at 28 • C. All the major compounds (Tables 1 and 2) found in the tea extracts were verified with their corresponding standards using HPLC. The qualitative analysis results are given in the Supporting Information. In addition, the quantitative analysis was performed by the external standard method according to the peak area at the wavelength of 280 nm.
Cell Viability Assay
The concentration of HT-29 cells in log phase was adjusted to 5 × 10 4 cells/mL, and then added to 96-well plates at 100 µL/well. After 24 h, the culture medium of adherent HT-29 cells was discarded, and 100 µL/well of HSGT solutions of different concentrations (lyophilized powder dissolved in McCoy's 5A Medium) were added, respectively. As a control well, McCoy's 5A Medium without FBS was added at 100 µL/well. Each group was repeated 4-6 times and cultured at 37 • C 5% CO 2 for 24 h or 48 h. At the time of detection, 10 µL/well MTT solution (Beijing MYM Biotechnology Co., Ltd., Beijing, China) was added and co-cultured for 3-4 h. Subsequently, the medium in each well was aspirated, and 150 µL/well of MDSO (Biosharp, Anhui, China) solution was added and incubated for 10 min. A TriStar LB941 multifunctional microplate reader (Berthold Technologies, Baden Württemberg, Germany) was used to measure OD value at a wavelength of 490 nm and obtained the cell viability.
Cell Cycle Assay
HT-29 cells were treated with 0.2 mg/mL HSGT extract solutions with different storage years for 24 h/48 h. Trypsinized cells were resuspended and centrifuged in 1 mL of icecold PBS. Then, 1 mL of 70% ethanol in an ice bath was added to the cell pellet, mixed by pipetting, and fixed for 12-24 h. After washing with ice PBS, cells were added to 0.5 mL propidium iodide (PI) staining solution (C1052 Cell Cycle and Apoptosis Detection Kit, Beyotime Biotechnology, Shanghai, China) for 30 min at 37 • C in the dark. The cell suspension was then filtered through a filter and placed on ice. A flow cytometer (Accuri C6 Plus, BD, Lake Franklin, NJ, USA) was used to detect the fluorescence signal at the excitation wavelength 488 nm channel. Flow cytometry data was processed using FlowJo-V10 software.
Cell Apoptosis Assay
HT-29 cells were treated with 0.2 mg/mL HSGT solution of different storage years for 24 h or 48 h, in which 5 µM cisplatin (MedChemExpress, Princeton, NJ, USA) was used as a positive control for apoptosis. A total of 1 × 10 5 digested HT-29 cells were resuspended with 195 µL Annexin V-FITC binding solution (C1062L Annexin V-FITC Apoptosis Detection Kit, Beyotime Biotechnology), and then 5 µL fluorescein isothiocyanate (FITC) and 10 µL PI staining solution were added. The cell suspension was incubated at room temperature (20-25 • C) for 10-20 min in the dark, then filtered through a filter and placed on ice. Under the excitation wavelength of a 488 nm flow cytometer (Accuri C6 Plus, BD, Lake Franklin, NJ, USA), the FITC fluorescence signal at 515 nm and the PI fluorescence signal at 560 nm were detected. FlowJo-V10 software was used to process and analyze the data.
Western Blotting Assay
RIPA lysate (Beyotime Biotechnology) was used to extract proteins from HT-29 cells treated with HSGT extract solution. The protein concentration was determined with a BCA protein detection kit (Thermo Fisher Scientific, Waltham, MA, USA), followed by purified water and 4×loading buffer (Solarbio, Beijing, China) to adjust the protein concentration. Protein samples were separated by SDS-PAGE electrophoresis and transferred to PVDF membranes (Millipore, Boston, MA, USA). Then, 5% non-fat dry milk (Bio-FROXX, Einhausen, Germany) was used to block the PVDF membrane and then incubated with primary antibodies overnight at 4 • C. Primary antibodies incubated included: p-PI3K (KPL 074-1806, SeraCare Life Sciences) at room temperature for 50 min. Blot signals on membranes were imaged by a chemiluminescent gel imaging system (Tanon 5200, Shanghai, China). Band grayscale was analyzed with Image J software.
Data Statistics and Analysis
All data were presented as mean ± standard deviation (SD), and each experimental data was repeated at least three times under the same conditions. Data analysis was performed using SPSS 20.0 and GraphPad Prism 8.0 software. One-way ANOVA analysis was performed between the treatments of multiple tea samples. Different lowercase letters in the same row/group show the significant differences at p < 0.05 level.
Identification of Active Ingredients in the Extracts of Chinese Green Tea (HSGT) Aged for Different Years
Active ingredients such as polyphenols, catechins and amino acids in tea are believed to be helpful for anti-cancer treatment. We first analyzed Chinese green tea (HSGT) aged for different years, including five batches that had been stored since 2003 (03Y), 2007 (07Y), 2011 (11Y), 2015 (15Y) and 2019 (19Y). The components of the main active ingredients obtained from the tea extract (lyophilized powders) were analysed with HPLC. As shown in Table 1, for the conventional composition of the teas, the content of polyphenols found in samples of 11Y and 15Y was significantly higher than that of other samples (p < 0.05). The amino acid and soluble sugar contents found in 03Y and 19Y were significantly higher than that of other samples (p < 0.05). For the ratio of phenol to ammonia and flavonoids, the lyophilized powder of 11Y tea showed the highest content. For the analysis of catechins, gallic acid and caffeine, there were no significant differences in the content of total catechins, ester catechins and non-ester catechins between these aged teas (Table 2). However, the content of catechin (C), catechin gallate (CG), gallocatechin (GC), gallocatechin-3-gallate (GCG), gallic acid (GA), and caffeine (CAFF) in the freeze-dried powder of the extract of teas with long aging time (03Y: 18-year-aged, 07Y: 14-year-aged) was found to be significantly increased compared with other groups (p < 0.05). Epigallocatechin (EGC) and epicatechin (EC) showed higher content in the short aging time (11Y: 10-year-aged, 15Y: 6-year-aged and 19Y: 2-year-aged) compared to 03Y or 07Y (p < 0.05). Epicatechin-3-gallate (ECG) showed the highest content in a 10-year aged tea (11Y). Moreover, there was no significant difference found for epigallocatechin-3-gallate (EGCG) among the groups. Taken together, the data obtained may reveal differentially active components in the teas aged for different years. Their therapeutic effect on colon cancer cells was investigated in detail in the following sections.
Aged Chinese Green Tea (HSGT) Inhibits the Proliferation of Colon Cancer Cells
We evaluated the effect of aged-tea extracts on the proliferation of HT-29 cancer cells. The HT-29 cells were treated with the solutions of aged-tea extracts at different concentrations for 24 and 48 h and followed by MTT assays to identify cell viability. The results showed that extracts at high concentration (1.0 mg/mL) significantly inhibited the viability of HT-29 cells at either 24 or 48 h of treatment compared to the lower concentration group (0.2 mg/mL) or the control group with buffer (p < 0.05). While treated for 24 h at each specific concentration, no significant effect on cell viability was observed for the tea aged for different years ( Figure 1A). Nonetheless, the results obtained for 48 h treatment were obviously varied. As shown in Figure 1B, the 19Y sample aged for 3 years generally showed lower cell viability than the tea samples of 03Y and 07Y at the treatment concentrations of 0.2 and 0.4 mg/mL, respectively (p < 0.05). These results also indicated that 19Y significantly inhibited the viability of HT-29 cells in a concentration-dependent manner. We also found that the IC 50 value of MTT in HT-29 cells had statistically significant correlations with the content of ECG and GA (positive correlation) and EC and EGC (negative correlation) in the tea extracts (p < 0.05) ( Figure S7). Moreover, the results may suggest that the tea samples
Aged Chinese Green Tea (HSGT) Promotes Cell Apoptosis
We further investigated whether the teas with different aging time could increase apoptosis in HT-29 cells, which could be a possible factor causing the decrease of HT-29 cell viability. Since significant differences in cell viability inhibition were observed for the teas with different years of aging at 0.2 mg/mL for 48 h treatment (p < 0.05) ( Figure 1B), we thus selected this concentration for subsequent experiments. For the HT-29 cells, after treatment with 0.2 mg/mL of different tea extracts for 24 h, it was found that the apoptosis rate of samples 03Y and 19Y was significantly increased compared with the control group (p < 0.05). It was noteworthy that sample 03Y exhibited a very comparable effect to the positive control using cisplatin (Figure 2A,B). For the 48 h treatments, compared to the control, all the aged teas examined generally enhanced the apoptosis significantly in the HT-29 cells. Among these aged teas, sample 03Y was found to have the highest apoptosispromoting effect and it was also significantly higher than the positive control (p < 0.05) ( Figure 2C,D). In addition, the cell apoptosis rate of HT-29 cells was positively correlated with the content of soluble sugar and GCG (p < 0.05) ( Figure S7). These results may confirm that a significant enhancement in HT-29 cell apoptosis was induced by the aged teas tested. In particular, sample 03Y was found to be the most potent one.
Aged Chinese Green Tea (HSGT) Promotes Cell Apoptosis
We further investigated whether the teas with different aging time could increase apoptosis in HT-29 cells, which could be a possible factor causing the decrease of HT-29 cell viability. Since significant differences in cell viability inhibition were observed for the teas with different years of aging at 0.2 mg/mL for 48 h treatment (p < 0.05) ( Figure 1B), we thus selected this concentration for subsequent experiments. For the HT-29 cells, after treatment with 0.2 mg/mL of different tea extracts for 24 h, it was found that the apoptosis rate of samples 03Y and 19Y was significantly increased compared with the control group (p < 0.05). It was noteworthy that sample 03Y exhibited a very comparable effect to the positive control using cisplatin (Figure 2A,B). For the 48 h treatments, compared to the control, all the aged teas examined generally enhanced the apoptosis significantly in the HT-29 cells. Among these aged teas, sample 03Y was found to have the highest apoptosispromoting effect and it was also significantly higher than the positive control (p < 0.05) ( Figure 2C,D). In addition, the cell apoptosis rate of HT-29 cells was positively correlated with the content of soluble sugar and GCG (p < 0.05) ( Figure S7). These results may confirm that a significant enhancement in HT-29 cell apoptosis was induced by the aged teas tested. In particular, sample 03Y was found to be the most potent one.
Aged Chinese Green Tea (HSGT) Slows Down Cell-Cycle Progression
We then examined whether the aged teas could regulate cell-cycle progression in HT-29 cells. In the assays, the tea extracts of 03Y, 07Y, 11Y, 15Y, 19Y and control were investigated with HT-29 cells at a concentration of 0.2 mg/mL for 24-and 48-h, respectively. Cell-cycle analysis was then performed with flow cytometry for comparison ( Figure 3A,C). Statistical results showed that all these aged teas were able to increase the proportion of G1 and S phases and decrease the proportion of G2/M phase in the HT-29 cell population, regardless of treatment time (p < 0.05) ( Figure 3B,D). In particular, the ratio of G1 phase and S phase for the cells treated with sample 19Y was significantly higher than that of other samples (p < 0.05) ( Figure 3D). Moreover, the cell-cycle distribution of G1/G0 phase presented statistically significant correlations with the components of EC and EGC (positive correlation, p < 0.01), GC and GA (negative correlation, p < 0.01) and ECG and total catechins (negative correlation, p < 0.05) ( Figure S7). Moreover, the cell-cycle distribution of S phase was negatively correlated with TP/FAA and C (p < 0.05) ( Figure S7). Therefore, we may conclude that the aged teas could block the transition of the G1/S phase population of HT-29 cells to the G2/M phase, thereby reducing cell viability.
Aged Chinese Green Tea (HSGT) Reduces the Expression of Cell-Cycle-Related Proteins in Colon Cancer Cells
Due to the inhibitory role of the aged teas in cell-cycle progression, we examined further several major cell-cycle regulatory proteins. The levels of CDK2, CDK4 and CylinB1 in HT-29 cells treated with 0.2 mg/mL of the extract of the aged teas for 48 h were examined and compared with the Western blot results ( Figure 4A). Quantitative analysis of protein bands revealed that the aged tea generally caused significant decreases in CDK2, CDK4 and CylinB1 protein levels (p < 0.05) ( Figure 4B-D). The results indicate that aged tea may effectively block cell-cycle progression by inhibiting the expression of CDK2, CDK4 and CylinB1 proteins.
Aged Chinese Green Tea (HSGT) Inactivates PI3K/AKT Signalling and Enhances Apoptotic Pathways
Activation of PI3K/AKT signalling is essential for cancer cell viability, including colon cancer, and also maintains downstream inhibitory signals of apoptosis. We therefore examined the levels of phosphorylated PI3K (p-PI3K), phosphorylated AKT (p-AKT), PRAP, Bax and Bcl2 in HT-29 cells treated with 0.2 mg/mL extract of HSGT for 48 h by Western blotting ( Figure 5A). Quantitative analysis of protein bands revealed that the expression of p-PI3K and p-AKT in HT-29 cells were markedly reduced after the treatment with the extracts of aged teas, demonstrating an inhibitory effect on PI3K/AKT signalling (p < 0.05) ( Figure 5B,C). For the apoptotic pathway, the tea extracts increased PRAP expression and the Bax/Bcl2 ratio in HT-29 cells (p < 0.05) ( Figure 5D,E). In particular, for the cells treated with the tea extracts of 15Y and 19Y, p-AKT expressions were significantly lower than that of other tea samples (p < 0.05) ( Figure 5C). In addition, their Bax/Bcl2 ratio was also significantly higher than others (p < 0.05) ( Figure 5E). These results demonstrate the inhibitory effect of the tea extracts on PI3K/AKT signalling and a sustained enhancement in the apoptotic pathway.
Colon Cancer Cells
Due to the inhibitory role of the aged teas in cell-cycle progression, we examined further several major cell-cycle regulatory proteins. The levels of CDK2, CDK4 and CylinB1 in HT-29 cells treated with 0.2 mg/mL of the extract of the aged teas for 48 h were examined and compared with the Western blot results ( Figure 4A). Quantitative analysis of protein bands revealed that the aged tea generally caused significant decreases in CDK2, CDK4 and CylinB1 protein levels (p < 0.05) ( Figure 4B-D). The results indicate that aged tea may effectively block cell-cycle progression by inhibiting the expression of CDK2, CDK4 and CylinB1 proteins. . (B-D). Relative quantification of CDK2, CDK4 and CylinB1 protein levels in each group was shown, with actin as a reference. One-way ANOVA analysis was performed between the treatments of multiple tea samples. The different lowercase letters (a and b) in the same group show the significant differences at p < 0.05 level.
Aged Chinese Green Tea (HSGT) Inactivates PI3K/AKT Signalling and Enhances Apoptotic Pathways
Activation of PI3K/AKT signalling is essential for cancer cell viability, including colon cancer, and also maintains downstream inhibitory signals of apoptosis. We therefore examined the levels of phosphorylated PI3K (p-PI3K), phosphorylated AKT (p-AKT), PRAP, Bax and Bcl2 in HT-29 cells treated with 0.2 mg/mL extract of HSGT for 48 h by Western blotting ( Figure 5A). Quantitative analysis of protein bands revealed that the expression of p-PI3K and p-AKT in HT-29 cells were markedly reduced after the treatment with the extracts of aged teas, demonstrating an inhibitory effect on PI3K/AKT signalling (p < 0.05) ( Figure 5B,C). For the apoptotic pathway, the tea extracts increased PRAP expression and the Bax/Bcl2 ratio in HT-29 cells (p < 0.05) ( Figure 5D,E). In particular, for the cells treated with the tea extracts of 15Y and 19Y, p-AKT expressions were significantly lower than that of other tea samples (p < 0.05) ( Figure 5C). In addition, their Bax/Bcl2 ratio was also significantly higher than others (p < 0.05) ( Figure 5E). These results demonstrate the inhibitory effect of the tea extracts on PI3K/AKT signalling and a sustained enhancement in the apoptotic pathway.
Discussion
As one of the most severe and refractory cancer types, the pathogenesis of colon cancer and its effective treatment options are constantly being explored. It is generally believed that the pathogenesis of colon cancer is related to the accumulation of gene mutations in colon epithelial cells and disturbance of the immune microenvironment [21,22]. In response to these characteristics, advanced drug treatment options, including immunotherapy (anti-PD1 or anti-CTLA4 therapy) and targeted drugs (such as bevacizumab and cetuximab), have already been used in the treatment of patients or undergone clinical trials [23,24]. However, these drugs still cannot avoid tumor recurrence and the side effects lead to a serious decline in the life quality of patients. The main purpose of the present study is to search for active and low-toxicity natural substances from traditional Chi- and Bax/Bcl2 ratio in each group was shown. One-way ANOVA analysis was performed between the treatments of multiple tea samples. The different lowercase letters (a, b, c, d) in the same group show the significant differences at p < 0.05 level.
Discussion
As one of the most severe and refractory cancer types, the pathogenesis of colon cancer and its effective treatment options are constantly being explored. It is generally believed that the pathogenesis of colon cancer is related to the accumulation of gene mutations in colon epithelial cells and disturbance of the immune microenvironment [21,22]. In response to these characteristics, advanced drug treatment options, including immunotherapy (anti-PD1 or anti-CTLA4 therapy) and targeted drugs (such as bevacizumab and cetuximab), have already been used in the treatment of patients or undergone clinical trials [23,24]. However, these drugs still cannot avoid tumor recurrence and the side effects lead to a serious decline in the life quality of patients. The main purpose of the present study is to search for active and low-toxicity natural substances from traditional Chinese herbs, such as aged Chinese green tea (HSGT), to ensure both efficacy and safety against colon cancer.
Our study identified the main components from the extracts of the HSGT aged with different years. The in vitro activity of the aged-tea extracts against the proliferation of colon cancer cells was systematically investigated and compared for the first time. In fact, previous studies have confirmed the beneficial effects of different kinds of tea extracts in colon cancer treatment [25][26][27]. In a study of Japanese men, it was reported that green tea may possibly reduce the risk of colon cancer [25]. Among the bioactive components studied in green tea, EGCG down-regulated STAT3 expression to induce apoptosis in colon cancer cells (SW480) [26]. In addition, catechins (mainly EGC and EGCG) were able to restrict the proliferation of HCT116 colon cancer cells [27]. These results were also validated in the present study, and we found that the tea samples of 15Y and 19Y showed the greatest inhibitory effect on cell viability among different aged teas. The HPLC analysis confirmed that the extracts of 15Y and 19Y contained high levels of EGC and EC. Given that there was no significant difference found in the EGCG content across different aging periods in our results, we thus reasoned that the effective anticancer activity against HT-29 could be probably mediated by the EGC and EC contents of the aged teas.
A previous study found that HSGT potentially activated the AMPK cascade signalling against liver injury in a high-fat-diet-induced obesity model [20]. However, the therapeutic potential of the aged HSGT in anticancer was not investigated. In the present study, we provided evidence that these aged teas in colon cancer therapy exhibited biological growth inhibition of HT-29 cells regardless the time of aging. However, for apoptosis and cell-cycle regulation, there was variability in the tea aged for different years. For example, with an effective treatment time of 48 h, among these aged teas, sample 03Y induced the most apoptosis and 19Y had the most severe arrest in the G1/S phase of the cell cycle. The results may indicate that the time of HSGT aging is important in improving their potency in anticancer treatment. Moreover, many Chinese teas, including Keemun black tea, Qingzhuan tea and Pu-erh tea had different active ingredients depending on the number of years they were aged [28][29][30][31][32]. The changes of active components in tea due to aging time may result in significant differences in cancer therapy or treatment for other diseases. For example, the content of statins and polyphenols in Pu-erh tea fermented for a short period of 42 days was higher than that with longer fermentation time, which is beneficial for relieving cardiovascular disease caused by hyperlipidemia [33]. Given the different apoptosis and cell-cycle regulation of the teas with different aging time in our study, the aged teas combined with cyclin inhibitors or apoptosis-promoting molecules can be utilized to develop an effective management strategy for colon cancer in different scenarios.
For the aged teas of 03Y and 19Y, both contained amino acid and soluble sugar contents that were significantly higher than the other samples tested. For the difference of the 03Y and 19Y samples, GA in the 03Y group was found to be significantly higher than that in the 19Y group, while EGC was higher in the 19Y group. We therefore hypothesized that GA in 03Y group mediated apoptosis, while EGC in 19Y group might affect cell-cycle regulation. It was reported that GA induced the apoptosis of HCT-15 colon cancer cells in a ROS-dependent manner [34]. Furthermore, the natural plant-derived GA inhibited PI3K/AKT phosphorylation and increased colon cancer cell apoptosis [35]. In terms of cell-cycle regulation, it was previously found that EGC kept Lovo colon cancer cells in the G1 phase [36] and inhibited the expression of cyclin D1 and CDK4 in tumor cells [37]. Thus, EGC is also believed to be involved in the activation of p-PI3K-and p-AKT-induced tumor growth signals [38]. Taken together, all these results may point to the fact that the active ingredients in the aged teas activate PI3K/AKT signalling to achieve the inhibition of colon cancer cell growth.
Conclusions
In summary, Chinese green teas (HSGT) aged for different years show certain effects in the inhibition of colon cancer cell growth, arrests in the G1/S phase of the cell cycle, and induce apoptosis, most likely via suppressing the PI3K/AKT signalling pathway, downregulating CDK2, CDK4 and CylinB1 proteins, and upregulating PARP protein and the ratio of Bax/Bcl-2.
|
v2
|
2022-12-07T19:34:05.437Z
|
2022-11-27T00:00:00.000Z
|
254343384
|
s2orc/train
|
The Role of Skeletal Muscle Mitochondria in Colorectal Cancer Related Cachexia: Friends or Foes?
Up to 60% of colorectal cancer (CRC) patients develop cachexia. The presence of CRC related cachexia is associated with more adverse events during systemic therapy, leading to a high mortality rate. The main manifestation in CRC related cachexia is the loss of skeletal muscle mass, resulting from an imbalance between skeletal muscle protein synthesis and protein degradation. In CRC related cachexia, systemic inflammation, oxidative stress, and proteolytic systems lead to mitochondrial dysfunction, resulting in an imbalanced skeletal muscle metabolism. Mitochondria fulfill an important function in muscle maintenance. Thus, preservation of the skeletal muscle mitochondrial homeostasis may contribute to prevent the loss of muscle mass. However, it remains elusive whether mitochondria play a benign or malignant role in the development of cancer cachexia. This review summarizes current (mostly preclinical) evidence about the role of skeletal muscle mitochondria in the development of CRC related cachexia. Future human research is necessary to determine the physiological role of skeletal muscle mitochondria in the development of human CRC related cachexia.
Introduction
Cancer is associated with high morbidity and mortality, and it is an important public health problem [1]. Colorectal cancer (CRC) is the second leading cause of cancer related death in developed countries, the second most common cancer in women, and the third most common cancer in men [2,3]. Together, CRC comprises 11% of all cancer diagnoses and 5.8% of all cancer deaths. Usually, CRC emerges from the glandular, epithelial cells of the large intestine. Driving factors behind the development of CRC are obesity, sedentary lifestyle, red meat consumption, alcohol, and tobacco use [4]. The presence of cachexia is one of the underlying factors related to the high mortality rate of CRC, and is identified as a risk factor for adverse events during systemic therapies, thereby limiting treatment outcomes [5,6]. Cancer cachexia is a multifactorial syndrome characterized by involuntary weight and skeletal muscle mass loss, with or without loss of fat mass [7]. Depending on the type of cancer, the prevalence of cachexia goes up to 80%, with gastrointestinal and pulmonary cancers having the highest rates [8]. In advanced CRC, up to 60% of the patients develop cachexia. It is often diagnosed at a late stage when it coexists with excess body weight [9]. Cancer cachexia is strongly associated with chemotherapy induced toxicity, poor prognosis, and worse clinically relevant outcomes, such as fatigue, quality of life, and physical status [10][11][12][13]. Over the last years, overall survival of cachectic CRC patients has improved due to improvements in systemic therapy treatment. However, underlying mechanisms involved in the development of cancer related cachexia remain Int. J. Mol. Sci. 2022, 23, 14833 2 of 10 largely elusive. Therefore, fundamental research is necessary for further optimization of therapy and clinical care for cancer patients [10][11][12][13].
Skeletal muscle is one of the most abundant and most plastic tissues in the human body. It is the main protein reservoir in the body, accounting for approximately 40% of total body weight. Muscle mass depends on a balance between protein synthesis and protein degradation. Of interest, skeletal muscle wasting is the main manifestation of cancer cachexia [7]. It has been suggested that this results from an imbalance between skeletal muscle protein synthesis and degradation, with a net more protein degradation [14,15]. However, it is still unclear whether an increase in catabolic (protein degradation) or a decrease in anabolic (protein synthesis) processes (mutually) dominate in the development of cancer cachexia. Furthermore, this imbalance may depend on the duration of the disease [7]. An important aspect in gaining or preserving skeletal muscle mass and in improving muscle function in cancer patients is physical exercise [16][17][18].
Interestingly, mitochondria fulfill an established role in muscle atrophy. Due to their role in energy production, apoptotic processes, production of reactive oxygen species (ROS), and oxidation of muscle contractile proteins, these organelles are important regulators of skeletal muscle mass [19][20][21]. Evidence shows that systemic inflammation, oxidative stress, and proteolytic systems contribute to mitochondrial dysfunction in cancer cachexia, which (jointly) contribute to an imbalanced metabolism of skeletal muscle proteins [19,20,22]. Preclinical and in vivo mouse models for CRC related cachexia (C26 and APC Min/+ ) demonstrate a lower mitochondrial content, reductions in mitochondrial enzymatic activities involved in oxidative phosphorylation, and altered mitochondrial morphology and dynamics [19][20][21][23][24][25][26][27].The C26 mouse model is a well-characterized and extensively used mouse model for cancer cachexia. These mice bear the colon-26 tumor, also referred to as adenocarcinoma. This results in a 10% tumor weight versus total body weight and a reduction of 20-25% in skeletal muscle weight [28]. Another mouse model for CRC is the APC min/+ model. These mice develop multiple colon adenomas and adenocarcinomas, and carry a heterologous mutation in the Apc gene, which is a tumor-suppressor gene in the Wnt signaling pathway [29]. They develop progressive cachexia between 12 and 20 weeks of age, with a decrease of 20-25% in body weight [30]. However, only a few studies investigated the role of skeletal muscle mitochondria in the development of CRC cachexia. The aim of this review is to summarize the existing literature about the role of skeletal muscle mitochondria in the development and progression of CRC related cachexia.
Underlying Mechanisms of Mitochondrial Dysfunction
In CRC related cachexia, systemic inflammation, oxidative stress and proteolytic systems contribute to the development of mitochondrial dysfunction, leading to skeletal muscle wasting [19,20,22]. Maintenance of the skeletal muscle mitochondrial homeostasis may be crucial to prevent skeletal muscle mass loss in cancer related cachexia [31].
The impact of Systemic Inflammation on Skeletal Muscle Mitochondria in CRC Cachexia
Systemic inflammation is a key driver in the development of cancer related cachexia by disrupting the balance between protein synthesis and protein degradation [32]. Proinflammatory factors that are released by cells during inflammation increase the production of ROS causing oxidative stress. This can either increase skeletal muscle protein degradation or decrease protein synthesis, and induce skeletal muscle mitochondrial dysfunction in CRC related cachexia [10,[33][34][35][36]. Furthermore, these pro-inflammatory factors target several signaling pathways playing a possible role in the development of cancer related cachexia by causing mitochondrial dysfunction leading to muscle loss [37,38]. The contribution of inflammatory pathways in the development of CRC related cachexia has been studied in pre-clinical research using the C26 colon cancer and the APC min/+ mouse model [19,21]. Pro-inflammatory mediators, such as IL-6, can activate these signaling pathways by binding specific receptors (IL-6 receptor-alfa) [39]. The most important and most investigated pathway within CRC cachexia and mitochondrial dysfunction is the Janus Kinase/signal transducers and activators of transcription 3(JAK/STAT3) pathway. Binding of IL-6 will lead to the activation of the JAK/STAT3 pathway [40,41]. Phosphorylation and activation of STAT3 will cause dimerization, nuclear translocation, DNA binding, and target gene regulation [40]. Eventually this will lead to tumor growth, dysregulation of mitochondrial respiration, biogenesis, fusion and fission, and muscle wasting [19,37,42]. Furthermore, mutations in components of the mitogen activated protein kinase/extracellular signal regulated kinase (MAPK/ERK) pathway will result in cells with malignant properties [43]. It has been shown that ERK inhibition prevents muscle wasting in C26 mice [44]. Additionally, activation of the phosphatidylinositol 3-kinase (PI3k)/Akt pathway by insulin growth factor 1 is downregulated in animal models of skeletal muscle atrophy [45][46][47]. This is caused by alterations in the PI3k/Akt effector molecules Foxo1/3, which are responsible for the expression of ubiquitin-ligases MAFbx and MuRF1. As such, the suppression of the PI3k/Akt pathway is linked to the activation of the ubiquitin-dependent proteolytic machinery, which is a hallmark of skeletal muscle wasting [46].
In cancer cachexia, the pro-inflammatory mediator IL-6 is associated with the dysregulation of skeletal muscle mitochondria [19,37,42]. In APC min/+ mice, it was shown that there is no development of cachexia when they lack IL-6, while overexpression of IL-6 promoted cancer cachexia [19], the latter being associated with increased levels of phosphorylated STAT3 in skeletal muscle tissue [37]. The IL-6-STAT3 pathway plays a pivotal role in driving skeletal muscle wasting by driving skeletal muscle mitochondrial dysfunction. Skeletal muscle oxidative capacity is reduced in both oxidative and glycolytic skeletal muscles from APC min/+ mice [19]. These effects on mitochondrial respiration in cachexia are important because oxidative phosphorylation (OXPHOS), coupling the electron transfer system to ADP (adenosine diphosphate) phosphorylation, can affect the redox status, oxidative stress levels, and thus mitochondrial dynamics and function. Eventually, this dysregulation of mitochondrial respiration could lead to protein degradation and skeletal muscle atrophy [48]. Evidence shows that there is cachexia-associated loss of muscle mitochondrial respiratory capacity in C26 mice [21,42,48,49]. Proteins involved in mitochondrial OXPHOS, including complex I (nicotinamide adenine dinucleotide hydrogen; NADH), complex II (succinate dehydrogenase; SDH), complex III (ubiquinol-cytochrome c reductase), complex IV (cytochrome c oxidase; COX), and complex V (ATP (adenosine triphosphate) synthase), are downregulated in skeletal muscle tissue from cachectic C26 mice [42,48]. These findings coincide with dysregulated nicotinamide adenine dinucleotide (NAD) + metabolism and decreased muscle protein synthesis, occurring through the STAT3 pathway [42]. Furthermore, current results described in the literature suggest that the STAT3 pathway at least partly drives skeletal muscle wasting in a CRC mouse model (HCT116) since the expression of key proteins (AKT, ERK, P38) involved in other important signaling pathways were unaltered in this model [37].
Mitochondrial Biogenesis, Fusion and Fission in CRC Cachexia
An important regulator of mitochondrial biogenesis is peroxisome proliferator-activated receptor-gamma coactivator (PGC)-1α. This transcriptional coactivator is downregulated in cachectic skeletal muscle tissue, which was associated with a reduced oxidative capacity, further leading to muscle wasting [19,37,42]. NAD + and sirtuin 1 (SIRT1), which both regulate mitochondrial oxidative metabolism, have PGC-1α as a downstream target. The levels of NAD + and SIRT1 are significantly lower in untreated cachectic C26 mice. Treatment with soluble activin receptor (sACVR) replenishes NAD + levels and normalizes SIRT1 expression similar to the predicted activities of PGC-1α [42]. Furthermore, antioxidant protection by restoring glutathione levels in skeletal muscle tissue of tumor-bearing mice is offered by sACVR treatment [50]. This possibly points out that sACVR can enhance cellular processes and mitochondrial function, indicating that PGC-1α and thus mitochondrial biogenesis is a key player in maintaining mitochondrial and skeletal muscle function [42]. Of interest, Ballaro et al., described that overexpression of PGC-1α in skeletal muscle of C26 mice was unable to prevent cancer or chemotherapy induced muscle mass loss, regardless of its ability to maintain mitochondrial oxidative capacity [27].
In order to adapt to different environmental and developmental contexts, mitochondria change their shape through fusion and fission. This is important for maintaining a physiologically healthy pool of mitochondria [51]. Mitochondrial fusion causes multiple mitochondria to fuse together, resulting in elongated mitochondria. On the other hand, mitochondrial fission will result in smaller mitochondria by splitting single mitochondria. Besides mitochondrial biogenesis, alterations in mitochondrial fusion and fission, caused by augmented STAT3 signaling also contribute to the development of CRC related cachexia [19,37,42]. Important regulators of mitochondrial fusion are Mfn1 and Mfn2. Knock out of these fusion regulators will result in muscle atrophy. Reductions in Mfn1 and Mfn2 expression are observed in APC min/+ mice [19,37] and C26 mice [31]. Furthermore, in cachectic skeletal muscle tissue, the mitochondrial protein OPA1, which is also involved in mitochondrial fusion, is downregulated [37]. The loss of fusion proteins causes mitochondrial fragmentation, making them predisposed to apoptosis [19]. Additionally, Fis1, a regulator in mitochondrial fission, is upregulated in skeletal muscle tissue from cachectic APC min/+ mice, leading to apoptosis and muscle mass loss [19]. Dynamin-related protein 1 (DRP1) is another pivotal factor of mitochondrial dynamics as inhibition of DRP1 has a negative effect on mitochondrial fission, with an appearance of elongated mitochondria. Overall, the loss of mitochondrial homeostasis caused by reduced mitochondrial biogenesis and fusion and more mitochondrial fission results in an increased ROS production. This will cause a reduction in muscle oxidative capacity and aggravated skeletal muscle atrophy in CRC related cachexia by promoting protein catabolic functions ( Figure 1) cellular processes and mitochondrial function, indicating that PGC-1α and thus mitochondrial biogenesis is a key player in maintaining mitochondrial and skeletal muscle function [42]. Of interest, Ballaro et al., described that overexpression of PGC-1α in skeletal muscle of C26 mice was unable to prevent cancer or chemotherapy induced muscle mass loss, regardless of its ability to maintain mitochondrial oxidative capacity [27]. In order to adapt to different environmental and developmental contexts, mitochondria change their shape through fusion and fission. This is important for maintaining a physiologically healthy pool of mitochondria [51]. Mitochondrial fusion causes multiple mitochondria to fuse together, resulting in elongated mitochondria. On the other hand, mitochondrial fission will result in smaller mitochondria by splitting single mitochondria. Besides mitochondrial biogenesis, alterations in mitochondrial fusion and fission, caused by augmented STAT3 signaling also contribute to the development of CRC related cachexia [19,37,42]. Important regulators of mitochondrial fusion are Mfn1 and Mfn2. Knock out of these fusion regulators will result in muscle atrophy. Reductions in Mfn1 and Mfn2 expression are observed in APC min/+ mice [19,37] and C26 mice [31]. Furthermore, in cachectic skeletal muscle tissue, the mitochondrial protein OPA1, which is also involved in mitochondrial fusion, is downregulated [37]. The loss of fusion proteins causes mitochondrial fragmentation, making them predisposed to apoptosis [19]. Additionally, Fis1, a regulator in mitochondrial fission, is upregulated in skeletal muscle tissue from cachectic APC min/+ mice, leading to apoptosis and muscle mass loss [19]. Dynamin-related protein 1 (DRP1) is another pivotal factor of mitochondrial dynamics as inhibition of DRP1 has a negative effect on mitochondrial fission, with an appearance of elongated mitochondria. Overall, the loss of mitochondrial homeostasis caused by reduced mitochondrial biogenesis and fusion and more mitochondrial fission results in an increased ROS production. This will cause a reduction in muscle oxidative capacity and aggravated skeletal muscle atrophy in CRC related cachexia by promoting protein catabolic functions (Figure 1) [19,24,52]. Furthermore, reduced expression of MEF2C, which plays an important role in skeletal muscle development, is associated with changes in muscle structural integrity and mitochondrial function. Specifically, reduced MEF2C will lead to dysregulation of oxygen transport and ATP regeneration in skeletal muscle of C26 mice. Morphological changes in the mitochondria of cachectic skeletal muscle include loss of cristae and swollen mitochondria, suggesting defective oxidative phosphorylation [26].
The role of Proteolytic Systems in Skeletal Muscle Mitochondrial Dysfunction in CRC Cachexia
In skeletal muscle tissue, four main proteolytic systems orchestrate protein degradation (proteolysis) and mitochondrial dysfunction: 1) the macroautophagy system, (2) the ubiquitin-proteasome-dependent pathway (UPS), (3) the calpain system, and (4) the caspase pathway [53][54][55]. The macroautophagy system has an important function in the onset of skeletal muscle depletion in cancer cachexia by targeting skeletal muscle mitochondria. It is known that excessive autophagy has a negative effect on skeletal muscle function and impairs muscle mass. In C26 mice, autophagic bodies are observed within skeletal muscle mitochondria, suggesting mitochondrial loss by autophagy (mitophagy) and dysfunction of muscle energy homeostasis [26]. However, partial blockade of autophagy does not ameliorate tissue wasting in C26 mice, which might indicate that autophagy is only partially responsible for skeletal muscle wasting in CRC related cachexia, being accompanied by other proteolytic systems, such as calpains and the proteasome [22].
Of interest, survival of C26 mice is not negatively affected when autophagy is induced. However, muscle protein wasting is exacerbated when excessive autophagy together with increased UPS activity cause degradation of structural or functional (mitochondrial) proteins [22]. Zeng et al. showed that activation of mitochondrial calpain induces mitochondrial injury and cell damage. Coculture of myoblasts with colon carcinoma cells activates calpains in myotube mitochondria causing non-selective pore opening on the inner membrane of mitochondria (MPTP) and mitochondrial membrane potential (∆ψ m ) alterations, together resulting in mitochondrial injury. Furthermore, mitochondrial respiration becomes altered by an impaired OXPHOS complex I activity in myotube mitochondria [56]. Additionally, they showed that inhibition of calpain improves the function of OXPHOS complex I and thus mitochondrial respiration [56]. This could implicate that there is upregulated activation of the calpain system in CRC related cachexia mouse models, contributing to muscle atrophy.
Skeletal Muscle Mitochondrial Disruption Leads to Apoptosis in CRC Cachexia
The most common mechanism of myocyte apoptosis is a mitochondrial-centered control pathway. Here, changes in ∆ψ m serve as a marker for mitochondrial function. Apoptotic signals converge at mitochondrial membranes causing the loss of ∆ψ m , leading to the release of toxic proteins into the cytosol [57]. These toxic proteins form apoptosomes, which will trigger the caspase pathway, leading to the activation of the downstream pathway involved in apoptotic cellular dismantling and clearance [57]. Coculture of C2C12 myoblasts with CT26 colon carcinoma cells increases the Bax/Bcl-2 ratio, leading to activation of the caspase pathway in mitochondria, and eventually apoptosis and muscle atrophy (Figure 2) [57][58][59]. Zeng et al. showed that adding either acylated ghrelin (AG) or unacylated ghrelin (UnAG) to the cocultures prevented the loss of ∆ψ m . Ghrelin is a multifunctional circulating hormone that exists in two different forms (AG and UnAG). The receptors of ghrelin are widely expressed in skeletal muscle tissue and play important roles in immune function and muscle oxidative metabolism in both humans and animals [60,61]. Specifically, both AG and UnAG inhibited the activation of caspase-3 and thereby protects myoblasts from apoptosis by inhibiting mitochondrial dysfunction induced by CT26 colon carcinoma cells. AG and UnAG activate Akt (increased p-Akt/Akt ratio) and ameliorate the decreased levels of Bcl-2 in mitochondria. Thereby, both AG and UnAG suppress myoblast apoptosis [57]. These findings suggest that both AG and UnAG can be possibly used in the treatment of cancer cachexia. Furthermore, Miao et al. showed that exosomes secreted by the C26 mouse cells decreased the diameter of C2C12 myotubes together with a decrease in muscle strength. Results showed that inhibition of exosome secretion ameliorated muscle wasting in C26 mice. Certain miRNAs (miR-195a-5p and miR-125b-1-3p) were richer in C26 mice exosomes compared to non-cachectic derived exosomes. It was shown that these miRNAs activated the apoptotic signaling, also by downregulating Bcl-2, and thereby triggering the caspase pathway in skeletal muscle mitochondria [58]. Additionally, Zhang et al. recently showed that cachectic C26 mice derived exosomes are rich in growth differentiation factor 15, which induces muscle atrophy of cultured C2C12 myotubes by regulating the Bcl-2/caspase-3 pathway [59].
Furthermore, Miao et al. showed that exosomes secreted by the C26 mouse cells decreased the diameter of C2C12 myotubes together with a decrease in muscle strength. Results showed that inhibition of exosome secretion ameliorated muscle wasting in C26 mice. Certain miRNAs (miR-195a-5p and miR-125b-1-3p) were richer in C26 mice exosomes compared to non-cachectic derived exosomes. It was shown that these miRNAs activated the apoptotic signaling, also by downregulating Bcl-2, and thereby triggering the caspase pathway in skeletal muscle mitochondria [58]. Additionally, Zhang et al. recently showed that cachectic C26 mice derived exosomes are rich in growth differentiation factor 15, which induces muscle atrophy of cultured C2C12 myotubes by regulating the Bcl-2/caspase-3 pathway [59].
The Effect of Exercise on Skeletal Muscle Mitochondrial Function in CRC Cachexia
In healthy persons [62] and cancer patients [63,64], physical exercise is associated with better health outcomes and health related quality of life. In mice, physical exercise increases total mitochondrial protein content within skeletal muscle fibers and thereby activates AMPK, the upstream regulator of PGC-1α [65,66]. However, the effects of exercise on skeletal muscle mass loss has been limitedly investigated in C26 mice. Here, different types of exercise (resistance, endurance, low intensity, high intensity) have been studied [31,67,68].
In C26 mice performing endurance training only (voluntary wheel running), OXPHOS subunit proteins and mitochondrial PGC-1α become upregulated. Moreover, exercise normalizes markers of oxidative stress and prevents abnormal mitochondrial morphology in skeletal muscle tissue of C26 mice. Interestingly, endurance trained C26 mice showed an increased food intake, a better grip strength, and showed a negative effect on tumor growth [31]. The combination of endurance and resistance training showed similar results as endurance training only [31,67]. The combined exercise training showed a trend towards more PGC-1α, cytochrome C, and SDH expression in skeletal muscle tissue of C26 mice. Hence, both endurance as well as combined training positively affects muscle mass and function by improving mitochondrial function [67].
The Effect of Exercise on Skeletal Muscle Mitochondrial Function in CRC Cachexia
In healthy persons [62] and cancer patients [63,64], physical exercise is associated with better health outcomes and health related quality of life. In mice, physical exercise increases total mitochondrial protein content within skeletal muscle fibers and thereby activates AMPK, the upstream regulator of PGC-1α [65,66]. However, the effects of exercise on skeletal muscle mass loss has been limitedly investigated in C26 mice. Here, different types of exercise (resistance, endurance, low intensity, high intensity) have been studied [31,67,68].
In C26 mice performing endurance training only (voluntary wheel running), OXPHOS subunit proteins and mitochondrial PGC-1α become upregulated. Moreover, exercise normalizes markers of oxidative stress and prevents abnormal mitochondrial morphology in skeletal muscle tissue of C26 mice. Interestingly, endurance trained C26 mice showed an increased food intake, a better grip strength, and showed a negative effect on tumor growth [31]. The combination of endurance and resistance training showed similar results as endurance training only [31,67]. The combined exercise training showed a trend towards more PGC-1α, cytochrome C, and SDH expression in skeletal muscle tissue of C26 mice. Hence, both endurance as well as combined training positively affects muscle mass and function by improving mitochondrial function [67].
Exercise, by using motorized wheel running, increased skeletal muscle mass and strength in C26 mice [27,68]. It caused a reduction of ROS levels, thereby decreasing oxidative stress and restoration of redox homeostasis in the skeletal muscles of exercised C26 mice [68]. Furthermore, motorized wheel running led to increased mitochondrial biogenesis and function (PGC-1α, cytochrome C, and SDH), and was able to partially reduce the expression of mitophagy markers (BNIP3) [27,68]. Additionally, exercised C26 mice show increased levels of Mfn2 mRNA, but no differences in the expression of Mfn1 [27], suggesting that exercise had a positive effect on mitochondrial fusion in these mice.
Exercise can also be combined with erythropoietin (EPO) to investigate the effects on muscle alterations in cancer cachexia. The receptor from EPO is located in the skeletal muscle and promotes myoblast differentiation and survival by the activation of MAPK and Akt [69]. The combination of EPO administration and exercise in C26 mice prevents partially cross-sectional area (CSA) reduction and prevents a shift from oxidative to glycolytic fiber type. Furthermore, acute exercise for two weeks combined with EPO has an antiinflammatory effect, by reducing circulating levels of the pro-inflammatory cytokine IL-6. However, on a long term, this effect was lost, which could be explained by the fact that prolonged exercise also releases IL-6. The combination of exercise and EPO rescues skeletal muscle mitochondrial function and structure in C26 mice, suggesting that EPO has a fundamental role in mitochondrial function. However, the administration of EPO alone in C26 mice is unable to prevent accumulation of dysfunctional mitochondria, indicating that exercise plays an important role [70].
Conclusions and Future Perspectives
This review describes current knowledge about the role of skeletal muscle mitochondria in CRC related cachexia. However, skeletal muscle mitochondrial dysfunction can also be observed in other cancer types besides CRC [24,71,72]. Based on the existing literature, it is undeniable that deterioration of skeletal muscle mitochondria plays a pivotal role in the development of CRC related cachexia. Several preclinical studies showed altered mitochondrial oxidative capacity, biogenesis, and fusion and fission, in CRC related cachexia. Therefore, preserving and/or restoring mitochondrial quality could be a promising future therapeutic strategy to maintain or improve muscle function and muscle mass in CRC patients. However, further research in human studies is absolutely necessary to unravel the role of skeletal muscle mitochondria in human CRC related cachexia. Of particular interest, (preventive) exercise could be a promising intervention to improve mitochondrial function, ultimately aiming to prevent or improve CRC related cachexia.
|
v2
|
2022-12-07T20:22:57.921Z
|
2022-11-27T00:00:00.000Z
|
254329229
|
s2orc/train
|
Synthesis and Anti-Tumor Effects of Novel Pomalidomide Derivatives Containing Urea Moieties
In order to explore novel immunomodulatory agents as anti-tumor drugs, we designed and synthesized a series of new pomalidomide derivatives containing urea moieties. Interestingly, in vitro biological experiments performed in several cancer cell lines showed that some of them displayed potent anti-tumor ability. These novel compounds 5a–5e and 6a–6e demonstrated the best cell growth inhibitive activity in human breast cancer cell lines MCF-7, but weaker inhibitive activity in human hepatocellular carcinoma cell lines Huh7. Moreover, compound 5d had the most powerful effects in this study, with an IC50 value of 20.2 μM in MCF-7. Further study indicated that compound 5d could inhibit cell growth and induce cell death in a concentration-dependent manner. Besides, compound 5d increased cellular ROS levels and induced DNA damage, thereby potentially leading to cell apoptosis. These observations suggest that the novel pomalidomide derivatives containing urea moieties may be worth further investigation to generate potential anti-tumor drugs.
Introduction
Immunomodulatory drugs (IMiD) are widely used in the clinical treatment of cancers. IMiD can stimulate T lymphocytes to increase IL-2 secretion and decrease the expression of proinflammatory cytokines [1,2]. Pomalidomide (Figure 1) is the third generation of IMiD produced by Celgene of the USA [3,4]. It is developed on the basis of the first generation of IMiD thalidomide, which modifies the molecular structure. The chemical name of pomalidomide is 4-amino-2-(2,6-dioxoperidine-3-ylisoindole-1,3-diketone). This improved IMiD can enhance the immune response mediated by T cells and NK cells, inhibit the production of monocyte proinflammatory cytokines, and induce apoptosis of cancer cells. Therefore, it is a popular treatment for various malignant tumors and immune diseases. Compared with the first and the second generation of IMiD, pomalidomide showed a stronger pharmacological effect, less toxicity, and better patient tolerance [5]. Because of its effective anti-angiogenesis and anti-inflammatory functions, pomalidomide is widely used in the early clinical studies of multiplemyeloma (MM) [6]. Recently, the molecular structure of pomalidomide has often been used as the ligand for E3 ligase in PROTAC production [7,8], and it plays an important role in the development of protease degradation drugs [9]. The urea structure fragment ( Figure 2) has a long and wide history in the application of medicinal chemistry. It consists of two aminos that are connected by carbonyl, and is an important fragment in drug development [10]. In the design of molecular drugs, the use of the urea structure fragment could improve activity, increase selectivity, and optimize physical and chemical properties; it is helpful for overcoming metabolic stability and removing toxic pharmacophore [11]. Until now, many drugs containing urea structure fragments that treat different diseases have been successfully marketed [12]. For example, glimepiride ( Figure 2), a classic third generation oral hypoglycemic drug, is widely used in diabetes [13]. Boceprevir (Figure 2), an effective oral anti-hepatitis C drug, is widely used in hepatitis therapy [14]. N,N-diphenylurea (DPU) ( Figure 2) is a kind of aromatic urea compound with a symmetrical structure and is widely found in plants with important roles. The function of DPU is similar to some cytokinin; it can promote chlorophyll synthesis and inhibit oxidase activity. DPU is a new plant growth regulator with important application values, which can help plants keep green, fresh, and delay aging. Moreover, derivatives of DPU are very important in medicine. Sorafenib ( Figure 2), a multi-kinase inhibitor with N,N-diphenyl urea structure that can inhibit the activity of c-RAF, b-RAF, c-KIT, FLT3, PDGFR-α/β, and VEGFR-1/2/3 is usually used in tumor treatment, especially in acute myeloid leukemia (AML) clinical trials [15,16]. The urea structure fragment ( Figure 2) has a long and wide history in the application of medicinal chemistry. It consists of two aminos that are connected by carbonyl, and is an important fragment in drug development [10]. In the design of molecular drugs, the use of the urea structure fragment could improve activity, increase selectivity, and optimize physical and chemical properties; it is helpful for overcoming metabolic stability and removing toxic pharmacophore [11]. Until now, many drugs containing urea structure fragments that treat different diseases have been successfully marketed [12]. For example, glimepiride ( Figure 2), a classic third generation oral hypoglycemic drug, is widely used in diabetes [13]. Boceprevir (Figure 2), an effective oral anti-hepatitis C drug, is widely used in hepatitis therapy [14]. N,N-diphenylurea (DPU) ( Figure 2) is a kind of aromatic urea compound with a symmetrical structure and is widely found in plants with important roles. The function of DPU is similar to some cytokinin; it can promote chlorophyll synthesis and inhibit oxidase activity. DPU is a new plant growth regulator with important application values, which can help plants keep green, fresh, and delay aging. Moreover, derivatives of DPU are very important in medicine. Sorafenib (Figure 2), a multi-kinase inhibitor with N,N-diphenyl urea structure that can inhibit the activity of c-RAF, b-RAF, c-KIT, FLT3, PDGFR-α/β, and VEGFR-1/2/3 is usually used in tumor treatment, especially in acute myeloid leukemia (AML) clinical trials [15,16]. The urea structure fragment ( Figure 2) has a long and wide history in the application of medicinal chemistry. It consists of two aminos that are connected by carbonyl, and is an important fragment in drug development [10]. In the design of molecular drugs, the use of the urea structure fragment could improve activity, increase selectivity, and optimize physical and chemical properties; it is helpful for overcoming metabolic stability and removing toxic pharmacophore [11]. Until now, many drugs containing urea structure fragments that treat different diseases have been successfully marketed [12]. For example, glimepiride ( Figure 2), a classic third generation oral hypoglycemic drug, is widely used in diabetes [13]. Boceprevir (Figure 2), an effective oral anti-hepatitis C drug, is widely used in hepatitis therapy [14]. N,N-diphenylurea (DPU) ( Figure 2) is a kind of aromatic urea compound with a symmetrical structure and is widely found in plants with important roles. The function of DPU is similar to some cytokinin; it can promote chlorophyll synthesis and inhibit oxidase activity. DPU is a new plant growth regulator with important application values, which can help plants keep green, fresh, and delay aging. Moreover, derivatives of DPU are very important in medicine. Sorafenib ( Figure 2), a multi-kinase inhibitor with N,N-diphenyl urea structure that can inhibit the activity of c-RAF, b-RAF, c-KIT, FLT3, PDGFR-α/β, and VEGFR-1/2/3 is usually used in tumor treatment, especially in acute myeloid leukemia (AML) clinical trials [15,16]. More and more studies focus on the therapeutic effects of novel synthesized compounds on tumors [17]. In order to explore more effective anti-tumor drugs, we linked pomalidomide and diphenyl urea compounds with different substituents through the ether chain structure and produced a series of novel pomalidomide derivatives containing urea moieties. Further study was performed to investigate the novel anti-tumor effects of these new compounds, include cell proliferation, apoptosis, ROS measurement, and molecular mechanisms. The aim of our study is to design and explore novel anti-tumor drugs that may provide potential strategy for cancers treatment. More and more studies focus on the therapeutic effects of novel synthesized compounds on tumors [17]. In order to explore more effective anti-tumor drugs, we linked pomalidomide and diphenyl urea compounds with different substituents through the ether chain structure and produced a series of novel pomalidomide derivatives containing urea moieties. Further study was performed to investigate the novel anti-tumor effects of these new compounds, include cell proliferation, apoptosis, ROS measurement, and molecular mechanisms. The aim of our study is to design and explore novel anti-tumor drugs that may provide potential strategy for cancers treatment.
Chemistry
The detailed operations are as follows (Scheme 1):
Effects of Novel Pomalidomide Derivatives Containing Urea Moieties on Cells Viability in Different Cancer Cell Lines
To investigate the effects of novel compounds (5a-5e and 6a-6e) on cell toxicity and viability, we treated different cancer cell lines with different concentrations of these compounds for 48 h to calculate IC 50 . The chosen cell lines include human breast cancer cells MCF-7 and human hepatocellular carcinoma cells Huh7. The IC 50 values of each compound in different cell lines were showed in Table 1. Results suggested that the cell growth inhibition activity of these compounds was better in MCF-7 cells than in Huh7 cells. Among these, compounds 5c and 5d showed more effective ability than others. The IC 50 values of 5c and 5d in MCF-7 cells were 26.93 µM and 20.2 µM, respectively. Furthermore, we measured three control compounds' IC 50 values. These controls have similar structures with our new compounds. Con1 is 4-amino-2- The IC 50 values of these controls were all higher than 200 µM. This suggested that the inhibitory effects against cancer cells of our modified compounds were significantly better than those of the controls. The data of IC 50 showed that the inhibition activity of compounds 5a-5e was better than 6a-6e, this suggested a urea structure that, at the meta-position of phenyl triazole structure, had better biological activity, and trifluoromethyl was found to be the most active substituent. 107.60 ± 13.17 >200 6e 99.14 ± 9.51 >200 con1 >200 >200 con2 >200 >200 con3 >200 >200
Novel Compound 5d Suppressed Cancer Cell Proliferation
The above results suggested that novel compounds, especially 5d, had an effective anti-proliferative activity to cancer cells. To further evaluate the role of compound 5d in cell proliferation, we performed the LIVE/DEAD staining and plate clone formation assay in MCF-7 cells. Cells were treated with different concentrations of compound 5d for 24 h, then, live and dead cells were stained with different dyes and photographed. The living cells were stained in green and the dead cells were stained in red. As shown, the number of dead cells increased in a dose dependent manner after treatment ( Figure 3A). The number of living cells was largely decreased in the 20 µM dose group compared with the control group ( Figure 3A). The ratio of dead to live cells was also dramatically increased in all treated groups, and was affected by dosage ( Figure 3A). Additionally, plate clone formation assay was detected to further investigate the anti-proliferation ability of compound 5d. The results showed that cell proliferation activity was suppressed and it was also changed in a dose-dependent manner ( Figure 3B). clone formation assay was detected to further investigate the anti-proliferation ability of compound 5d. The results showed that cell proliferation activity was suppressed and it was also changed in a dose-dependent manner ( Figure 3B).
Novel Compound 5d Induced Cell Apoptosis
The above data showed that compound 5d could inhibit cancer cell growth. To explore whether it had effects on cell apoptosis, we performed apoptosis analysis. After treatment with compound 5d for 48 h, MCF-7 cells were collected and stained with Annexin-V and PI. Quadrant Q1 represents necrotic cells, quadrant Q2 represents late apoptotic cells, quadrant Q3 represents early apoptotic cells, and quadrant Q4 represents non-apoptotic cells. The results showed that cell apoptosis, especially late apoptosis, was significantly induced in the 20 μM group but did not change in the 5 μM or 10 μM group compared with the control group ( Figure 4). Cell apoptosis is a continuous process that can occur at any phase of the cell cycle, and it is hard to define the exact phase of the cell at which apoptosis occurs.
Novel Compound 5d Induced Cell Apoptosis
The above data showed that compound 5d could inhibit cancer cell growth. To explore whether it had effects on cell apoptosis, we performed apoptosis analysis. After treatment with compound 5d for 48 h, MCF-7 cells were collected and stained with Annexin-V and PI. Quadrant Q1 represents necrotic cells, quadrant Q2 represents late apoptotic cells, quadrant Q3 represents early apoptotic cells, and quadrant Q4 represents non-apoptotic cells. The results showed that cell apoptosis, especially late apoptosis, was significantly induced in the 20 µM group but did not change in the 5 µM or 10 µM group compared with the control group ( Figure 4). Cell apoptosis is a continuous process that can occur at any phase of the cell cycle, and it is hard to define the exact phase of the cell at which apoptosis occurs.
Novel Compound 5d Increased ROS Levels and Induced DNA Damage
Cellular reactive oxygen species (ROS) are mainly produced by the mitochondrial and NAPDH oxidase family, which includes superoxide anion (O2-), hydroxyl (OH-), and hydrogen peroxide (H2O2). ROS levels affect many intracellular signaling transductions and, thus, play very important roles in life processes [18]. The homeostasis of ROS is associated with cell growth and survival. Studies showed that in many cancers, ROS levels were obviously increased, which could affect genome stability, excessive proliferation, angiogenesis, and epithelial mesenchymal transformation [19]. Researchers found that appropriately increased ROS levels could stimulate tumor cell proliferation, but excessively increased ROS levels would lead to tumor cell apoptosis and death [20]. In order to investigate whether the apoptosis induced by compound 5d was related to ROS levels, we treated MCF-7 cells with different doses of compound 5d for 24 h and detected cellular ROS levels using a DCFH-DA probe. ROS levels were dramatically increased in all treated groups, and they increased as the concentration increased ( Figure 5A).
Cell death can be caused by various processes, such as apoptosis, autophagy, and DNA damage [21]. To further evaluate these signaling pathways, key regulated protein expressions related to these processes were determined. Ubiquitin-like molecule light chain 3 (LC3) is the marker of autophagy, and results showed that the ratio of LC3II to LC3I did not change after compound 5d treatment, although the expression of LC3I and LC3II was increased ( Figure 5B). This suggests that autophagy may not be the main reason for cell death induced by compound 5d.
Novel Compound 5d Increased ROS Levels and Induced DNA Damage
Cellular reactive oxygen species (ROS) are mainly produced by the mitochondrial and NAPDH oxidase family, which includes superoxide anion (O 2 −), hydroxyl (OH−), and hydrogen peroxide (H 2 O 2 ). ROS levels affect many intracellular signaling transductions and, thus, play very important roles in life processes [18]. The homeostasis of ROS is associated with cell growth and survival. Studies showed that in many cancers, ROS levels were obviously increased, which could affect genome stability, excessive proliferation, angiogenesis, and epithelial mesenchymal transformation [19]. Researchers found that appropriately increased ROS levels could stimulate tumor cell proliferation, but excessively increased ROS levels would lead to tumor cell apoptosis and death [20]. In order to investigate whether the apoptosis induced by compound 5d was related to ROS levels, we treated MCF-7 cells with different doses of compound 5d for 24 h and detected cellular ROS levels using a DCFH-DA probe. ROS levels were dramatically increased in all treated groups, and they increased as the concentration increased ( Figure 5A).
Cell death can be caused by various processes, such as apoptosis, autophagy, and DNA damage [21]. To further evaluate these signaling pathways, key regulated protein expressions related to these processes were determined. Ubiquitin-like molecule light chain 3 (LC3) is the marker of autophagy, and results showed that the ratio of LC3II to LC3I did not change after compound 5d treatment, although the expression of LC3I and LC3II was Figure 5B). This suggests that autophagy may not be the main reason for cell death induced by compound 5d.
DNA damage is another important cause of cell death and it was reported that proteins involved in DNA damage are also related to cell apoptosis [21]. After treatment with compound 5d, the protein expressions involved in the DNA damage process increased, including H2AX variant histone (γ-H2AX) and poly (ADP-ribose) polymerase (PARP) ( Figure 5B). Moreover, the cell cycle process was determined and did not change, as reflected by the unchanged expressions of CyclinD, CyclinE, or β-catenin ( Figure 5B). DNA damage is another important cause of cell death and it was reported that proteins involved in DNA damage are also related to cell apoptosis [21]. After treatment with compound 5d, the protein expressions involved in the DNA damage process increased, including H2AX variant histone (γ-H2AX) and poly (ADP-ribose) polymerase (PARP) ( Figure 5B). Moreover, the cell cycle process was determined and did not change, as reflected by the unchanged expressions of CyclinD, CyclinE, or β-catenin ( Figure 5B). Blotting were: LC3, cyclin D, cyclin E, β-Catenin, γH2AX, PARP (all from Cell Signaling Technology, Danvers, MA, USA), β-actin (Sigma, Shanghai, China).
General Procedure for the Synthesis of Compound 3 (The Method Is Suitable for Compound 4)
Compound 2 (4.8 g, 0.01 mol) and 3-ethynylaniline (1.4 g, 0.012 mol) were added to a mixed solvent (water: CH 2 Cl 2 : tert-butanol: THF = 1:1:1:1, 40 mL). Cuprous chloride (0.2 g, 0.002 mol) was added to the mixture and the reaction was stirred at 65 • C. After completion of the reaction, the mixture was extracted with CH 2 Cl 2 (15 mL × 4). The combined organic phase was washed successively with water and brine, then drying with MgSO 4 and desolventizing. 13 A solution of compound 3 (6.0 g, 0.01 mol) in CH 2 Cl 2 (100 mL) was added with 1-isocyanato-4-methoxybenzene (1.5 g, 0.01 mol) in one portion. After stirring at room temperature for 2.5 h, the mixture was concentrated, and the residue was purified by column chromatography on silica gel (eluent: PE: EA = 2:1) to give compound 5a as a pale yellow solid (3.9 g). 13
Cell Culture
Human breast cancer cell line MCF-7 and human hepatocellular carcinoma cell line Huh7 were cultured in DMEM medium containing 10% FBS and 1% penicillin/streptomycin. Cells were maintained in a humidified incubator (5% CO 2 /95% air atmosphere at 37 • C).
Cell Viability Assay
Cell viability was evaluated by CCK-8 assay according to the manufacturer's instructions. Cells were seeded in a 96-well plate at the density of 5 × 10 3 cells per well. After incubation for 24 h, cells were treated with different doses (0, 5 µM, 10 µM, 20 µM) of new synthetic compounds and cultured for 48 h. Then, CCK-8 reagent was added to each well for one hour of incubation. Absorbance was measured using a Microplate Reader at the wavelength of 450 nm. For IC 50 , cells were treated with different concentrations of compounds (0, 10, 20, 40, 80, 160 µM) for 48 h and cell viability was measured. Then, the inhibition percentage was calculated and the IC 50 was analyzed using the prism statistical software.
Live and Dead Cells Assay
Cells were seeded in a 96-well plate with the density of 5 × 10 3 cells per well. Different concentrations (0, 5 µM, 10 µM, 20 µM) of compounds were added to cells and cultured for 24 h. Cells were then stained using Calcein/PI Live/Dead Viability Assay Kit, the living cells were stained green and dead cells were stained red. Live and dead cells numbers were observed and photographed using a fluorescent confocal microscope.
Plate Clone Formation Assay
Cells were seeded in a 6-well plate at a density of 500 cells per well. After adhesion, cells were treated with different doses of compounds (0, 5 µM, 10 µM, 20 µM) for 48 h. Then, cells were cultured continually for about 10 days until eye visible monoclonal cells appeared. Cells were then fixed with 4% paraformaldehyde and stained using Giemsa dye. Clone numbers were photographed and counted using an optical microscope.
ROS Measurement
Cells were seeded in a 96-well plate with the density of 5 × 10 3 cells per well. Different doses of compounds (0, 5 µM, 10 µM, 20 µM) were added to cells for 24 h. After treatment, cells were stimulated with 10 µM DCFH-DA for 30 min at 37 • C. A fluorescent confocal microscope was used to observe and photograph the cellular ROS levels.
Apoptosis Measurement
Annexin V-FITC/PI apoptosis detection was performed according to the manufacturer's instruction. Cells were cultured in a 6-well plate and treated with different concentrations of compounds (0, 5 µM, 10 µM, 20 µM) for 48 h. Then, cells were collected and washed with PBS and suspended in Annexin V binding buffer. FITC labeled Annexin V and PI were added and incubated for 20 min in the dark. Samples were measured using flow cytometry as soon as possible and the raw data was analyzed using FlowJo software (v10, Becton, Dickinson and Company, Ashland, CA, USA).
Western Blot
Protein expressions were evaluated by western blot. Cells were cultured in a 12-well plate and treated with different concentrations of compounds (0, 5 µM, 10 µM, 20 µM) for 48 h. Then cells proteins were collected using radioimmunoprecipitation assay (RIPA) buffer containing protease/phosphatase inhibitor cocktail. Proteins were separated and collected using a 10-12% sodium dodecyl sulfate polyacrylamide gel electrophoresis and nitrocellulose membranes. After being incubated with antibody, proteins were measured and calculated using the electronic chemiluminescence substrate kit.
Statistical Analyses
Data were presented as means ± SEM and performed using Graph Prim 7.0. A twotailed Student's t-test or one-way analysis of variance following Student-Newman-Keuls (SNK) test were used to assess significant differences. Values of p < 0.05 were considered statistically significant.
Conclusions
In summary, we designed and synthesized a series of novel pomalidomide derivatives containing urea moieties. These new compounds were evaluated for their anti-tumor functions in cancer cells lines. The results found that these new compounds exhibited more effective anti-tumor ability in MCF-7 cells than in Huh7 cells. Particularly, compound 5d showed the most promising effects on cancer cells, with IC 50 values of 20.2 µM in MCF-7. Moreover, studies demonstrated that compound 5d inhibited cell proliferation, increased cellular ROS levels, and induced DNA damage, leading to cell apoptosis and cell death. These observations may highlight the potential anti-tumor effects of these novel compounds and will provide novel therapy for cancer treatment.
Author Contributions: Investigation and analysis, Y.G., L.M. and X.W.; Writing-original draft preparation, Y.G., L.M., J.W. and L.P.; Writing-review and editing, Z.W. and G.X. All authors have read and agreed to the published version of the manuscript.
|
v2
|
2022-12-12T05:17:38.184Z
|
2022-11-27T00:00:00.000Z
|
254535100
|
s2orc/train
|
Intraoperative Appearance of Endosalpingiosis: A Single-Center Experience of Laparoscopic Findings and Systematic Review of Literature
Background: Endosalpingiosis is assumed to be the second most common benign peritoneal pathology after endometriosis in women. Although recent studies indicate a significant association with gynecologic malignancies, many underlying principles remain unclear. This work aimed to systematically describe the intraoperative appearance of endosalpingiosis. Methods: Data and intraoperative videos of patients with histologically verified endosalpingiosis were retrospectively reviewed. The main outcome measures were macroscopic phenotype and anatomical distribution. Additionally, a systematic review searching PubMed (Medline) and Embase was conducted. Results: In the study population (n = 77, mean age 40.2 years (SD 16.4)), the mean size of lesions was 3.6 mm and the main visual pattern was vesicular (62%). The most frequent localization was the sacrouterine ligaments (24.7%). In the systematic review population (n = 1174 (210 included studies overall), mean age 45.7 years (SD 14.4)), there were 99 patients in 90 different studies with adequate data to assess the appearance of the lesions. The mean size of the lesions was 48.5 mm, mainly with a cystic visual pattern (49.5%). The majority of the lesions affected the ovaries (23.2%), fallopian tubes (20.4%), or lymph nodes (18.5%). Comparing this study to the literature population, the main differences concerned the size (p < 0.001) and main visual patterns (p < 0.001) of lesions. Conclusions: The usual intraoperative findings of endosalpingiosis appeared less impressive than described in the literature. In our study population, lesions of a few millimeters in size with a vesicular appearance were mostly seen, most frequently in the sacrouterine ligament area. Intraoperative recognition by the gynecologic surgeon and histologic diagnosis should play an important role in further understanding this entity, scientifically and clinically.
Introduction
Endosalpingiosis is the ectopic presence of a fallopian tube-type glandular epithelium and has a prevalence of~7% in premenopausal women [1,2]. Described by Sampson in 1930 as "post-salpingectomy endometriosis", endosalpingiosis has long been perceived as an insignificant incidental finding, and thus the relevance of this condition remains largely unknown [3].
Endosalpingiosis is the second most common peritoneal disease in women following endometriosis, the most common representative of the condition known as mullerianosis [4]. These two entities occur concurrently in about 30-40% of cases [1,5]. A comparative study showed that endosalpingiosis does not have a chronic inflammatory nature and does not cause infertility or chronic pelvic pain compared with endometriosis [1]. The etiology remains unexplained for both to date; analogous theories have been discussed such as retrograde menstruation, metaplasia of the coelomic epithelium, embryonic misplacement, and hematogenous or lymphomatous dissemination [4,6]. Apart from exceptions where extensive lesions are revealed on imaging, endosalpingiosis is usually detected intraoperatively.
However, recent work indicates that endosalpingiosis is associated with gynecological tumors including uterine and ovarian neoplasia; among the latter, especially serous borderline, clear cell, invasive mucinous tumors, and endometrioid cancer subtypes [5,7], sharing similar molecular pathomechanisms [8].
Systematic descriptions of macroscopic appearance are sparse, making it difficult to recognize the lesions and distinguish them from endometriosis or other findings intraoperatively. Similar reference works as for endometriosis hardly exist [9].
Here, we systematically investigated the intraoperative macroscopic phenotype and anatomical distribution of endosalpingiosis based on an own patient population and a systematic literature review.
Own Population
The study was designed in compliance with the STROBE checklist [10]. Data and intraoperative videos of patients with endosalpingiosis undergoing a laparoscopy between 2007 and 2020 in the Department of Obstetrics and Gynecology of Cantonal Hospital Schaffhausen were examined. Exclusion criteria were a lack of histologically verified endosalpingiosis and missing or insufficient intraoperative video material. Every included video was reviewed by two reviewers independently (AM, NS). In cases of disagreement between the two reviewers, a third reviewer (LB) was invited to participate, and the consensus was reached by discussion.
Sample Size Calculation
The minimum required sample size was calculated based on the study by Hesseling et al. [2], presumably the most comprehensive description of intraoperative findings in endosalpingiosis to date, versus a review of the current literature data. According to these data, lesions of 1 to 10 mm in diameter seem most frequent in clinical routine. This is in line with our experience and in contrast to the literature, where mostly larger findings of 4-5 cm have been reported. Regarding the anatomical distribution, in the study by Hesseling et al., the majority of lesions were in the pouch of Douglas with 69%, whereas only 7% were seen there in the literature review. In consideration of these findings, assuming a statistical power of 80% (p = 0.05), at least 18 participants in each group were required to describe the macroscopic phenotype, or eight for the anatomic distribution.
Systematic Review Population
This systematic review was conducted according to the PRISMA Guidelines [11]. The study protocol was registered in PROSPERO (CRD42022303171). The search for eligible studies was conducted in two databases (PubMed, Medline, and Embase) using a combination of the following MeSH terms as an electronic search algorithm: Endosalpingiosis OR Mullerianosis OR Endometriosis after salpingectomy. Reference lists of relevant articles and associated reviews were manually searched to identify papers not captured in the electronic search. Original studies (cohort studies, case-control studies, case reports) concerning humans in any language were considered for inclusion. Studies were included if their focus was on endosalpingiosis and if they contained information about the macroscopic appearance and/or the anatomical distribution. Exclusion criteria were an insufficiently precise description of the appearance (in words or pictures), missing anatomical information, or a lack of histological confirmation.
If the same cases were included in more than one publication (e.g., abstract and full-text manuscript), only the publication with the most detailed information was considered. Abstracts providing information about the macroscopic presentation and anatomical distribution of endosalpingiosis were considered eligible if no full-text manuscript was available.
The main search was conducted independently by three investigators (LB, DRK, NS) for the relevant literature published until 31 December 2021. Discrepancies were resolved by consensus. In addition to information on the general characteristics of the studies (authors, year of publication, journal, design, number of patients), the following parameters were recorded in standardized Excel spreadsheets.
Parameters
In both the own population and the systematic review population, the clinicopathological characteristics of the patients (e.g., age, parity, menopausal status, previous abdominal or gynecological surgery, indication for surgery, concurrent endometriosis and/or cancer) were recorded.
The primary endpoint was the macroscopic phenotype of endosalpingiosis lesions; the secondary endpoint was the anatomical localization.
The appearance of the lesions from patients was described in terms of the shape, color, height, surface area, consistency, associated calcifications/adhesions/fibrosis, and histological presence of endometriosis in the same lesions. On this basis, lesions were allocated into five main visual patterns (types 1-5: vesicular, polypous, fimbrial-like, cystic, and unusual). This classification has been described previously by our group (Figure 1) [12]. Abstracts providing information about the macroscopic presentation and anatomical distribution of endosalpingiosis were considered eligible if no full-text manuscript was available.
The main search was conducted independently by three investigators (LB, DRK, NS) for the relevant literature published until 31 December 2021. Discrepancies were resolved by consensus. In addition to information on the general characteristics of the studies (authors, year of publication, journal, design, number of patients), the following parameters were recorded in standardized Excel spreadsheets.
Parameters
In both the own population and the systematic review population, the clinicopathological characteristics of the patients (e.g., age, parity, menopausal status, previous abdominal or gynecological surgery, indication for surgery, concurrent endometriosis and/or cancer) were recorded.
The primary endpoint was the macroscopic phenotype of endosalpingiosis lesions; the secondary endpoint was the anatomical localization.
The appearance of the lesions from patients was described in terms of the shape, color, height, surface area, consistency, associated calcifications/adhesions/fibrosis, and histological presence of endometriosis in the same lesions. On this basis, lesions were allocated into five main visual patterns (types 1-5: vesicular, polypous, fimbrial-like, cystic, and unusual). This classification has been described previously by our group (Figure 1) [12].
Statistical Analysis
Statistical analyses were performed with IBM SPSS Statistics 27 (Endicott, NY, USA). For the categorical data, the Chi-square test was used; for continuous data, the Mann-Whitney U test was used. p-values < 0.05 were considered statistically significant.
Quality Assessment Systematic Review
Quality assessments for the included studies were conducted independently by three reviewers (LB, DRK, NS). Quality assessment for the observational cohort studies was performed using the Newcastle-Ottawa Scale and, for case reports, the JBI critical appraisal checklist for case reports [13,14].
Patient and Public Involvement
Apart from the retrospectively recorded, anonymized laparoscopic images and clinicopathological data of patients of the own population, there was no patient or public involvement in this study. Patient consent was obtained for the anonymous re-use of the data and intraoperative images. Approval for research was obtained from the local ethics committee (2020-02718). There are no conflicts of interest to declare.
Endometriosis was simultaneously present in 53.2% (n = 41) of all cases. According to the American Society for Reproductive Medicine (ASRM) endometriosis classification, 46.3% (n = 19) were at stage I, 14.6% (n = 6) at stage II, 9.8% (n = 4) at stage III, and 29.3% (n = 12) at stage IV. Gynecological malignancies were associated in 28.6% (n = 22); among them, there were seven cases of endometrial cancer, one case of uterine carcinosarcoma, eight cases of borderline ovarian tumors, five cases of epithelial ovarian cancer, and one case of yolk sac tumor of the ovary (Table 1).
Phenotype
Most (64.9%, n = 50) of the cases could be adequately visualized. Five cases were excluded because laparotomy was performed without video documentation, seven cases because no video was archived, and three cases were due to poor video quality. In seven patients, endosalpingiosis could not be distinguished on the peritoneum or from other adjacent lesions (i.e., endometriosis). Endosalpingiosis was not visible due to its sole location in the lymph nodes (three cases) or omentum (two cases). The mean single-lesion size was 3.6 mm (range 1-40 mm, SD 5.7 mm). The main colors were transparent (48%, n = 24) and white (22%, n = 11). Most lesions had a regular shape (64%, n = 32), were flat (70%, n = 35), had a smooth surface (84%, n = 42), and had a soft or liquid consistency (88%, n = 44). Calcifications were present in 24% (n = 12), and adhesion in 32% (n = 16). The main visual group was vesicular type (62%, n = 31), followed by fimbrial-like (12%, n = 6), cystic (10%, n = 5), and polypous (6%, n = 3) (Table 3). In three cases, there was a second lesion of endosalpingiosis. Among them, two were vesicular and one of type 5 (unusual). Figure 2 provides a schematic intraoperative view of the findings.
Systematic Review
Two hundred and ten publications were included, with a total of 1174 patients. Among them, 77.1% (n = 162) were case reports or case series with less than five cases, and 22.9% (n = 48) of publications were original human research. Less than half (42.8%, n = 90) of the articles had information about the visual aspect of endosalpingiosis and anatomical distribution, and 20.5% (n = 43) of the studies included a picture of the macroscopic appearance [2, (Figure 3). Most (81.4%, n = 171) included a histological picture, 8.1% (n = 17) an ultrasound image, 11.0% (n = 23) a CT-scan, and 11.4% (n = 24) an MRI image. More than half (57.1%, n = 120) of the studies included only information on the anatomical distribution and no depiction of the phenotype [1,8,. All of the studies with information on the phenotype also indicated the anatomical distribution. adjacent lesions (i.e., endometriosis). Endosalpingiosis was not visible due to its sole location in the lymph nodes (three cases) or omentum (two cases).
Data on the indication for the surgery was available in 295 patients. These were mainly: 28.8% (n = 85) suspicious pelvic mass, 21.4% (n = 63) acute or chronic pelvic pain, 15.6% (n = 46) gynecologic neoplasm, and 7.1% (n = 21) fertility diagnostic. All indications are shown in Table 2. Of the 295 patients where indication for surgery and procedure were known, 3.7% (n = 11) received colorectal surgery (seven rectosigmoid resections, one right hemicolectomy, one ileocecal resection, one other colonic segmental resection, one small bowel segmental resection).
Anatomical Distribution
In 210 publications with a total of 1174 patients, there was information about the lesion localization of the endosalpingiosis lesion. In 90.6% (n = 1064) of the cases, the lesion was localized only on one site, affecting not more than one organ (unilocular); 4.9% (n = 57) were multilocular; and 4.5% (n = 53) were diagnosed on abdominal washing cytology and could not be assigned to the above two groups. The most frequent localization was the ovaries (23.2%, n = 272), the fallopian tubes (20.4%, n = 239), and the lymph nodes (18.5%, n = 217). Table 4 shows all the different localizations of the lesion.
Comparison between Own and Systematic Review Population
When comparing the own with the literature population, there were significant differences in the macroscopic aspect between our collective and the reported cases in terms of size (p < 0.001), shape (p = 0.001), color (p = 0.005), height (p < 0.001), consistency (p = 0.007), adhesions (p = 0.002), and in the main visual groups (p < 0.001) (Table 3).
Furthermore, there were significant differences in the anatomical distribution. We found more lesions on the peritoneum of the bladder (p < 0.001), the parametrium (p < 0.001), the sacrouterine ligaments (p < 0.001), the pelvic sidewall (p < 0.001), the cavity of Douglas (p < 0.001), and the abdominal wall (p = 0.047). In contrast, the cases reported in the literature were more likely to be localized in the ovary (p < 0.001), fallopian tube (p < 0.001), and lymph nodes (p < 0.001) ( Table 4). There was no significant difference in the percentage of colorectal procedures between the two populations (p = 0.287).
Discussion
This study shows the relevant differences between the own population, reflecting clinical practice at a gynecological reference center, and the systematic literature population.
In both populations, the main indications for surgery were pelvic pain, gynecological neoplasm, infertility, and pelvic mass. Significantly more frequent in the own population was fertility diagnostic and surgery for neoplasms; in the literature group, it was pelvic mass. That fertility work-up is a common indication for surgery in patients with findings of endosalpingiosis is consistent with Prentice et al. (27.6% (n = 16/58) vs. 27.1% (16/59) in premenopausal patients) [1]. That pelvic mass was more common as an indication in the literature population is most likely due to the large manifestations seen in preoperative imaging [73,81,213]. The indications seem heterogeneous, which strengthens the currently accepted thesis that endosalpingiosis is mostly an incidental finding and does not cause pain or infertility [1].
This study's clinically most relevant finding lies in the macroscopically different lesions (Table 3). Based on nine phenotypic features described in the Materials and Methods, the lesions were subdivided into five visual patterns, which have been published elsewhere [12]: Type 1 lesions (vesicular) are mostly smaller than 5 mm, symmetric with a translucent clear or yellow liquid content; Type 2 (polypous) are around 5 mm to 10 mm in size, with a smooth surface and reddish color with the closest resemblance to endometriosis; Type 3 (fimbrial-like) looks like fimbrial mucosa with a smooth opaque surface and appears as grouped bumps, frequently on fallopian tubes; Type 4 (cystic) are usually bigger than 10 mm, forming a cystic sac and can be found as pedunculated structures attached to pelvic organs. Type 5 includes all other lesions. The average size of a single lesion in the study population was less than 4 mm (mostly vesicular (Type 1), 62%), whereas in the literature population, it was almost 5 cm (mostly cystic (Type 4), 49.5%) (Table 3, Figure 1). This difference most likely resulted from publication bias. Most (77.1%) of the articles containing information on the intraoperative aspect of endosalpingiosis are case reports, where impressive examples are interesting [66,68]. This underlines that knowledge on the part of the laparoscopist is important to even recognize this entity intraoperatively.
To date, the origin of endosalpingiosis is not clear. Similar hypotheses of development (retrograde menstruation, metaplasia of the coelomic epithelium, iatrogenic, metastatic, embryonic remnant) are proposed as for endometriosis. Reactive excessive tubal proliferation following salpingitis is another theory [4,222]. Additionally, the natural history of endosalpingiosis and the course of changes over the lifespan are completely unclear.
The term "florid" endosalpingiosis is frequently used in the literature, representing large cystic findings. A recognized definition is missing, so it is unclear whether the term "florid" correlates with biological behavior [51,68,74,78,87,200].
How and even whether to approach endosalpingiosis lesions surgically has not been determined. We used near-contact laparoscopy with high resolution. All macroscopically detected foci were removed by local peritoneal excision. Due to the unclear significance and for histological workup with differentiation from other entities, especially endometriosis, until now, we have deliberately decided to avoid ablative procedures.
Although the distinction from endometriosis can often only be made histologically, some features can help to differentiate these entities intraoperatively. According to our experience and published hypothesis, endosalpingiosis lesions seem to have a more symmetrical, clearly circumscribed shape, sometimes surrounded by fine adhesions (32%) and calcifications (24%). Endosalpingiosis seems rarely associated with inflammation (neoangiogenesis, fibrosis). Additionally, we did not encounter any distortion of the anatomy in our cases, as is common in deep endometriosis [12].
The calcifications look like grains of sand and are associated with psammoma bodies, which are dystrophic calcification following cellular degeneration [223]. These are in ovarian serous papillary neoplasms and non-neoplastic peritoneal diseases such as endosalpingiosis [224].
Another differential diagnosis to be considered is peritoneal mesothelioma. This presents from smaller peritoneal lesions of 2 to 20 mm to larger cystic findings. On immunohistological examination, these lesions can be distinguished from endosalpingiosis [160,225,226].
Concerning localization, 90% of lesions in our own population were located in the pelvis, most commonly on the sacrouterine ligaments, bladder, or the remaining cavity of Douglas. In the literature, more lesions were on the ovaries or fallopian tubes and as incidental findings of lymphadenectomies. Hesseling et al. found the most common lesions in the cavity of Douglas, followed by the cardinal ligaments [2].
In the literature population, the prevalence of malignancy in patients with endosalpingiosis was significantly lower than in the own population, which showed similar frequencies to the epidemiologic studies by Hermens et al. and Esselen et al. [5,7,227]. It is possible that large cystic forms are less frequently associated with malignancy. It is still unclear whether endosalpingiosis is an insignificant incidental finding or represents a relevant risk factor or even a precursor lesion [154]. As recently published research has shown, there is increasing evidence that most low-grade serous tumors in the ovary are related to endosalpingiosis [228].
The limitations of this study-concerning the own population-were the retrospective monocentric design, the limited study population, and that we could not guarantee that all manifestations were seen. To detect as many lesions as possible, we adopted the concept of near-contact laparoscopy [229]. Concerning the retrospective design and limited population, it can be said that endosalpingiosis is still usually an incidental finding, so there is no preoperative inclusion in an endosalpingiosis cohort. In addition, biopsy and optimal imaging are required for this type of study. Nevertheless, a sample size calculation was performed to have enough power for the research question. Regarding the systematic review, a relevant proportion of the literature consisted of case reports; there were hardly any similar works to compare.
This work raises questions that could be addressed in the future: Do different types of endosalpingiosis actually exist, and is this reflected at the histopathologic level? Is there a different neoplastic potential?
Conclusions
The endosalpingiosis lesions found in clinical practice are much less prominent than those described in the literature. These are often a few millimeters in size, vesicular in appearance, and located in the small pelvis. For further scientific and clinical understanding of endosalpingiosis including its association with malignancy and the resulting recommendations for clinical consequences in the future, detailed knowledge of endosalpingiosis among gynecologic surgeons as initial diagnosticians is essential.
Institutional Review Board Statement:
The study was conducted in accordance with the Declaration of Helsinki, and approved by the responsible cantonal Ethics Committee of Zurich (2020-02718).
Informed Consent Statement:
Informed consent was obtained from all subjects involved in the study.
Data Availability Statement:
The data presented in this study are available on request from the corresponding author. The data are not publicly available according to the requirements of the ethics committee.
Conflicts of Interest:
The authors declare no conflict of interest.
|
v2
|
2022-12-12T05:18:59.582Z
|
2022-11-27T00:00:00.000Z
|
254534874
|
s2orc/train
|
How Should We Treat Meningeal Melanocytoma? A Retrospective Analysis of Potential Treatment Strategies
Simple Summary As a rare tumor disease, only single case reports and small case series have been published on meningeal melanocytomas. In the case of complete surgical resection, there is a shallow risk of recurrence, whereas the benefit of radiotherapy or chemotherapy, both as single or combined therapy, is unclear. This work aims to analyze and summarize previously published cases and proposes a therapeutic algorithm. Abstract Background: Meningeal melanocytomas (MM) are rare primary melanocytic tumors of the leptomeninges with an incidence of 1:10,000,000. Until now, there has been only sparse information about this tumor entity. Here, we provide a meta-analysis of all cases published in the English language since 1972. Methods: A literature review was performed using PubMed and Web of Science. All published cases were evaluated for location, sex, age, therapeutic approach, and outcome. In total, we included 201 patient cases in our meta–analysis. Results: The majority of MM was diagnosed more frequently in men between the third and fifth decade of life. Surgery is the preferred therapeutic approach, and total resection is associated with the best outcome. Patients with partial resection or tumor recurrence benefit from adjuvant radiotherapy, whereas chemo- or immunotherapies do not improve the disease course. Malignant transformation was described in 18 patients. Of these, 11 patients developed metastasis. Conclusions: We present the first retrospective meta-analysis of all MM cases published in the English language, including an evaluation of different treatment strategies allowing us to suggest a novel treatment guideline highlighting the importance of total resection for recurrence–free survival and characterizing those cases which benefit from adjuvant radiotherapy.
Introduction
Meningeal melanocytomas (MM) are rare primary melanocytic tumors of the leptomeninges. They can be divided into circumscribed or diffuse, benign or malignant lesions. Well-differentiated, circumscribed tumors are called meningeal melanocytomas, while their malignant counterparts are meningeal melanomas. Additionally, MM with increased mitotic activity or invasion of the CNS parenchyma are considered intermediategrade lesions. Furthermore, diffuse melanocytic tumors are characterized by invasion into subarachnoid space. Depending on the dignity of the histological phenotype, the lesion is called meningeal melanocytosis or meningeal melanomatosis [1]. Since their first description in 1972 [2], about 201 cases have been reported in English worldwide. They can be found anywhere along the neuraxis, and clinical presentation depends on tumor location and size.
Depending on the amount of melanin [3], MM appear isointense to hyperintense on T1-weighted and isointense to hypointense on T2-weighted MRI and show heterogenous contrast enhancement. In CT, MM appear as well-defined, isodense to hyperdense with homogeneous, contrast-enhancing lesions [4,5].
Depending on the amount of melanin [3], MM appear isointense to hyperintense on T1-weighted and isointense to hypointense on T2-weighted MRI and show heterogenous contrast enhancement. In CT, MM appear as well-defined, isodense to hyperdense with homogeneous, contrast-enhancing lesions [4,5].
Figure 1.
Exemplary perioperative MRI sequences of a 25-year-old Meningeal Melanocytoma (MM) patient that underwent surgery for a cerebellar lesion at our department. Axial T1 MRI showing a grey matter isointense posterior fossa mass shifting the brain stem forward, compressing cerebellum and brainstem, thereby leading to obstruction of the fourth ventricle. Preoperative (left row) T1 imaging after gadolinium application shows sagittal and axial inhomogeneous contrast enhancement. Postoperative (middle row) T1-weighted MRI without contrast agent (axial) and following gadolinium application (sagittal, axial), showing total resection of the mass with decompressed 4th ventricle and without secondary bleeding. Histopathological analysis of our case revealed spindleshaped cells that showed expression of S-100, HMB45, and MelanA. patient that underwent surgery for a cerebellar lesion at our department. Axial T1 MRI showing a grey matter isointense posterior fossa mass shifting the brain stem forward, compressing cerebellum and brainstem, thereby leading to obstruction of the fourth ventricle. Preoperative (left row) T1 imaging after gadolinium application shows sagittal and axial inhomogeneous contrast enhancement. Postoperative (middle row) T1-weighted MRI without contrast agent (axial) and following gadolinium application (sagittal, axial), showing total resection of the mass with decompressed 4th ventricle and without secondary bleeding. Histopathological analysis of our case revealed spindle-shaped cells that showed expression of S-100, HMB45, and MelanA (right row).
Although several case reports have been published, so far, it remains unclear which is the best treatment approach for MM, in particular for those cases in which only incomplete surgical resection could be performed. Therefore, the aim of this study was to reanalyze all published cases, as well as one unpublished case from our department, concerning the applied treatment strategies and their outcome.
Search Strategy and Statistics
MM cases were identified by using PubMed (Medline) and Web of Science (Clarivate). As the keyword, "meningeal melanocytoma" was used. In total, 219 (PubMed) and 247 (Web of Science) results were found, which were published between 1972 and 2022. After subtracting duplicates, the total data covered 312 items. Articles were excluded if they did not provide a novel case report, if the abstract did not include MM as a topic (n = 77), or if written in another language than English (n = 35), so in total, 201 cases were included in this analysis, as we also included one unpublished MM case from our department ( Figure 1). All published cases were evaluated for age, gender, tumor location, and therapeutic approach as well as postoperative outcome (recurrence, metastasis, recurrence-free survival) ( Figure 2). Although several case reports have been published, so far, it remains unclear which is the best treatment approach for MM, in particular for those cases in which only incomplete surgical resection could be performed. Therefore, the aim of this study was to reanalyze all published cases, as well as one unpublished case from our department, concerning the applied treatment strategies and their outcome.
Search Strategy and Statistics
MM cases were identified by using PubMed (Medline) and Web of Science (Clarivate). As the keyword, "meningeal melanocytoma" was used. In total, 219 (PubMed) and 247 (Web of Science) results were found, which were published between 1972 and 2022. After subtracting duplicates, the total data covered 312 items. Articles were excluded if they did not provide a novel case report, if the abstract did not include MM as a topic (n = 77), or if written in another language than English (n = 35), so in total, 201 cases were included in this analysis, as we also included one unpublished MM case from our department ( Figure 1). All published cases were evaluated for age, gender, tumor location, and therapeutic approach as well as postoperative outcome (recurrence, metastasis, recurrence-free survival) ( Figure 2). As database PubMed and Web of Science were used. As keyword "meningeal melanocytoma" was applied. In total, 219 results were found using PubMed and 247 using Web of Science published between the first description in 1972 and 2022. After subtracting duplicates, the total data covered 312 items. A total of n = 77 were excluded because no novel case report of MM was provided, and n = 35 were excluded as no abstract was available in English language. Therefore, in total, 201 published cases, as well as 1 unpublished case from our department, were included for further analysis.
All patient cases were included in our analysis, of which at least one of the above variables could be collected. For this reason, the population groups for the different analyses also differed in size (indicated each time in the text). Histological diagnoses of tumors described here were adopted from the original manuscripts. No reevaluation of histological specimens was performed by local neuropathologists according to the 2021 WHO classification. Therefore, the lesions depicted here were classified according to the current WHO classification in each case. Statistical analysis was performed using the statistics Figure 3. Age-dependent incidence of MM in females (red) and males (blue). The y-axis represents the age of the patients, and the x-axis is the count of female or male patients that were diagnosed with MM. The youngest patient was only 28 weeks old, and the oldest patient was diagnosed at the age of 79 years ( Figure 2). The median age of disease onset of female patients was 37 years, and for male patients, it was 42 years. A higher frequency of MM was found in men compared to women (1.4:1).
Location
The location of the tumor was reported in 189 out of 201 cases. About half of the MM were found intracranially (101/189, 52.6%). The predominant location was the posterior fossa (57/101, 56.4%), followed by the middle cranial fossa with 11 cases (11/101, 10.9%) and the sellar region with 9 cases (9/101, 8.9%). Within the posterior fossa, MM occurred most often at the cerebellopontine-angle (CPA) (18/57, 31.6%). In the spine, MM occurred . Age-dependent incidence of MM in females (red) and males (blue). The y-axis represents the age of the patients, and the x-axis is the count of female or male patients that were diagnosed with MM. The youngest patient was only 28 weeks old, and the oldest patient was diagnosed at the age of 79 years ( Figure 2). The median age of disease onset of female patients was 37 years, and for male patients, it was 42 years. A higher frequency of MM was found in men compared to women (1.4:1).
Total Resection and Partial Resection
Treatment strategies were reported in 186 out of 201 cases (92.5%). As the primary therapeutic approach, surgery was performed in 179 out of 186 patients (96.2%) of the cases. In the remaining cases, radiotherapy was used in two, and no therapy was applied in five others. Total resection was achieved in 89 out of 179 (49.7%) of cases and partial resection in 73 out of 179 cases (40.7%), while in 9.5% of surgical procedures, the extent of resection was not documented (17/179).
Adjuvant Therapy
Total resection was performed without any further therapy in 81 out of 179 patients (45.3%). The combination of total resection and radiotherapy was applied in 8 (4.5%), partial resection alone in 45 cases (25.1%), and adjuvant radiotherapy after partial resection in 24 out of 179 cases (13.4%). In two cases, radiosurgery was used after partial resection so that the remaining tumor could also be targeted [15,16]. Due to the severity and progression of the disease, five patients did not receive any therapy, and three of them died; one developed tumor progression, and for the last one, follow-up data were not available. In fact, one of those patients was diagnosed by autopsy.
Definite Radiotherapy and Radiosurgery
Due to tumor localization in an eloquent region, resection could not be performed in three patients. In two of these patients' definite radiotherapy was chosen as a treatment option with a tumor-free follow-up of 42 months in 1 patient [24]. The other patient died due to pneumonia, unrelated to the MM [24]. In one case, radiosurgery alone was used as initial treatment after biopsy of the tumor [25]. Re-operation was the main therapy chosen in cases of tumor regrowth in 14 out of 44 cases (31.8%), followed by combination of re-operation and radiotherapy, applied in 7 (15.9%), re-operation combined with radiochemotherapy in another 4 (9.1%), while radiotherapy alone was used in 4 out of 44 cases (9.1%). In addition, three cases in which radiosurgery was used as follow-up therapy after recurrence of the tumor were also reported [32][33][34].
Outcome
For outcome analysis, we were able to evaluate 147 out of 201 data sets comprising information about initial therapy and follow-up (73.1%). Total resection was the most efficient therapy and showed a tumor-free interval without recurrence in 68.1% of cases (p = 0.001). The median tumor-free interval was 18 months, with a minimum of 1 month and a maximum of 35 years. If, alternatively, only partial resection was performed, a better outcome was shown in 61.9% of the patients by the additional use of adjuvant radiotherapy (see Tables 2 and 3). Tumor progression was recorded here at a median of 24 months, ranging from 1 month to 16 years before recurrence developed. When resection was combined with chemotherapy, tumor-free follow-up was not recorded in 10 out of 11 cases for total resection, partial resection, or with additional radiotherapy. Only one case was noted to have a tumor-free interval [31] (Table 1).
For radiosurgery, the outcome in all but one case was found to result in a tumor-free or progression-free interval. For this, it has been regardless of whether radiosurgery was used initially or subsequently at recurrence [15,16,25,[32][33][34].
Intermediate-Grade and Malignant Transformation
MM with a MIB-1/Ki-67 of 5-10% are defined as intermediate-grade MM with potential for development into malignant melanoma (>10% Ki-67). In total, 16 intermediate cases were reported, 14 showed a high recurrence rate without adjuvant radiotherapy after resection, and 2 were treated by radiotherapy without recurrence [42].
Furthermore, another 17 cases of MM reported malignant transformation [26,27,29,34,43,44]. Thirteen of these patients died, and four patients developed tumor progression. In 11 of these patients, MM metastases were found. All but three of these patients died of disease progression. Regarding the localization of metastasis, we were able to highlight that MM metastasize both within the central nervous system but also can occur in other tissues, as metastases were observed in the liver [8,22], pancreas [22], and skeleton [8] (Table 4). Regarding the temporal component at follow-up, we were able to highlight a median of 18 months (range: few days-35 years).
Discussion
Since its first description in 1972 by Limas and Tio [2], several case descriptions of MM have been published; however, a meta-analysis of MM and evaluation of treatment strategies is missing but urgently needed. Our aim of this study was to analyze all available data from all MM cases published so far and evaluate potential treatment strategies.
Interestingly, our data demonstrated that MM occurs at a younger age in females than in males and is more frequent in males than in females, which contradicts the impression from smaller studies where female patients were thought to develop MM more often [50,51]. We could confirm the impression that MM is a disease of the adult, and in the majority of the cases independent of gender, MM occurred between the 3rd and 5th decade [51], while children were only rarely affected.
Furthermore, our analysis shows that the predominant location is the posterior fossa, as well as the cervical and thoracic spine, which is in line with the embryological development of melanocytes [52]. Melanocytes originate from the neural crest, which in turn gives rise, among other tissues, also to the leptomeninges. This may explain the preferred location of MM in the posterior fossa as well as the cervical and thoracic spine [52].
We evaluated treatment strategies and their outcome, showing the best recurrence-free follow-up after total resection (Figure 4). In these cases, no clear evidence was found that adjuvant therapy is beneficial. Combined treatment with total resection and adjuvant radiotherapy may be considered only for those cases where tumors show high mitotic activity, i.e., intermediate MM, which has been observed to be associated with tumor recurrence. The differentiation to intermediate-grade (Ki67/MIB1-proliferation index of 5-10%) MM and malignant transformation into melanoma (Ki67/MIB1-proliferation index of >10%) is particularly important [53][54][55][56]. Only in those cases that first received a total resection but developed MM recurrence, radiotherapy appears to be an advantage for recurrence-free survival ( Figure 5).
In patients where only partial resection was achieved, radiotherapy showed a clear beneficial effect, while other therapeutic approaches, such as chemotherapy or immunotherapy, did not show any advantages. Furthermore, some case reports indicate a potential benefit of radiosurgery.
When MM is considered as a diagnosis, we do not suggest deciding on conservative follow-up observations, as we learned that MM appear capable of developing metastases. When the tumor is inoperable, definite radiotherapy has also been used successfully.
Therefore, we suggest the following treatment approach for patients that are diagnosed or considered to have MM ( Figure 4): Only in those cases that first received a total resection but developed MM recurrence, radiotherapy appears to be an advantage for recurrence-free survival ( Figure 5). Figure 4. Treatment strategies at initial therapy: When MM is diagnosed, total resection should be the primary goal. Depending on the Ki-67 index, it should then be evaluated whether adjuvant radiotherapy is necessary. Figure 5. Treatment strategies after tumor recurrence/progression: Reoperation is the most used treatment option for tumor progression. However, in almost no case report, a second follow-up after the first recurrence is recorded, so no further evaluation can be made here as to how successful the respective therapy options are. These are only the therapies that are most frequently used.
Although chemo-and immunotherapy has failed so far, several mutations, such as in Guanine-nucleotide binding protein G subunit alpha (GNAQ, GNA11), have been identified [57]. Both GNAQ and GNA11 are g-proteins that share responsibility for activating the MAP-kinase pathway. Both have been suspected to be potential therapeutic targets. In mouse models, GNAQ and GNA11 have been shown to lead to hyperpigmentation and proliferation of melanocytes [58]. Additionally, molecular analysis of PLCB4 and CYS-LTR2 [59][60][61] and methylation profiling are especially useful in discriminating these lesions from other pigmented CNS tumors [1,59]. The presence of SF3B1-, EIF1AX-, or BAP1-mutation or complex copy number variations indicate aggressive behavior consistent with meningeal melanoma [62][63][64]. Especially in children, meningeal melanocytosis and melanomatosis are characterized by NRAS-and occasionally BRAF mutations [65][66][67].
Beyond that, novel immunotherapies applied for malignant melanoma therapy may be beneficial also for MM. Both share common antigens, such as Melan-A or S-100 [11][12][13]. Therefore, further studies investigating novel potential therapies are needed. Figure 5. Treatment strategies after tumor recurrence/progression: Reoperation is the most used treatment option for tumor progression. However, in almost no case report, a second follow-up after the first recurrence is recorded, so no further evaluation can be made here as to how successful the respective therapy options are. These are only the therapies that are most frequently used.
Limitations of the Study
In patients where only partial resection was achieved, radiotherapy showed a clear beneficial effect, while other therapeutic approaches, such as chemotherapy or immunotherapy, did not show any advantages. Furthermore, some case reports indicate a potential benefit of radiosurgery.
When MM is considered as a diagnosis, we do not suggest deciding on conservative follow-up observations, as we learned that MM appear capable of developing metastases. When the tumor is inoperable, definite radiotherapy has also been used successfully.
Therefore, we suggest the following treatment approach for patients that are diagnosed or considered to have MM ( Figure 4): Although chemo-and immunotherapy has failed so far, several mutations, such as in Guanine-nucleotide binding protein G subunit alpha (GNAQ, GNA11), have been identified [57]. Both GNAQ and GNA11 are g-proteins that share responsibility for activating the MAP-kinase pathway. Both have been suspected to be potential therapeutic targets. In mouse models, GNAQ and GNA11 have been shown to lead to hyperpigmentation and proliferation of melanocytes [58]. Additionally, molecular analysis of PLCB4 and CYSLTR2 [59][60][61] and methylation profiling are especially useful in discriminating these lesions from other pigmented CNS tumors [1,59]. The presence of SF3B1-, EIF1AX-, or BAP1-mutation or complex copy number variations indicate aggressive behavior consistent with meningeal melanoma [62][63][64]. Especially in children, meningeal melanocytosis and melanomatosis are characterized by NRAS-and occasionally BRAF mutations [65][66][67].
Beyond that, novel immunotherapies applied for malignant melanoma therapy may be beneficial also for MM. Both share common antigens, such as Melan-A or S-100 [11][12][13]. Therefore, further studies investigating novel potential therapies are needed.
Limitations of the Study
As MM is a rare entity, the composition of our multi-center derived data set was very inhomogeneous due to different authors and unrelated case reports. For that reason, this study can only serve as a meta-analysis of all published case reports, which intuitively cannot fulfill the criteria for a real comprehensive study. Thus, future multicenter prospective studies with fixed follow-up periods are now needed in order to achieve precise outcome and prognosis and verify our treatment suggestions derived from our retrospective analysis.
The fact that we were unable to reanalyze the tissue samples in this study is a methodological limitation of studies such as this and can bias conclusions. Hopefully, future reports will be able to use more up-to-date histopathological classifications.
Conclusions
Based on the first retrospective meta-analysis of all MM cases published in the English language, we propose a novel guideline for the treatment of MM, highlighting the importance of total resection for recurrence-free follow-up and suggesting in which cases adjuvant radiotherapy may have beneficial effects of the patient's disease course.
|
v2
|
2022-12-12T05:23:10.530Z
|
2022-11-27T00:00:00.000Z
|
254534962
|
s2orc/train
|
Secular Trends in Incidence of Esophageal Cancer in Taiwan from 1985 to 2019: An Age-Period-Cohort Analysis
Simple Summary Esophageal cancer (EC) was the eighth most common type of cancer worldwide in 2020. In Taiwan, the age-standardized incidence of EC, especially esophageal squamous cell carcinoma (ESCC), has increased substantially during the past thirty years. These trends may be associated with changes in the prevalence of risk factors in Taiwan, including smoking, alcohol consumption, and betel nut chewing. In the study, we described the incidence trends of EC from 1985–2019 and the trends of the risk factors to explore the relationship between the risk factors and the incidence rates of EC. The results showed the incidence rate of ESCC in men and overall EC increased prominently from 1985–1989 to 2015–2019. The increased prevalence of risk factors from approximately 1970–1995 could explain the increased cohort effects of EC. We suggest that early detection in high-risk patients and prevention should be conducted strictly. Abstract In Taiwan, the age-standardized incidence of EC, especially esophageal squamous cell carcinoma (ESCC), has increased substantially during the past thirty years. We described the incidence trends of EC from 1985–2019 by an average annual percentage change (AAPC) and age-period-cohort model by using Taiwan Cancer Registry data. Age-period-cohort modeling was used to estimate the period and cohort effects of ESCC and esophageal adenocarcinoma (EAC). The Spearman’s correlation coefficient was used to analyze the correlation between age-adjusted incidence rates of EC and the prevalence of risk factors from national surveys. The results showed the incidence rate of ESCC in men (AAPC = 4.2, 95% CI = 3.1–5.4, p < 0.001) increased prominently from 1985–1989 to 2015–2019 while that of EAC in men (AAPC = 1.2, 95% CI = 0.9–1.5, p < 0.001) and ESCC in women (AAPC = 1.7, 95% CI = 1.4–2.1, p < 0.001) increased to a lesser degree. Increased period effects were observed in ESCC in men, ESCC in women, and EAC in men. High correlations were found between the risk factors and the increased birth-cohort effects of ESCC (p < 0.05). To conclude, the incidence of ESCC in both sex and EAC in men increased with statistical significance in recent decades. The increased prevalence of risk factors from approximately 1970–1995 could explain the increased cohort effects of ESCC.
Introduction
EC was the eighth most common type of cancer worldwide [1] and the sixth leading cause of cancer-related death in 2020 [2]. According to GLOBOCAN 2020, the agestandardized incidence rate (ASR) of EC was 9.3 per 100,000 in men and 3.6 per 100,000 in women [2]. Eastern Asia, eastern Africa, and southern Africa have shown the highest ASRs. In Eastern Asia, the ASR was 18.2 per 100,000 in men and 6.8 per 100,000 in women in 2020 [2]. In Taiwan, the ASR of EC has also been high. During the past thirty years, the ASR has increased substantially from 4.88 per 100,000 in 1985 to 23.83 per 100,000 in 2019 in Taiwan. EC can be histologically divided into two main types: esophageal squamous cell carcinoma (ESCC) and esophageal adenocarcinoma (EAC) [3]. ESCC has long been the most prevalent type in the world. However, there is a difference between developed and less developed countries. EAC has shown an increasing trend and is now the predominant type of EC in the USA and other Western countries [3]. In less developed countries or regions, such as Kenya or Linxian in China, ESCC still has a higher incidence rate [4,5]. These results could be explained by the distinctive risk factor profiles in different countries.
ESCC and EAC each have their own risk factors. Cigarette smoking, alcohol consumption, and betel nut use have been regarded as risk factors for ESCC. For EAC, the risk factors include smoking, obesity, and gastroesophageal reflux disease (GERD) [3,6]. In developed countries, such as the USA, the Netherlands, and the United Kingdom, the growing incidence of EAC is probably due to the increasing prevalence of obesity and GERD [1,3,7]. In less developed countries, the high incidence of smoking, alcohol consumption, hot tea consumption, a poor diet, and betel quid chewing could explain why ESCC is still the predominant type [8].
In Taiwan, ESCC is the major type of EC. From 1979 to 2003, the incidence of ESCC significantly increased, whereas the incidence of EAC leveled off. These trends may be associated with changes in the prevalence of risk factors in Taiwan, including smoking, alcohol consumption, and betel nut chewing [7]. In addition to the traditional risk factors mentioned above, emergent risk factors, such as obesity and Helicobacter pylori (H. pylori) infection [9], may also influence the trends.
In our study, the aim was to describe the trends of ESCC and EAC from 1985-2019 by an age-period-cohort model and the trends of the risk factors to explore the relationship between the risk factors and the incidence rates of ESCC and EAC.
Study Design and Data Source
We conducted an observational study of patients diagnosed with ESCC and EAC from 1985 through 2019 according to the Taiwan Cancer Registry (TCR) and analyzed the correlation between ESCC, EAC, and their risk factors using data obtained from the Taiwan Tobacco and Liquor Corporation [10] and the Health Promotion Administration [11]. The TCR is a nationwide population-based registration system that provides critical data related to cancer in Taiwan. Every case of cancer must be registered by law [12]. The completeness of the TCR data was 92.8% in 2002 and increased to 99.29% in 2019 [13,14]. The biopsy rates of EC in men and women were 99.47% and 98.45%, respectively, in the 2019 cancer registry annual report. The sex-age-specific population data in Taiwan consumed alcohol during 1971-1996 was those over 18 years old who smoked more than three cigarettes per day on average and those over 18 years old who drank more than half a bottle of 0.6 L per month on average, respectively.
Statistical Analysis
The age-specific incidence rates for women and men by calendar period and birth cohort were calculated. The age, calendar period, and birth cohort were divided into 5-year groups, with 18 (0-4, 5-9, 10-14 . . . 85-89), 7 (from 1985-1989, 1990-1994 . . . 2015-2019) and 24 groups (1900-1904, 1905-1909, 1910-1914 . . . 2015-2019), respectively. Age-adjusted incidence rates were calculated using the WHO 2000 standard population. Annual percentage change (APC) and average annual percentage change (AAPC) were conducted through Joinpoint Regression program (Version 4.9.1.0) [15]. 95% confidence interval and p values were provided. Age-period-cohort modeling, which was used to estimate the period and cohort effect of ESCC and EAC [16], was conducted using a web tool of the National Cancer Institute. Input data were cases in age groups between 41 and 80, periods between 1985-1989 and 2015-2019 and cohorts between 1905 and 1974. Period and cohort effects are presented as incidence rate ratios. The Spearman's correlation coefficient was used to analyze the correlation between the prevalence of risk factors, including smoking and alcohol drinking, in 1971-1982 and the incidence of EC, including ESCC and EAC for the period 2006-2017. The time lag between the risk factors and alcohol drinking is considered 35 years [6,[17][18][19]. This study was approved by the Institutional Review Board of Fu-Jen Catholic University (C107034).
Results
From 1985-1989 to 2015-2019, the incidence of EC in men increased dramatically (5.82 to 14.53 per 100,000) with an AAPC of 3.5% (95% CI = 2.3-4.6, p < 0.001), while the incidence of EC in women increased slightly but also significantly (0.7 to 0.97 per 100,000) with an AAPC of 0.8% (95% CI = 0.4-1.2, p < 0.01) ( Table 1 and Figure 1). The incidence rate of EAC in men changed from 0.35 to 0.47 per 100,000, with an AAPC of 1.20% (95% CI = 0.9-1.5, p < 0.001). The incidence rate of EAC in women remained relatively stable. Table 1 and Figure 1). The trend of ESCC in men showed a statistically significant increase (4.29 to 13.49 per 100,000) from 1985-1989 to 2015-2019, with an AAPC of 4.20% (95% CI = 3.1-5.4, p < 0.001), while the incidence rate of ESCC in women increased to a lesser degree from 1985-1989 to 2015-2019 (0.48 to 0.82 per 100,000), with an AAPC of 1.70% (95% CI = 1.4-2.1, p < 0.001) ( Table 1 and Figure 1). The numbers and 95% confidence interval of the incidence rates of EC, ESCC, and EAC were shown in Table S1. Age-adjusted incidence rates (per 100,000) Calendar year EC in men EC in women EAC in men EAC in women ESCC in men ESCC in women For different age groups, the incidence of ESCC in men increased as the calendar period progressed (Figure 2a). In the 50-54 age group, the incidence rate was 16.04 in 1985-1989, and it increased to 32.83 in 2005-2009 (p < 0.001), which means that the incidence rate in the same age group was higher in later periods. The age-specific incidence rate of ESCC in women remained relatively stable as the calendar period progressed ( Figure 2b and Table S2), except for the age groups 45-49 and 50-54, in which the incidence increases from 0.46 to 1.44 (APC = 5.6, 95% CI = 1.8-9.6, p = 0.01) and 0.6 to 2.22 (APC = 5.0, 95% CI = 3.7-6.4, p < 0.001), respectively. In the 75-79 age group, the incidence rate was down from 1985-1999 to 2015-2019 with APC was −3.2 (95% CI = −4.6 to −1.8, p = 0.01). The incidence rate of ESCC in women increased as age increased. The age-specific incidence rate of EAC in men slowly increased as the calendar period progressed (Figure 2c), in age groups 40-44, 45-49, 50-54, and 60-64 the APC was 3.6 (95% CI = 0.5-6.8), 5.2 (95% CI = 0.3-10.3), 3.5 (1.1-5.9) and 1.6 (95% CI = 0.5-2.8) during 1895-2019, respectively (Table S3). The incidence rate of EAC in men increased as age increased. The incidence rate of EAC in women remained stable as the calendar period progressed (Figure 2d). The incidence of EAC in women increased as age increased. AAPC and 95% confidence interval in Figure 2a-d was presented in Tables S2 and S3. incidence rate was down from 1985-1999 to 2015-2019 with APC was −3.2 (95% CI = −4.6 to −1.8, p = 0.01). The incidence rate of ESCC in women increased as age increased. The age-specific incidence rate of EAC in men slowly increased as the calendar period progressed (Figure 2c), in age groups 40-44, 45-49, 50-54, and 60-64 the APC was 3.6 (95% CI = 0.5-6.8), 5.2 (95% CI = 0.3-10.3), 3.5 (1.1-5.9) and 1.6 (95% CI = 0.5-2.8) during 1895-2019, respectively (Table S3). The incidence rate of EAC in men increased as age increased. The incidence rate of EAC in women remained stable as the calendar period progressed (Figure 2d). The incidence of EAC in women increased as age increased. AAPC and 95% confidence interval in Figure 2a-d was presented in Tables S2, S3. The incidence of ESCC in men increased as the birth cohort period increased (Figure 3a). The increasing gradients were larger in age groups from 45 to 64 than in the older and younger groups. From age 45 to 49, 1940-1969, the incidence rate increased from 3.32 to 32.04. From age 50 to 54, 1935-1964, the incidence rate increased from 9.17 to 44.51. From age 55 to 59, 1930-1964, the incidence rate increased from 13.82 to 55.62. The incidence rate of ESCC in women remained relatively stable as the birth cohort changed (Figure 3b). However, there was a slight increase in the birth cohort from 1950-1964. In the 45-49, 50-54, and 55-59 age groups, the incidence rate increased from 0.18 to 0.59, 0.21 to 0.40, and 1.51 to 2.22, respectively, during 1950-1964. The incidence of EAC in men remained relatively stable as the birth cohort changed (Figure 3c). An increasing trend was observed between 32.04. From age 50 to 54, 1935-1964, the incidence rate increased from 9.17 to 44.51. From age 55 to 59, 1930-1964, the incidence rate increased from 13.82 to 55.62. The incidence rate of ESCC in women remained relatively stable as the birth cohort changed (Figure 3b). However, there was a slight increase in the birth cohort from 1950-1964. In the 45-49, 50-54, and 55-59 age groups, the incidence rate increased from 0.18 to 0.59, 0.21 to 0.40, and 1.51 to 2.22, respectively, during 1950-1964. The incidence of EAC in men remained relatively stable as the birth cohort changed (Figure 3c). An increasing trend was observed between 1935 and 1964. The case numbers were small in the 70-74 and 75-79 age groups, resulting in larger fluctuations in the trends. The incidence of EAC in women remained relatively stable as the birth cohort changed (Figure 3d). The case numbers were so small that larger fluctuations of the trends were observed in the figure. The results of the age-period-cohort analysis are shown in Figure 4. In ESCC in men, the age effect increased, the rate ratio of the period effect increased from 0.39 to 1.22 from The results of the age-period-cohort analysis are shown in Figure 4. In ESCC in men, the age effect increased, the rate ratio of the period effect increased from 0.39 to 1. 1985-1989 to 2015-2019, and the cohort effect increased prominently during the birth years 1950-1969. The cohort effect in 1969 was 5.95 times higher than that in 1944 ( Figure 4a-c). In ESCC in women, the age effect increased, the rate ratio of the period effect increased from 0.65 to 1.26 from 1985-1989 to 2015-2019, and the cohort effect increased prominently during the birth years 1950-1969. The cohort effect in 1969 was 4.63 times higher than that in 1944 (Figure 4d-f). In EAC in men, the age effect increased, the rate ratio of the period effect increased from 0.60 to 0.97 from 1985-1989 to 2015-2019, and the cohort effect increased during birth years 1950-1974. The cohort effect in 1974 was 4.84 times higher than that in 1944 (Figure 4g-i). In EAC in women, the age effect was increased. The rate ratio of the period effect increased from 0.64 to 1 during 1985-2004 and decreased to 0.46 in 2015-2019. A cohort effect was not observed for EAC in women (Figure 4j-l). Supplementary Figures S1, S2 show the prevalence of smoking and alcoh consumption during 1971-1982 together with the incidence of ESCC and EAC in 200 2017. The prevalence of smoking in men was high from 1971 to 1990 (58.48% to 59.41% and then decreased significantly from 1992 to 2016 (57.86% to 28.60%) (Figure S1a,c). T prevalence of smoking in women remained stable from 1971 to 1982 (4.25% to 4.22% decreased from 1982 to 1986 (4.22% to 2.32%), increased from 1986 to 2002 (2.32% 5.30%), and then decreased from 2002 to 2016 (5.30% to 3.80%) (Figure S1b,d). Regardi alcohol consumption ( Figure S2b,d), the prevalence in men increased from 1971 to 19 and then decreased from 1990 to 2017 (Figure S2a,c); in women, the prevalence increas Supplementary Figures S1 and S2 show the prevalence of smoking and alcohol consumption during 1971-1982 together with the incidence of ESCC and EAC in 2006-2017. The prevalence of smoking in men was high from 1971 to 1990 (58.48% to 59.41%) and then decreased significantly from 1992 to 2016 (57.86% to 28.60%) (Figure S1a,c). The prevalence of smoking in women remained stable from 1971 to 1982 (4.25% to 4.22%), decreased from 1982 to 1986 (4.22% to 2.32%), increased from 1986 to 2002 (2.32% to 5.30%), Cancers 2022, 14, 5844 10 of 13 and then decreased from 2002 to 2016 (5.30% to 3.80%) ( Figure S1b,d). Regarding alcohol consumption ( Figure S2b,d), the prevalence in men increased from 1971 to 1990 and then decreased from 1990 to 2017 ( Figure S2a,c); in women, the prevalence increased from 1971 to 2017 (Figure S2b,d).
Discussion
By extracting data from the TCR, the 35-year trends of EC, ESCC and EAC, were analyzed in this study. The results show that the incidence rate of ESCC in men increased from 4.29 to 13.49 per 100,000 from 1985-1989 to 2015-2019 with an AAPC of 4.2% (p < 0.001), while that of ESCC in women increased from 0.48 to 0.82 per 100,000 with an AAPC of 1.7% (p < 0.001). The incidence rate of EAC in men changed from 0.35 to 0.47 per 100,000 from 1985-1989 to 2015-2019, with an AAPC of 1.20% (p < 0.001), while that of EAC in women remained relatively stable (0.06-0.06 per 100,000) from 1985-1989 to 2015-2019 with an AAPC of 0.2% (p = 0.56). Significant correlations were found between the risk factors and ESCC. The correlation coefficients between the prevalence of smoking and the incidence rates of ESCC and EAC in men were 0.81 (p = 0.02) and 0.12 (p = 0.77), respectively, and those between the prevalence of alcohol consumption and the incidence rates of ESCC and EAC in men were 0.83 (p = 0.02) and −0.10 (p = 0.82), respectively.
ESCC accounts for most of cases of EC in the world, with the highest incidence rates in sub-Saharan Africa, central Asia, and east Asia. However, the incidence of ESCC has declined continuously since the 1980s, while that of EAC has increased rapidly [1,[20][21][22][23]. In our study, the incidence of ESCC increased from 1985 to 2019, and the peak incidence occurred in younger generations. The possible etiology may be attributed to smoking [24,25], alcohol consumption [24][25][26], and betel nut chewing [27]. The combined effect of these three risk factors accounted for 83.7% of the attributable fraction of EC in ESCC patients [28]. Given that smoking, alcohol consumption, and betel nut chewing are the three main risk factors for ESCC in Taiwan, the increased birth-cohort effect of ESCC may be explained by changes in the prevalence of these risk factors. The prevalence of smoking and alcohol consumption in men were shown in Figures S1a and S2a, which coincide with the trend of ESCC in men if people started to smoke at about 20 years old [29]. In addition to the birthcohort effect caused by the risk factors, the high incidence in men may also be explained by a higher prevalence of the ALDH2*2 allele in Han Chinese individuals and a higher level of tobacco use and alcohol consumption [17,30]; additionally, the odds ratio of ESCC has been reported to be higher in people with the ALDH2*2 allele if they have higher levels of tobacco use or alcohol consumption [19]. For women, Tai et al. reported that smoking and alcohol consumption, particularly heavy drinking, are the major risk factors for ESCC in Taiwanese women [18]. The smaller increase in the cohort effect of ESCC in women than men may be due to the following: (1) The prevalence of smoking and alcohol consumption in women was lower than that in men. (2) The odds ratio of smoking was higher in men than in women (men: 4, women: 2.7) [6]. (3) Alcohol intake can interact with tobacco use to increase the risk of ESCC in a multiplicative way [19]. A higher prevalence of smoking and alcohol consumption in men may result in a higher incidence of ESCC in men than that of smoking or alcohol consumption alone.
The increased birth-cohort effect of EAC was only observed in men from 1950-1974. The major risk factors for EAC are smoking, GERD, and obesity, while H. pylori infection is a protective factor. The relative risk of EAC has been found to be 1.85 for ever vs. never smokers [31]. The prevalence of GERD in patients who underwent referral endoscopies increased from 3.4% to 12.4% from 2000 to 2007 [32]. GERD has become a common disorder in Taiwan [33]. The prevalence of obesity has increased significantly in recent decades in Taiwan. In adults, the prevalence of overweight and obesity in men increased from 22.9 to 28.9 and 10.5 to 15.9, respectively, during 1993-2001. However, the prevalence of overweight and obesity in women decreased from 20.3 to 18.7 and 13.7 to 10.7, respectively, during 1993-2001 [34]. The prevalence of H. pylori infection increased from 54.4% to 68.3% during 1992-1999 and decreased to 39.2% by 2004. The national policy for the eradication of H. pylori and improvement of hygiene and economics may explain its decreased prevalence [4]. According to the trends above, the increased cohort effect in men rather than women may be due to (1) the increased prevalence of smoking in men during 1971-1984 ( Figure S1c), whereas the prevalence in women had a stable or slightly declining trend during that period ( Figure S1d), and (2) the increased prevalence of obesity in men but not in women. The increased prevalence of GERD and decreased prevalence of H. pylori infection after 1999 may be related to an increasing trend in EAC in the future.
Besides the risk factors mentioned above, the increased trends of ESCC and EAC also partly result from the increased period effect of ESCC in men, ESCC in women, EAC in men, which may be associated with gradual improvements in early detection and endoscopic screening [35], increased convenience of seeking medical care, and increased health awareness, resulting from the National Health Insurance founded in 1995 [5,36]. Similarly, higher incidence of EAC in areas in China may be associated with more health care and early detection, and hence more diagnoses recently [37,38].
The strength of this study lies in the fact that we described the long-term trends of ESCC and EAC in Taiwan from 1985 to 2019 and analyzed them by age-period-cohort modeling. The EC data were extracted from the TCR, which is a population-based registry.
As the TCR has a high degree of completeness and accuracy, our data have credibility. In addition, the EC data include the earliest registered cases to the latest cases (1985-2019), which represents the most extensive data set in a publicly accessible database in Taiwan. Although our study lacks individual cancer risk factor data, which impeded direct analyses between the incidence rates of EC and the prevalence of risk factors from the perspective of individuals and may have led to an ecological fallacy, we analyzed the correlation between the long-term trends of risk factors and EC considering a time lag of 35 years. Additionally, the data on the risk factors were from government studies based on population surveys in Taiwan that generally reflect the actual prevalence of the exposure. Other potential confounders were not included in this study, such as obesity, consumption of fresh fruits and vegetables, and good nutritional status, but the importance of smoking, alcohol consumption, and betel nut chewing was greater than that of the other factors.
We suggest that early detection should be conducted strictly [39,40], especially in high-risk patients who have the risk factors mentioned in our study. Prevention is also important, especially in the younger population. Avoiding risk factors, such as by making lifestyle changes, quitting smoking, reducing alcohol and hot beverage intake, and eating more vegetables, should be broadly advocated.
Conclusions
In conclusion, we described the 35-year trends of EC, including ESCC and EAC. The incidence rate of ESCC in men substantially increased with statistical significance during 1985-2019. In addition, the increase incidence could be seen in ESCC in women and EAC in women. Increased period effects were observed for ESCC in both women and men and EAC in men. An increased birth-cohort effect was observed, which can be explained by the secular trends of their risk factors, such as smoking, alcohol consumption. Table S1: Values of ageadjusted incidence rates of esophageal cancer (EC), esophageal squamous cell carcinoma (ESCC), and esophageal adenocarcinoma (EAC) by sex in Taiwan for the period 1985-2019; Table S2: Annual percent change (APC) and average annual percent change (AAPC) in ESCC over time, by sex and age. Table S3: Annual percent change (APC) and average annual percent change (AAPC) in EAC over time, by sex and age.
|
v2
|
2022-12-25T05:12:18.394Z
|
2022-11-27T00:00:00.000Z
|
255059889
|
s2orc/train
|
Targeting the DNA Damage Response Machinery for Lung Cancer Treatment
Lung cancer is considered the most commonly diagnosed cancer and one of the leading causes of death globally. Despite the responses from small-cell lung cancer (SCLC) and non-small cell lung cancer (NSCLC) patients to conventional chemo- and radiotherapies, the current outcomes are not satisfactory. Recently, novel advances in DNA sequencing technologies have started to take off which have provided promising tools for studying different tumors for systematic mutation discovery. To date, a limited number of DDR inhibition trials have been conducted for the treatment of SCLC and NSCLC patients. However, strategies to test different DDR inhibitor combinations or to target multiple pathways are yet to be explored. With the various biomarkers that have either been recently discovered or are the subject of ongoing investigations, it is hoped that future trials would be designed to allow for studying targeted treatments in a biomarker-enriched population, which is defensible for the improvement of prognosis for SCLC and NSCLC patients. This review article sheds light on the different DNA repair pathways and some of the inhibitors targeting the proteins involved in the DNA damage response (DDR) machinery, such as ataxia telangiectasia and Rad3-related protein (ATR), DNA-dependent protein kinase (DNA-PK), and poly-ADP-ribose polymerase (PARP). In addition, the current status of DDR inhibitors in clinical settings and future perspectives are discussed.
Introduction
Lung cancer is considered one of the commonest malignancies that account for a high rate of mortality. In 2018, global statistics revealed that approximately over two million new cases of lung cancer were diagnosed [1]. Histologically, lung cancer is classified into two types: non-small cell lung cancer (NSCLC) and small cell lung cancer (SCLC) [2]. Internal factors such as reactive oxygen species (ROS), methylating agents, hydrolytic deamination, and lipid peroxidation-derived aldehydes, as well as external factors such as ultraviolet (UV) light, ionizing radiation, chemicals, and toxins, are in constant interaction with the human genome [3]. The genotoxic stress resulting from various cellular processes (e.g., cellular replication and transcription) is also considered as an endogenous damaging agent [4]. It is well known that radiotherapy plays a crucial role in the treatment of advanced and inoperable NSCLC [5]. However, radio-resistance is a serious challenge that started to limit radiotherapy's clinical benefits. Researchers have extensively studied the various mechanisms that may have the potential to cause radiotherapeutic resistance [6]. However, tumor heterogeneity along with other factors limited the exact identification of the mechanisms causing radiotherapeutic resistance [7]. Despite the discovery of new promising targeted therapies, there is not yet an effective treatment due to the overall low survival percentage that is to date reported as 17% [8]. Surgery, followed by adjuvant chemo and/or radiotherapy (RT), is currently the most effective treatment option; however, this treatment can only be given to patients with no metastasis [9]. Therefore, as the majority of lung Almost all of the SCLC cases have either homozygous loss or inactivated RB1, which is responsible for the regulation of the G1-S cell cycle checkpoint, and tumor protein 53 (TP53), which is crucial for multiple DDR pathways [33]. This remarkable sensitivity of SCLC to DNA damage proposes an attractive strategy for inhibiting the DNA repair pathways involved in SCLC, and can significantly enhance the efficacy of the currently available therapies [34].
Homologous Recombination (HR) Pathway
Homologous recombination is a process through which the DNA is correctly replicated and ensures that detrimental mutation-induced damage does not occur [35]. The HR pathway has been reported to play a crucial role in developing chemotherapeutic resistance in lung adenocarcinoma. This pathway has also been reported to serve a crucial role in the DSBs repair along with NHEJ. Figure 1 represents the HR-mediated DSBs repair [36]. (HR). The scheme explains the mechanism through which cells repair the damage resulting from the formation of a DSB that is displayed in purple lines. As shown in the first step, cells either repair the damage through HR or NHEJ pathways. (A) This choice of any of the two pathways is usually mediated by different factors; the BRCA1 promotes the HR pathway whereas 53BP1, RIF1, and the shieldin complex promote NHEJ. (B) In the second step, a resection by the MRN (MRE11-RAD51-NBS1) complex, CtIP, EXO1, BLM, as well as DNA2 creates 3′ ssDNA overhangs, coated by the trimeric replication protein A (RPA) which is displayed as a complex of green circles. During canonical homologous recombination, RPA undergoes displacement by RAD51 which is displayed as a complex of red circles. An alternative approach is also displayed where RAD51-independent repair may occur through single-strand annealing, which ends up with both the DNA ends ligated together. (C) In the third step, regulation of the RAD51 filament formation by BRCA2, PALB2, and the RAD51 paralogs takes place. Simultaneously, RAD51 is negatively regulated by FBH2 and Figure 1. Schematic representation of double-strand break repair by homologous recombination (HR). The scheme explains the mechanism through which cells repair the damage resulting from the formation of a DSB that is displayed in purple lines. As shown in the first step, cells either repair the damage through HR or NHEJ pathways. (A) This choice of any of the two pathways is usually mediated by different factors; the BRCA1 promotes the HR pathway whereas 53BP1, RIF1, and the shieldin complex promote NHEJ. (B) In the second step, a resection by the MRN (MRE11-RAD51-NBS1) complex, CtIP, EXO1, BLM, as well as DNA2 creates 3 ssDNA overhangs, coated by the trimeric replication protein A (RPA) which is displayed as a complex of green circles. During canonical homologous recombination, RPA undergoes displacement by RAD51 which is displayed as a complex of red circles. An alternative approach is also displayed where RAD51-independent repair may occur through single-strand annealing, which ends up with both the DNA ends ligated together. (C) In the third step, regulation of the RAD51 filament formation by BRCA2, PALB2, and the RAD51 paralogs takes place. Simultaneously, RAD51 is negatively regulated by FBH2 and RECQL5. (D) In the fourth step, RAD51-mediated homology search and strand invasion occurs, which is regulated by the RAD51 paralogs and RAD54A,B. At the same time, RAD51-mediated D loops are negatively regulated by RTEL and FANCM. (E) In the fifth step, the missing information from the homologous template is copied by DNA polymerases as displayed in turquoise. (F) In this step, the D loop undergoes displacement, and the DNA is resolved into a non-crossover product during synthesisdependent strand annealing (SDSA). (G) Dissolution and resolution of the DNA intermediates may occur if there is a heteroduplex extension and a double Holliday junction formed by second-end capture. (H) Non-crossover products result from dissolution, (I) and both crossover and non-crossover products result from resolution [36].
Since the HR pathway applies an error-free repair depending on the DNA homologous strand, it is activated during the cell cycle stages, G0/G1, G1, G2, and S. Sister chromatids at the G2 and S stages are used as a template by this pathway. Moreover, DNA lesions occurring at the replication forks in response to anticancer agents are also considered substrates of the HR repair pathway [37]. For instance, cisplatin and PARP inhibitors have been reported to be more effective on tumors with a defective HR pathway [10]. Many pieces of evidence have been shown to support a distinctive role for ATM in HR, and many HR factors such as BLM gene, breast cancer gene 1 (BRCA1), Nijmegen breakage syndrome 1 (NBS1), carboxy-terminal interacting protein (CtIP), and meiotic recombination 11 (MRE11), are labeled as ATM substrates [38]. It has been reported that cells that carry homozygous ATM kinase-dead mutations show reduced HR expression, and as a consequence, are more sensitive to PARP inhibition, topotecan, and mitomycin C [39]. Homologous recombination deficiency (HRD) is considered common in many cancers and has been shown to lead to an impairment in DNA repair, and hence causes malignancy [40]. Recent studies have investigated HRD in different forms of lung cancers. Diossy et al. have identified a group of lung adenocarcinomas associated with HRD, without losing the key homologous recombination genes BRCA1 and BRCA2. Results have shown that some HR-deficient cancers have an enhanced response to PARP inhibitors as well as to platinum-based chemotherapies; thus it has been concluded that HRD can be considered a biomarker for the responses of these drugs [41]. In other studies, mutations in the BRCA1/2 genes were detected in 5-10% of NSCLC cases [42], which harbor multiple DNA damage checkpoint genes mutations [43]. However, it is still unknown how often these mutations can lead to the HR pathway inactivation in lung cancer. Thus, in order to assess that, an analysis of DNA profiles extracted from the next-generation sequencing data needs to be generated for NSCLC cases [44]. In a recent study, various mutational signatures associated with HRD were derived from whole-genome and whole-exome sequencing data in lung squamous carcinoma and lung adenocarcinoma cases from the cancer genome atlas (TCGA). The results revealed that a group of the cases examined, with and without the presence of biallelic loss of either BRCA1 or BRCA2, showed good signs of HRD. Moreover, HRDassociated mutational signatures have also shown elevated sensitivity to PARP inhibitors in lung cancer cell lines. As a consequence, PARP inhibition therapy may be beneficial in HRD-associated lung cancer cases [45]. In a recent study, it has been demonstrated that a reduced expression of BRCA1 may be a predictor of a better outcome in patients with lung cancer [46]. Thus, depending on the value of BRCA1 expression predicted, the low expression of BRCA1 has been used as a biomarker in NSCLC patients in a Trabectedin clinical trial [47]. However, it was shown later that a low expression of BRCA1 or excision repair cross complementation group 1 (ERCC1) was remarkably associated with good outcomes [48]. On the other hand, the data concerning how mutations or expression of BRCA2 affect the treatment outcomes of patients with lung cancer is still unknown. In summary, more detailed mechanistic studies to investigate these genes in lung cancer are still required in order to involve them in targeted therapies [41]. In a study conducted recently, mutation data in over 1900 samples were analyzed in NSCLC and SCLC cells, and studies proved the HR genes to be highly mutated in both NSCLC and SCLC cancer patients. Results have shown an alteration in the HR genes in 30% of the total lung cancers. These data have suggested that HR genes are often mutated in lung cancer, and targeting lung cancers with HRD is relevant in clinical settings [45]. Nevertheless, HR-associated gene expression has also been linked to the response to RT. For example, an elevated RAD51, NBS, and XRCC3 expression have been shown to cause radio-resistance, whereas reduced expression of XRCC2 causes radiosensitivity [49]. Furthermore, recent studies have investigated the genetic polymorphisms that lead to HRD, and have shown that in response to IR, the single nucleotide polymorphisms in RAD51 and XRCC2 can be considered prognostic factors for the overall survival in NSCLC [50]. A recent study has reported that mutations in BRCA1/2 genes occur in~2.1% of advanced NSCLC patients [51]. Additionally, in an analysis where more than 100 HR genes were tested, it has been shown that approximately 5% of the total NSCLC cases cause biallelic alterations in an identified HR target gene [52]. In conclusion, inhibiting the HR target is considered promising for identifying most of the HR-proficient NSCLC cases, and hence may enhance the RT beneficial effects [53].
Non-Homologous End Joining (NHEJ) Pathway
NHEJ is one of the pathways involved in the DNA DSBs-repairing mechanism. NHEJ can efficiently have a role in all cell cycle phases and allows tumor cells to become resistant to chemotherapeutic drugs [54]. This pathway has five fundamental components, as shown in Figure 2 [55]. In several studies, it has been demonstrated that inhibiting the NHEJ pathway leads to a significant reduction in the resistance against chemotherapeutic drugs. These studies have also acknowledged DNA-PKcs to be the primary target for blocking the NHEJ pathway's activity due to its central role, as shown in Figure 2, which represents the DSBs repair pathway of the NHEJ [54,[56][57][58]. in lung cancer, and targeting lung cancers with HRD is relevant in clinical settings [45]. Nevertheless, HR-associated gene expression has also been linked to the response to RT. For example, an elevated RAD51, NBS, and XRCC3 expression have been shown to cause radio-resistance, whereas reduced expression of XRCC2 causes radiosensitivity [49]. Furthermore, recent studies have investigated the genetic polymorphisms that lead to HRD, and have shown that in response to IR, the single nucleotide polymorphisms in RAD51 and XRCC2 can be considered prognostic factors for the overall survival in NSCLC [50].
A recent study has reported that mutations in BRCA1/2 genes occur in ~2.1% of advanced NSCLC patients [51]. Additionally, in an analysis where more than 100 HR genes were tested, it has been shown that approximately 5% of the total NSCLC cases cause biallelic alterations in an identified HR target gene [52]. In conclusion, inhibiting the HR target is considered promising for identifying most of the HR-proficient NSCLC cases, and hence may enhance the RT beneficial effects [53].
Non-Homologous End Joining (NHEJ) Pathway
NHEJ is one of the pathways involved in the DNA DSBs-repairing mechanism. NHEJ can efficiently have a role in all cell cycle phases and allows tumor cells to become resistant to chemotherapeutic drugs [54]. This pathway has five fundamental components, as shown in Figure 2 [55]. In several studies, it has been demonstrated that inhibiting the NHEJ pathway leads to a significant reduction in the resistance against chemotherapeutic drugs. These studies have also acknowledged DNA-PKcs to be the primary target for blocking the NHEJ pathway's activity due to its central role, as shown in Figure 2, which represents the DSBs repair pathway of the NHEJ [54,[56][57][58]. Schematic representation of nonhomologous end-joining (NHEJ) repair pathway in mammalian cells. The scheme shows that following a DSB, Ku which has a high affinity to DNA ends binds to the DNA. This binding causes conformational changes allowing the DNA-PKcs to bind. Ku can also act as an alignment factor for NHEJ accuracy. Upon the formation of the DNA-PK assembly on DNA breaks, this complex causes activation of the serine/threonine protein kinase, and target substrates such as Artemis get phosphorylated, colocalizing at the ends of the broken DNA before end-processing and end-joining events [55]. Schematic representation of nonhomologous end-joining (NHEJ) repair pathway in mammalian cells. The scheme shows that following a DSB, Ku which has a high affinity to DNA ends binds to the DNA. This binding causes conformational changes allowing the DNA-PKcs to bind. Ku can also act as an alignment factor for NHEJ accuracy. Upon the formation of the DNA-PK assembly on DNA breaks, this complex causes activation of the serine/threonine protein kinase, and target substrates such as Artemis get phosphorylated, colocalizing at the ends of the broken DNA before end-processing and end-joining events [55]. In support of these findings, other studies have reported that higher DNA-PKcs protein has been highly expressed in patients with NSCLC, including adenocarcinoma. Particularly, mutations occurring in Ku80, which is a protein essential to NHEJ repair of DNA DSBs, as shown in Figure 2, have been considered a risk factor in the development of COPD in both humans and mice models [58]. Low levels of Ku80 have been observed in smokers who suffer from COPD, showing high levels of oxidative DNA damage (8-OHdG), which indicates a potential connection between exposure to cigarette smoke and low levels of DNA repair protein expression [59]. Mouse models that lack the Ku70 (XRCC6), which is an essential NHEJ protein, have been shown to develop both the structural and functional changes of COPD with age, and this has been shown to be associated with elevated apoptosis [60]. AKT1 is the main substrate of PI3K, which is responsible for stimulating the IR-induced DSB repair via DNA-PKcs-dependent NHEJ and Rad51-dependent HR. Studies have shown that nuclear localization as well as activation of AKT1 is mandatory for stimulating DSB repair. Therefore, AKT1 is required to induce an immediate expression and activation in the nucleus following IR to recruit DSB repair [61]. Recently, a study was conducted to investigate the subcellular distribution of AKT1 in NSCLC cell lines following IR and stimulation using HER ligands. The data indicated that AKT1 nuclear translocation is a slow process and is dependent on the activity of AKT. These results suggest that both the ionizing radiation (IR) and stimulation with HER family ligands cannot induce the nuclear translocation of AKT1. According to the key role that AKT1 plays in DSB repair, Patritumab, which is a HER3-neutralizing antibody, and the HER3-siRNA have been shown to reduce DSB repair in vitro [62]. Moreover, DDR studies have concluded that following IR or exposure to chemicals, human and mouse lung basal stem cells (BSCs) have a more efficient DNA repair using the NHEJ pathway when compared to alveolar progenitor cells, which has led to cell survival and proliferation [63]. Bioinformatic analysis has shown that lung squamous cell carcinomas (SqCCs) carry a transcriptional fingerprint of human lung BSCs, which suggests that BSCs may act as the original cells of this lung cancer subtype. In conclusion, data have shown that DNA repair that is susceptible to errors is considered a distinctive sign of lung SqCC and suggested that developing drugs that target the NHEJ pathway may prevent and/or treat lung SqCC [63].
Base Excision Repair (BER) Pathway
The BER mechanism is a DDR pathway that has also been shown to play a role in the chemotherapeutic drug resistance in lung adenocarcinoma. Figure 3 represents the base excision repair (BER) mechanism in mammalian cells [64].
The targeted damages of the DNA by this pathway include oxidative damages, depurination, alkylation as well as deamination, which are all necessary for the growth and development of mammalian cells [65]. When the BER pathways lose their function, severe diseases such as neurological disorders and cancers result [66]. Recent studies have demonstrated that inhibiting the BER pathway causes a significant reduction in chemotherapeutic drug resistance in various cancers, including lung cancer [67]. In NSCLC, a significant correlation between the chemotherapeutic drug resistance and the over-expression of XRCC1 protein has been reported [68]. Besides, EGFR tyrosine kinase inhibitors (EGFR-TKIs) are among the chemotherapeutics that are commonly used for the treatment of patients with advanced NSCLC adenocarcinoma [69]. Among the different mechanisms that have been suggested for the resistance against the EGFRTKIs is PI3K/AKT/mTOR pathway dysregulation [70]. EGFR-TKIs have been shown to exert their action by inhibiting the phosphorylation of Hsp70 and stimulating its ubiquitination in lung adenocarcinoma cells resulting in this protein's degradation. Hsp70 is essential in the BER pathway since it activates essential enzymes involved in this pathway, which are the APE1 and Pol β enzymes [10]. However, a study conducted recently showed that giving a low dose of erlotinib results in an EGFR T790M mutation on exon 20, which, as a consequence, causes resistance against EGFRTKIs in patients with lung adenocarcinoma. Thus, inactivating the BER pathway by deregulating the Hsp70 is considered critical to forming EGGR T790M mutation in lung adenocarcinoma cells [71]. Afatinib and sirolimus are drugs that are widely used for the treatment of NSCLC. These two drugs were given in combination in a study conducted by Dr. Rosell and colleagues to evaluate their efficacy in reversing acquired EGFR-TKIs resistance. The results have not been promising, noting that further clinical development is required [72]. Dacomitinib is an EGFR-TKIs inhibitor that has also been commonly used to treat patients with metastatic NSCLC [73]. Nevertheless, the BER pathway has also been shown to promote the survival and proliferation of lung cancer cells against organophosphate pesticides (OPP)-induced oxidative stress. In a recent study, it was reported that organophosphate pesticides (OPPs) can initiate oxidative damage in the DNA in an A549 lung adenocarcinoma model [64]. In conclusion, the role of the BER pathway in the development of resistance against chemotherapeutics for lung adenocarcinoma tumors has been illustrated in recent studies [66,67]. A non-helix distorting lesion is recognized by a monofunctional glycosylase that cleaves at the N-glucosidic bond, which releases the base. This creates an abasic site that is recognized by an AP endonuclease that creates a 5′ nick. This substrate is then processed by SP or LP repair. SP repair uses the lyase activity of pol β to remove the dRP moiety. Pol β extends 1 nt followed by DNA ligation by the DNA ligase III/XRCC1 complex. LP repair proceeds by pol β, δ, ε to extend ≥2 nts. The displaced DNA is cleaved by flap endonuclease followed by DNA ligation via the coordinated efforts of DNA ligase I and PCNA [64].
The targeted damages of the DNA by this pathway include oxidative damages, depurination, alkylation as well as deamination, which are all necessary for the growth and development of mammalian cells [65]. When the BER pathways lose their function, severe diseases such as neurological disorders and cancers result [66]. Recent studies have demonstrated that inhibiting the BER pathway causes a significant reduction in chemotherapeutic drug resistance in various cancers, including lung cancer [67]. In NSCLC, a significant correlation between the chemotherapeutic drug resistance and the over-expression of XRCC1 protein has been reported [68]. Besides, EGFR tyrosine kinase inhibitors (EGFR-TKIs) are among the chemotherapeutics that are commonly used for the treatment of patients with advanced NSCLC adenocarcinoma [69]. Among the different mechanisms that have been suggested for the resistance against the EGFRTKIs is PI3K/AKT/mTOR pathway dysregulation [70]. EGFR-TKIs have been shown to exert their Figure 3. A schematic illustration of the short patch and long patch base excision repair (BER) pathways in eukaryotic cells. A non-helix distorting lesion is recognized by a monofunctional glycosylase that cleaves at the N-glucosidic bond, which releases the base. This creates an abasic site that is recognized by an AP endonuclease that creates a 5 nick. This substrate is then processed by SP or LP repair. SP repair uses the lyase activity of pol β to remove the dRP moiety. Pol β extends 1 nt followed by DNA ligation by the DNA ligase III/XRCC1 complex. LP repair proceeds by pol β, δ, ε to extend ≥2 nts. The displaced DNA is cleaved by flap endonuclease followed by DNA ligation via the coordinated efforts of DNA ligase I and PCNA [64].
Nucleotide Excision Repair (NER) Pathway
The NER pathway is a major mechanism in the DDR machinery of mammalian cells that targets massive DNA damage extraction (Figure 4) [74]. This DNA damage is usually composed of nitrogenous bases that are sensitive to reactive oxygen species, UV light, electrophilic chemical mutagens, ionizing irradiation, and chemotherapeutic agents [75]. There are two main mechanisms through which this pathway functions depending on the location where the damage occurred. When the damage occurs on the genome's side that did not undergo active transcription, the global genome NER (GG-NER) mechanism is then recruited to fix the damage. Otherwise, the other mechanism, the transcriptioncoupled NER (TC-NER), is recruited [76]. It is well documented in the literature that platinum-based agents, such as cisplatin and carboplatin, are among the most important anti-cancer agents used for the treatment of NSCLC adenocarcinoma patients. These drugs exert their anti-proliferative action by causing DNA damage in cancer cells. Several computational and experimental studies have recently reported the involvement of the NER pathway as well as several related genes in the repair processes of DNA damage, in particular the platinum-based damage [77]. In addition, other studies have reported a significant increase in the ERCC1 expression levels for lung adenocarcinoma patients in particular [78]. Cetuximab is an anti-EGFR agent that is commonly used as a first-line treatment combined with cisplatin or docetaxel for the treatment of advanced NSCLC. Cetuximab exerts its action via the inhibition of the proliferation, invasion, and metastasis of lung cancer cells, in addition to stimulating apoptosis, which leads to high survival rates of NSCLC patients [79]. In a recent study carried out by Li and co-workers, it was reported that ERCC1 overexpression inhibited the activation of the EGFR and stimulated resistance in lung adenocarcinoma cells to the combined therapy of cetuximab and cisplatin [74]. In summary, the NER pathway can be considered one of the critical mechanisms in the DNA repair machinery that contributes to the development of chemotherapeutic drug resistance in lung adenocarcinoma patients [10]. In the GG-NER sub-pathway, the damage sensor XPC and the UV excision repair protein homolog B (RAD23B) and centrin 2 (CETN2) complex bind the non-damaged strand with the help of the UV-DDB complex, as shown in the second step. The binding of this complex to the damaged site dissociates the RAD23B from the complex, as displayed in the third step. In the TC-NER, the initiation of damage recognition is performed by the stalling of RNA polymerase II (Pol II). This stalled Pol II activates CSB, resulting in the formation of the Pol II-CSB complex, which serves as a platform for further recruitment of other repairing factors such as CSA and UVSSA-USP7. After recognizing the damage in the first three steps (step 1-3), the TFIIH complex is then recruited to the lesion in both the sub-pathways, along with XPA, RPA, and XPG, as shown in the fourth step. Following the verification of the DNA lesion, dual incisions occur resulting in the removal of the damage-containing DNA short fragment, which is then followed by the synthesis of a new DNA fragment, and the completion of the NER reaction by sealing the final nick by DNA ligase [74].
DDR Inhibitors for a Targeted Treatment of Lung Cancer
When genotoxic stress occurs, there are three phosphatidyl inositol 3-kinase-related protein kinases involved, although each one is activated by different types of injury [23]. ATM has been reported to show a response toward DNA-damaging agents, such as IR, which causes DSBs [80]. Both ATM and ATR kinase have been reported to detect alterations occurring in cell replication upon exposure to ultraviolet light (UV) [81]. Similar to the ATM, another signaling pathway, DNA-PK, has also been shown to be recruited in response to DSBs under certain cellular conditions, such as environmental carcinogens, IR exposure, and chemotherapeutic agents, as well as in cells that have shortened telomeres [82]. In the last decade, the discovery and development of promising DDR targeting agents have opened the door for more exciting avenues for the treatment of several cancers, and SCLC in particular [14]. Many recent studies have reported a high genetic expression of different DDR mediators such as CHK1, PARP, ATM, and ATR in patients with SCLC in comparison to normal lung cells and/or NSCLC cells [3,18,26,41,83,84]. In addition, a high-throughput (HT) small molecule screening has identified other DDR proteins, such as CHK1, to be further explored as candidate targets for treating SCLC patients [85]. Consequently, many DNA repair inhibitors have been recently developed and undergone evaluation in preclinical models as well as clinical trials as candidates for the treatment of SCLC. Although the recently developed DDR inhibitors, such as the PARP inhibitor Talazoparib, have shown promising activity as monotherapies when tested on SCLC models as well as on some patients [86], combining these agents with cytotoxic chemotherapies, other DDR targeting agents [6], or with immunotherapy is expected to have greater clinical responses as this may increase the number of patients responding as well as the duration of the response [87].
ATM/ATR Inhibitors
In the presence of DNA damage, both ATM and ATR have the ability to promote the modification of chromatin via inducing H2AX phosphorylation and hence form foci at the break sites. Following the phosphorylation of H2AX, a γ-H2AX is formed, which allows to the recruitment of other proteins required for the repairing mechanism [81]. ATM and ATR have been reported to have roles in the regulation of the Werner syndrome protein (WRN), which is implicated in the stalled replication fork recovery, hence limiting the fork collapse [88]. They have also been reported to act on BRCA-1, which acts as a scaffold facilitating the activation of the downstream substrates by ATM and ATR, which, when recruited, phosphorylate several substrates [89]. The principal downstream effectors of ATM and ATR are two kinases, CHK2 and CHK1, which transmit the signals to other molecules [82]. In the presence of extended ssDNA stretches with a coating of replication protein A (RPA), ATR is activated by interacting with ATR interacting protein (ATRIP). Once ATR is activated, phosphorylation and activation of multiple targets such as CHK1 take place to form the ATR-CHK1 complex. Upon stimulation, this complex repairs the damage by enforcing the halting of the progression of the cell cycle at the G2-M phase [90]. Recent preclinical observations have suggested that ATR inhibitors may show their activity in TP53 and/or ATM-deficient tumor models when compared to other tumor types [32]. On the other hand, ATM has also been reported to have a role in DNA DSB repair beyond its role in the regulation of p53-mediated apoptosis, and this role in repairing DSBs is through the HR pathway in particular, with an unclear role reported in the NHEJ pathway. In ATM-deficient tumors, DSB repair has been shown to mainly depend on the ATR/CHK1 axis [39]. Recent reports have investigated the activity of ATR inhibitors in both in vitro and in vivo models of SCLC [27]. Remarkably, the clinical results of these studies have been considered promising for further research into ATR inhibitors for the treatment of SCLC [23]. A recent study carried out to test the M6620 pre-treatment in DMS114 cells led to an 1.4-fold increase in TOP1-DPCs following treatment with topotecan for two hours. The results suggested a distinctive role of ATR in the clearance of TOP1 DPCs as well as in repairing TOP1-mediated DNA damage [91]. However, it is worth mentioning that neither the ATM inhibitor (KU55933) nor the DNA-PKcs inhibitor (VS984) has potentiated topotecan-generated TOP1-DPCs [91,92]. In another recent study, the ATRi Ceralasertib has been used along with RT on an NSCLC H460 mouse model. Results demonstrated a remarkable delay in tumor growth [93]. Likewise, ATRi Berzosertib has been shown to enhance the radiation effect in NSCLC brain metastasis patient-derived xenografts (PDXs) models. These findings have been shown to support the continuing clinical trials of Berzosertib combined with whole brain irradiation in NSCLC brain metastasis patients [27]. Nonetheless, Berzosertib has also been shown to enhance the in vivo tumor response to irinotecan, and no additional toxicity has been observed. These findings have provided a foundation for combining TOP1 inhibitor and ATRi in further clinical trials. Similarly, the results of phase I trials where Berzosertib has been combined with topotecan have revealed that this combination has been tolerable and most effective in platinum-refractory SCLC, which in other studies has been reported to have no response to topotecan alone [94]. Moreover, the ATRi Gartisertib has been reported to be significantly synergized with both topotecan and irinotecan in tumor XPD and organoid models derived from humans [95]. A combined therapy of TOP2 inhibitor etoposide and Ceralasertib is in Phase II trial as a candidate treatment for extensive stage SCLC [96]. In a study carried out in 2020 by Byers et al., a combination of AXL inhibitor and ATRi had a significant effect as it decreased the cell proliferation of NSCLC and large cell neuroendocrine carcinoma (LCNEC) cells [97]. As tabulated in Table 1, there are currently various clinical trials of ATM/ATR inhibitors as monotherapies or in combination with other chemotherapeutic drugs for the treatment of SCLS and NSCLC (https://clinicaltrials.gov/, accessed on 20 September 2022).
DNA-PK Inhibitors
As mentioned earlier, chemotherapeutic drugs such as etoposide and doxorubicin and radiotherapy cause DNA damage to exert their anticancer effect [98]. DNA-PK has a crucial role in DSB repair and thus is considered a promising target to treat various cancer types [99]. Many DNA-PK inhibitors with high potency have been recently developed, such as M3814 (Nedisertib), VX-984, and NU7427 [100]. Among all DNA-PK inhibitors, M3814 is an inhibitor with high potency and high selectivity that has been reported to have high activity in preclinical models [101]. Recent studies carried out on lung cancer xenograft models have reported a promising activity of M3814 combined with etoposide and cisplatin for the treatment of lung cancer [102]. Other studies have focused on the investigation of the PI3K-Akt-mTOR signaling cascade, and results have found that this signaling cascade has an essential role in NSCLC tumorigenesis, development, and progression [103,104]. The activation of PI3K-Akt-mTOR has been shown to participate in vital hallmarks of NSCLC, such as sustained cancer growth, resistance to apoptosis, cancer invasion, angiogenesis, metastasis as well as insensitivity to therapies. Therefore, this signaling cascade signifies the key therapeutic target for NSCLC [105][106][107]. The activation of the DNA-PK is seen to promote the repair of DNA damage and causes resistance to cell death by anti-cancer agents. CC-115 is an mTOR kinase blocker with high potency that has been recently discovered and shown to act by inhibiting the activation of mTORC1 and mTORC2. Recent preclinical studies have found that the dual inhibition of mTOR and DNA-PK achieved by CC-115 could have substantial activity in solid tumors [108][109][110][111]. In a recent study carried out by Zheng et al., CC-115 was reported to simultaneously block the activation of both the mTOR and DNA-PK as well as inhibiting the growth of renal cell carcinoma [108]. In addition, another study conducted by Burkel et al. reported that the dual inhibition of mTOR and DNA-PK by CC-115 stimulated melanoma cell death in addition to sensitizing radiation-induced anti-melanoma cell activity [109]. Nonetheless, Tsuji et al. recently reported that CC-115 blocked the DDR and inhibited the growth of ATM-deficient cancer cells [111]. A recent study carried out to test the safety and efficacy of using M3814 in synergy with paclitaxel and etoposide for the treatment of NSCLC has shown that targeting mTOR DNA-PK by CC-115 remarkably hindered the growth of NSCLC cells [83]. M3814 has been reported in other studies to potentiate the anti-cancer effect of both paclitaxel and etoposide in A549 and H460 human NSCLC cell lines. Additionally, tumor regression has also been observed in vivo at tolerated doses. M3814 chemotherapy combination has been shown to induce P53-dependent accelerated senescence of NSCLC cells, which has indicated a possible explanation for the anticancer effect of this therapeutic synergy [98,104]. A recent study has provided a theoretical basis for the use of M3814 and paclitaxel and etoposide combination clinically for optimized NSCLC treatment [112]. A lung cancer model that showed resistance towards Osimertinib has been established and shown to harbor the mutations in EGFR L858R and T790M. Results have revealed that the DDR has been compromised in cells that were resistant to Osimertinib, which indicates that DNA-PK is a key kinase that mediates NHEJ repair and enhances the cells' sensitivity to Osimertinib. These findings have also revealed an innovative molecular mechanism of Osimertinib resistance and suggested a rationale for combining different DNA-PK inhibitors for the treatment of NSCLC to overcome this acquired Osimertinib resistance [30]. A recent retrospective study on the relationship between the expression of PD-1 and PD-L1 which are immune checkpoints, and the DNA-PK, found a remarkable positive correlation in NSCLC patients [113]. In summary, further investigation is still required in order to clarify this correlation's significance and its effect on immunotherapy's effectiveness.
PARP Inhibitors
PARP inhibitors are a class of DDR inhibitors that hinder the repair of DNA and are reported to have anticancer effects [29]. In 2009, the first human clinical trial that used Olaparib as a PARP inhibitor documented the synthetic lethality interaction between this class of inhibitors and the mutations occurring in BRCA1/BRCA2 [114]. Recent studies have investigated the effect of PARP inhibitors in SCLC as it has been reported as sensitive to this class of inhibitors, which has led to further research to test PARP inhibitors as possible therapeutics for treating SCLC [13]. Typically, PARP inhibitors are mostly associated with BRCA1 or BRCA2 genetic mutations and are thought promising for the treatment of lung cancers; however, many other studies revealed that the application of PARP inhibitors is also anticipated to expand to other HR-deficient tumors, thus the discovery of novel biomarkers related to HR abnormalities is considered necessary [115]. Immune checkpoint blockade therapy is promising as a third-line therapeutic option, and its use in first-line therapy has recently been reported with a promising survival benefit, which makes it the new standard of care [115,116]. Typically, many hurdles stand in the way of treating SCLC as this cancer's biology presents many challenges that limit further therapeutic advances [117]. Additionally, drug resistance has recently begun to emerge; however, the mechanism of resistance is still unclear and is yet to be revealed [118]. As mentioned in previous sections, the SCLC type of lung cancer is considered to have a higher sensitivity to DNA-damaging chemotherapy as compared to NSCLC, accounting for much higher response rates [119]. Resonating this difference, a recent study carried out by Thomas and colleagues under which genomic sequencing of SCLC types was performed, found that the inactivation of RB1 and TP53 DDR regulators was extensive in SCLC [120].
Initially, PARP is considered a novel therapeutic target for the treatment of SCLC following a study carried out by Rudin et al. in which reverse phase protein array (RPPA) analysis of thirty-four SCLC and seventy-four NSCLC cell lines was conducted. The results of this proteomic analysis reported that in the case of SCLC cell lines, the PARP1 mean levels were 2.06-fold higher than NSCLC cell lines (p < 0.0001) [34]. In a study carried out by Owonikoko and colleagues, it was demonstrated that veliparib has low efficacy as a monotherapy in vitro when tested on a panel of a total of nine SCLC cell lines in preclinical settings. Unpredictably, veliparib was reported to enhance the cytotoxicity of carboplatin, cisplatin, and etoposide in SCLC cell lines. These data demonstrated that combining these drugs could promote higher inhibition of the growth of the tumor in SCLC PDX [121].
Similarly, another study recently demonstrated that a combination therapy of Olaparib (AZD2281) with cisplatin or etoposide could result in the death of the H82 and H69 cell lines in vitro [20]. In another study carried out by Rudin et al., using SCLC cell lines and patientderived xenograft (PDX) to test Talazoparib's efficacy, showed an in vitro synergistic effect with TMZ, with a high combinatorial efficacy degree in vivo [34]. Furthermore, two recent studies have demonstrated that combining either Veliparib or Olaparib with TMZ accounts for more promising results both in vivo and in vitro as compared to monotherapy [119,122]. A recent study carried out by Rudin et al. studied the effect of PARP inhibitors and RT sensitization on SCLC cells. This study investigated the efficacy and potency of a combination therapy Veliparib/Talazoparib and radiotherapy, and showed that Talazoparib exerted a more additive effects in vitro when given in a combination with radiotherapy than with veliparib. However, an in vivo experiment showed that Talazoparib has the ability to enhance the inhibitory effect of RT against the growth of tumor in SCLC PDXs that are resistant to chemotherapy [123]. Nonetheless, an ongoing randomized phase 1/2 study where a combination of carboplatin/etoposide with or without a high dose of veliparib found that cisplatin-etoposide with or without veliparib trial suggested a need for a biomarker selection strategy for the identification of patients who are more likely to benefit from this combination [124]. Table 2 summarizes the current clinical trials of PARP inhibitors as monotherapies or in combination with other chemotherapeutic drugs for the treatment of SCLS and NSCLC (https://clinicaltrials.gov/, accessed on 20 September 2022).
The Current Status and Future Perspectives
Investigating the genomics of SCLC and discovering new biomarkers is central for providing enhanced and more targeted treatment options [33]. Therefore, whole exome sequencing is believed to assist in the identification of these new targets and biomarkers. For instance, losing the TP53 and RB1 in SCLC has been shown to occur most frequently, thus resulting in replication and proliferation stress as well as early metastasis and a rapid development of chemotherapy resistance [125]. The clinical relevance of finding biomarkers for SCLC is dependent on the preferential targeting of multiple routes, drug combinations, or combining different treatment modalities. Recently, many preclinical studies have acknowledged predictive biomarkers that are responsive to DDR-targeted therapies in SCLC and NSCLC. Several proteins that are involved in this repairing machinery, including PARP, WEE1, ATM and ATR, and checkpoint kinase 1 (CHK1), were all considered attractive targets for the treatment of SCLC and NSCLC [23]. These promising targets have been shown to prevent the damaged cells or the cells that have an incompletely replicated DNA from entering into mitosis and therefore case suppression of the replication stress, and hence resulting in cell death [29,82,84,91,99,106,126]. Adavosertib (AZD1775) has been reported to have high selectivity and high potency as a WEE1 inhibitor when used as a monotherapy or combined with PARP inhibitors or other chemotherapeutic drugs [21]. Recent genomic sequencing has identified the Schlafen 11 (SLFN11), which is a predictive biomarker to predict the PARP inhibition sensitivity when used as a monotherapy for the treatment of SCLC [34]. The expression of SLFN11 is higher in SCLC and its expression has been shown to decrease remarkably following treatment with veliparib. Moreover, the treatment with TMZ has been reported with beneficial effects in patients with SCLC, particularly in a subgroup where the MGMT promoter methylation is present [127]. On the other hand, new strategies for testing different DDR-inhibitor combinations or targeting multiple pathways are yet to be explored [128]. In addition, the intra-tumor heterogeneity is an ongoing challenge in the targeted treatment of SCLC, and a strategy of blocking multiple routes of growth in order to block the growth of the tumor stands as a promising solution. Recent studies have found that co-targeting DDR proteins (i.e., PARP and CHK1) may increase the PD-L1 expression and enhance the anti-tumor immune response in SCLC [126]. Thus, a strategy where DDR targeting is combined with immunotherapy could also be promising.
In summary, with the various biomarkers that have either been recently discovered or are the subject of ongoing investigations, designing future trials is hoped to allow for studying targeted treatments in a biomarker-enriched population, which is defensible for the improvement of prognosis for SCLC patients [129].
Conclusions
In every cell cycle, damage to the genetic material (DNA) occurs, and each cell has its repairing machinery to deal with the damage [12]. In the case of tumor cells, the DNA damage is comparatively greater than the damage occurring in normal cells due to the use of chemotherapy and/or radiation, and the repairing system of DNA is usually inactive in tumor cells unlike normal cells [13]. Inhibiting a target that promotes the HR pathway is a promising approach to identifying most of the HRD-NSCLC cases, and hence may enhance the beneficial effects of RT [53]. Several drugs that target the proteins involved in DDR, such as ATM and ATR, DNA-PK, and PARP have been developed [16]. To date, a limited number of DDR inhibitor trials have included SCLC patients, although the data currently available points to good activity in a group of patients suffering from SCLC. In addition, novel biomarkers have started to emerge which may assist in the identification of SCLC subsets that are greatly vulnerable to specific DDR inhibitors [23]. Despite the low survival rates of SCLC, it is notable to be remarkably responsive to treatments that combine multiple DNA-damaging agents. This high sensitivity toward DNA-damaging agents may be due to the underlying genetics that drive the oncogenesis of SCLC [32]. In the last decade, the discovery and development of promising DDR targeting agents have opened the door for more exciting avenues for the treatment of several cancers, and SCLC in particular [14]. Although the recently developed DDR inhibitors such as the PARP inhibitor Talazoparib have shown promising activity as monotherapies when tested on SCLC models [86], combining these agents with cytotoxic chemotherapies, other DDR targeting agents [6], or with immunotherapy is expected to have greater clinical responses as this may increase the number of patients responding as well as the duration of the response [87]. Investigating the genomics of SCLC and discovering new biomarkers is central for providing enhanced and more targeted treatment options [33]. New strategies to test different DDR-inhibitors combinations or to target multiple pathways are yet to be explored [128]. With the various biomarkers that have either been recently discovered or are the subject of an ongoing investigation, designing future trials is hoped to allow for studying targeted treatments in a biomarker enriched population, which is defensible for the improvement of prognosis for SCLC patients [129].
|
v2
|
2022-11-28T14:19:12.132Z
|
2022-11-28T00:00:00.000Z
|
254020146
|
s2orc/train
|
A network meta-analysis to evaluate the efficacy of traditional Chinese medicine on intestinal flora in patients with gastrointestinal cancer
Background and Purpose: Traditional Chinese medicine (TCM) can regulate intestinal flora so as to affect the occurrence, progression, and prognosis of gastrointestinal cancer. According to clinical studies, TCM oral administration, TCM external treatment, and TCM injections, can adjust intestinal flora disorders in patients with gastrointestinal cancer. This network meta-analysis aims to evaluate the effect of three treatments on the intestinal flora in gastrointestinal cancer patients. Methods: This meta-analysis was registered in PROSPERO (CRD42022332553). Six electronic databases, namely CNKI, Wanfang, CSTJ, PubMed, Cochrane Library, and EMBASE, were searched from their inception to 1 April 2022. We identified randomized controlled trials (RCT) used to compare the efficacy of three TCM treatment methods—oral administration, external therapy and injections—on the intestinal flora in gastrointestinal cancer patients. The main outcome indicators were Bifidobacteria, Lactobacilli, Escherichia coli, and Enterococci. Stata (15.1) and the Cochrane risk of bias assessment tool were employed. Results: We identified 20 eligible RCTs with a total of 1,774 patients. According to network meta-analysis results, TCM injection plus common treatment (CT) or oral administration of TCM plus CT was superior to CT alone for supporting Bifidobacterium. In supporting Lactobacillus, TCM injection plus CT demonstrated more obvious effect relative to oral administration of TCM plus CT; TCM injection plus CT was more effective than CT only; and oral administration of TCM plus CT was superior to CT only.The inhibitory effect of TCM injection plus CT on Escherichia coli was better compared with CT only. In terms of inhibiting Enterococci, oral administration of TCM plus CT was superior to CT only.The difference in efficacy among the above treatments was statistically significant. In the SUCRA probability ranking, TCM injection plus CT had the best ranking curve among the three treatments and was the most effective in supporting Bifidobacteria (Sucra = 90.08%), Lactobacilli (Sucra = 96.4%), and regulating Escherichia coli (Sucra = 86.1%) and Enterococci (Sucra = 87.1%). Conclusion: TCM injections plus CT is the most effective therapy in balancing the intestinal flora of gastrointestinal cancer patients. However, the current results deserve further validation through high-quality research. Systematic Review Registration: http://www.prisma-statement.org/, identifier 10.1136/bmj.n71.
Introduction
Gastrointestinal (GI) cancers, including gastric cancer, colon cancer, and colorectal cancer (Soleimanpour et al., 2020), are among the most common cancers (Wang et al., 2020a), accounting for approximately 26% of total cancer incidence and about 36.4% of cancer-related deaths (Arnold et al., 2020). Recently, the incidence and mortality of GI cancers have been increasing (Bray et al., 2018), so exploring the protective factors and risk factors for the occurrence and development of GI cancers will be conducive to effectively preventing and treating these cancers. Clinically, GI cancers are usually treated by radiotherapy, chemotherapy, surgery, drugs, and immunotherapy, while TCM, generally considered as an adjuvant therapy combined with radiotherapy and chemotherapy, plays an effective anti-tumor role by inducing tumor cell apoptosis and inhibiting tumor angiogenesis . At the same time, it decreases the gastrointestinal reactions caused by radiotherapy and chemotherapy . However, with the in-depth study of the relationship between TCM and intestinal flora and gastrointestinal cancers, we found that TCM can adjust intestinal flora, promote beneficial bacteria to produce more Short-chain fatty acids (SCFAs) (Martin-Gallausiaux et al., 2021), mainly including acetate (C2), propionate (C3) and butyrate (C4), and improve the microenvironment of the gastrointestinal tumors, thereby having a certain beneficial impact on the occurrence, development, and prognosis of GI cancers (Sivan et al., 2015). In addition, intestinal flora also has a therapeutic effect on radiation enteritis caused by radiotherapy (Jian et al., 2021). Therefore, we believe that TCM can treat patients with gastrointestinal cancers by regulating intestinal flora in multiple ways.
Human intestinal microbes constitute a complex ecosystem, with around 800 species and more than 7,000 bacterial strains (Ley et al., 2006). In the intestine, symbiotic microorganisms are dynamic, which can maintain intestinal stability and inhibit pathogen colonization. When the balance is broken, the intestinal mucosal barrier and immune function will be undermined, leading to additional pathogenic factors, which are risk factors for colorectal cancer as well (Si et al., 2021).Clinical studies have found significant changes in the structure and characteristics of the intestinal flora in gastrointestinal cancer patients (Ferreira et al., 2018). Additionally, intestinal flora affects the absorption of anticancer drugs and correlates with the prognosis of these patients (Wertman et al., 2021). The pathological mechanisms by which intestinal flora affects colorectal cancer are currently thought to be achieved through multiple pathways, such as the induction of inflammation and immunity (Meng et al., 2018). Notably, intestinal pathogenic bacteria can drive tumorigenesis by shaping the tumor microenvironment or forming biofilms, such as Bacteroides, Escherichia coli, and Clostridium difficile, which can secrete a variety of virulence factors that damage intestinal epithelial cells and trigger chronic inflammatory responses, and develop into colorectal cancers (Hayase and Jenq, 2021). Meanwhile, some intestinal probiotics can directly produce tumor suppressive substances or enhance related antigens to achieve anti-tumor effects . The ferritin produced by Lactobacillus casei ATCC334, for instance, can act as a tumor suppressor through the JNK signaling pathway (Konishi et al., 2016). Therefore, we consider how to balance the environment of intestinal microbiota deserves further exploration.
Among many pathogenic bacteria, Escherichia coli and Enterococcus, belonging to neutral bacteria, are not pathogenic when their population is within a certain range, however, an excessive number of these bacteria may produce Enterotoxin that are highly pathogenic (Wassenaar, 2018;Alhinai et al., 2019). Bifidobacteria and Lactic acid bacteria, as probiotics, produce a large amount of SCFAs, which are beneficial to intestinal health (Zaharuddin et al., 2019). Because of their large number, more indepth basic research, and easy clinical detection, when intestinal pathology changes, the flora changes significantly, so they are commonly used as clinical indicators for evaluation of intestinal flora (Kuugbee et al., 2016).
In fact, the TCM adjuvant therapy for cancer has achieved a remarkable clinical efficacy (Wang S. et al., 2020c). Nowadays, the main TCM therapies commonly used in the clinics are oral therapy, external therapy and injection therapy (Huang et al., 2018). The classification is based on different routes of administration. Oral treatments of TCM are absorbed through the gastrointestinal tract, external treatments of TCM are absorbed through the skin and mucosa by physical therapy or enema, and TCM injections are the components directly enter the bloodstream. To the best of our knowledge, most of the previous studies have focused more on TCM oral administration, and less on external treatments and TCM injections. It has been shown that TCM can inhibit the development of cancer by regulating intestinal microbes . XiaoYao decoction (a medicinal diet with Ginseng, Atractylodes and Fushen as the main ingredients), for instance, can increase the abundance of Bacteroides, Lactobacillus, and Proteobacteria, and reduce the abundance of Desulfovibrio and Rickerella (Zhang Z. et al., 2020).
Given that the evidence in the current literature not able to determine which one is the most effective Therefore, we tried to select the best treatment by counting and analyzing the changes of 4 indicators in intestinal flora after the application of three TCM treatments in the previous literature. To date, no meta-analysis has been conducted to compare the effects of CT in combination with each of these three TCM methods on intestinal flora in gastrointestinal cancer patients. We present the paper on the basis of the checklist of the extended PRISMA for network meta-analysis.
Materials and methods
This meta-analysis was registered in PROSPERO (CRD42022332553).
Search strategies
We searched three English databases (PubMed, Cochrane Library and Embase) and three Chinese electronic databases (CNKI, Wanfang and Chinese Science and Technology Journal Database). The search period started from the establishment of the database until 1 April 2022.
Our search strategy contains comprehensive terms in the English database as follows: (Medical, Chinese traditional or Chinese medicine) and (gastric or colorectal or colorectal or gastrointestinal tumors) or (intestinal flora or gut microbes or Bifidobacterium or Lactobacillus or Escherichia coli or Enterococcus). A comprehensive search with subject terms, joint keywords and free words was conducted according to different databases to ensure the systematization and integrity of the search.
Inclusion standards
(1) The symptoms and clinical indicators of patients were in accordance with the newly compiled guideline The Diagnostic Criteria of Gastrointestinal Tumors.
(3) The control group was treated with CT, and the treatment group with one of three TCM intervention methods, namely CT + Oral administration of TCM, CT + external therapy of TCM (e.g., enema of TCM, acupoint catgut embedding, cutaneous scraping therapy, acupuncture, and moxibustion), and CT + TCM injection.
Exclusion standards
(1) Literature review, animal experiment, experience summary and other types of literature are excluded.
(3) The treatment group did not meet the requirements of combined TCM and common treatment or did not use one of the 3 treatment methods of TCM, or the control group was treated with TCM. (4) Articles with multiple publications and those with full text unavailable or with incomplete data were excluded. (5) None of the four selected indicators of intestinal flora (Bifidobacteria, Lactobacilli, Escherichia coli, and Enterococci) was found in the outcome indicators of RCT.
Types of outcome measures
The outcome indicators of this study were determined based on the frequency of outcome indicators in the articles involved and the 2020 AGA clinical practice guidelines. The main outcome indicators are as follows: 1) Bifidobacteria and Lactobacilli (increased number) and 2) Escherichia coli and Enterococci (decreased number).
Literature screening and data extraction
According to the search strategy, relevant literature was found in the database and the bibliography was exported. Duplicate literature was excluded using Endnotex9 software.The literature that met the inclusion criteria were downloaded for comparison, and the full text was ultimately read for exclusion.
Two reviewers (Niran Feng and Kunyang Li) independently searched the database and the selected articles. If there was any disagreement between them, a third party (Shurui Wang) would Frontiers in Genetics frontiersin.org participate in the discussion and propose a solution to resolve their differences. Furthermore, the references in the selected studies were examined to incorporate literature missing from the main studies. Data extraction criteria included: first author, publication year, country, title, number of cases, treatment duration, intervention measures in both the experimental group and the control group, and treatment results.
Quality assessment
Two researchers (Niran Feng and Zixin Xu) independently assessed the literature according to the inclusion and exclusion criteria. A third party participated in the discussion and decided whether there was any objection. We used the Revman software 5.2 and the "bias risk assessment" tool recommended by the Cochrane manual as the evaluation index for the quality assessment for all included studies. We evaluated the content of the literature with high risk, low risk, and unknown risk. In the case of incomplete data during the evaluation process, we obtained data by contacting the authors.
Statistical investigation
Considering the data of the four intestinal microbiota as continuous variables, the weighted mean difference (WMD) and 95% CI were used as effect size indicators for continuous variables. The difference was considered statistically significant, when the confidence interval (CI) was set to 95% and 0 was excluded. The data extracted from the article were ranked for efficacy and ranked cumulative probabilities using stata15.0 (Stata Corporation, College Station, TX, United States). Heterogeneity was assessed using funnel plots, where I 2 values greater than 50% represented considerable statistical heterogeneity. In addition, data processing, network link graph, forest graph and surface under the curve ranking (Sucra) were completed sequentially.
Literature search of the included studies
First, we screened out 765 articles and eliminated 109 duplicates according to the search criteria. Next, after reading the titles and abstracts, another 610 references were excluded. Finally, the remaining 46 articles were read and 20 eligible RCTs were included (Figure 1). The 20 RCTs comprised a total of 1,774 patients, including 888 in the treatment group and 886 in the control group. All included studies were conducted in China, with a sample size range of 30-109 entries. The duration of medication varied from 7 days to 3 months. 20 studies were RCTs, and 2 studies had no Enterococci-related data.
Risk of basis
The results of the quality assessment are presented in Figure 2, which shows that the risks of a large proportion of the studies were unclear and low. However, the overall quality of the 20 RCTs was acceptable.
Outcome indicators 3.4.1 Data analysis
The network diagram includes 20 RCTs. The line between two points indicates the evidence for direct comparison between the two methods. There is no closed loop between interventions; that is, there is no direct comparison between interventions (Figure 3). Among the four bacteria, the three types of TCM shows that the number of treatment methods using oral Chinese medicine is the largest, followed by external treatment and injection. All pairwise comparisons between interventions were from indirect comparisons. Therefore, statistical analysis can be performed directly under the consistency model.
Publication bias
Publication bias was assessed by the comparative-adjusted funnel method. Comparative correction charts were prepared for the included studies to evaluate the small sample effects. As shown in Figure 4, the RCTs with Lactobacillus and Bifidobacterium as outcome indicators in this study are roughly symmetrically distributed on both sides of the midline, indicating that the possibility of a small sample effect is low, and RCTs with Escherichia coli and Enterococcus as outcome indicators are not symmetrically distributed on both sides of the midline, indicating that the possibility of a small sample effect is high.
Network meta-analysis
In the comparison of pairwise methods, a total of 6 groups are meaningful (Table 2). In the bifidobacteria group, there were 2 pairs of comparison with statistically significant differences. CT only was compared with TCM injection in combination with CT, which the MD is 1.97 [MD = 1.97, 95% CI (0.48, 3.46)]. CT only was compared with oral administration of TCM in combination with CT, which MD is 0.83 [MD = 0.83, 95% CI (0.13,1.53)]. In Lactobacillus, 3 pairs of comparison showed statistically significant differences. TCM injection plus CT was compared with oral administration of TCM plus CT, which the MD is 1.55 [MD = 1.55 95% CI (0.20, 2.89)]. TCM injection combined with CT only was compared with CT, which the MD is 2.3 [MD = 2.30, 95% CI (1.08, 3.51)]. Oral administration of TCM combined with CT was compared with CT, which the MD is 0.75 [MD = 0.75, 95% CI (0.18, 1.32)]. In Escherichia coli, there is a statistically significant difference in one pair of comparison, the curative effect of TCM injection combined with CT was compared with CT only, which the MD is -1.46 [MD = -1.46, 95% CI (-2.88, -0.03)]. Among enterococci, one pair of comparison indicated a statistically significant difference. Oral administration combined with CT of TCM Compare with
Comparative effect of colorectal cancer and gastric cancer
To make the results more stable and credible, we performed a meta-analysis supplementing the intestinal flora of colorectal and gastric cancers (Table 3). The random-effects model shows that TCM injection plus CT (WMD = 1.97, 95% CI (0.273, 3.667), p < 0.05] or TCM external treatment plus CT (WMD = 1.046, 95% CI (0.843,1.249), p < 0.05] is compared with CT, the amount of Bifidobacteria and Lactobacillus in feces of colorectal cancer patients are higher than those of the control group. For
Discussion
A total of 20 RCTs with 1774 patients was included in this paper. Through the comparison of SUCRA results, Aidi injection is the most effective in increasing the number of Bifidobacteria and Lactobacillus, and in inhibiting the number of Escherichia coli and Enterococcus. In the pairwise comparison of three TCM treatments, injection of TCM plus CT or oral Chinese medicine plus CT are effective for Bifidobacteria and Lactobacillus. For Escherichia coli, TCM injection plus CT takes effect. For Enterococcus, TCM oral treatment plus CT is practical.
There are three treatments of TCM, including internal treatment (oral absorption), external treatment (physical therapy or skin mucosal absorption), and injection (direct blood injection). Internal treatment mainly uses oral Chinese medicine decoction, the preparation of which is to soak the traditional Chinese medicine in boiling water or hot water to produce an aqueous extract containing a mixture of chemical components (Zhou et al., 2016;Deng et al., 2019). Specifically, after oral administration of TCM into the colon, intestinal microbiota converts carbohydrates, proteins, lipids and small non-nutritive compounds from TCM into chemical metabolites that may have beneficial or adverse effects on human health . For example, the continuous digestion of polysaccharides and carbohydrates (PS) produces many shortchain oligosaccharides, which can promote the growth of probiotics such as Bifidobacteria and Bacteroides. Shorter PSs are digested to form monosaccharides, which can be continuously catabolized to form short-chain fatty acids (SCFA) (e.g., formate, acetate, propionate, butyrate), lactic Frontiers in Genetics frontiersin.org acid, hydrogen, carbon dioxide and other metabolites. Valproic acid, a kind of SCFAs, has antitumor activity, and its main mechanism is to inhibit histone deacetylase (Gurvich et al., 2004). These metabolites may directly affect the host intestinal environment and improve the microenvironment of gastrointestinal cancer (Vernocchi et al., 2016;Feng et al., 2019). Aidi injection is mainly composed of ginseng, Astragalus membranaceus, canthatis, and acanthopanax senticosus. The active components are ginsenoside, astragalus polysaccharide, astragalus saponin, cantharidin and Acanthopanax Senticosus Polysaccharide (Quirke et al., 2007). Astragalus polysaccharides can increase the number of lactic acid bacteria and Bifidobacteria, thereby reducing pro-inflammatory factors, such as interleukin-6 and tumor necrosis factor-α. Therefore, as an inflammatory response inhibitor, it can also reduce the inflammatory response by reducing Salmonella typhi in the intestine . Ginsenoside-rb3 and ginsenoside Rd can promote the growth of beneficial bacteria, such as Bifidobacterium, Lactobacillus, Acidophilus and Anisoid, and can also reduce a number of cancer-related pathogens and Helicobacter pylori spp to prevent the development of colorectal cancer (CRC) (Huang et al., 2017). There are few studies on other drugs. We attribute the better effect of Aidi injection to its high bioavailability compared with the other two methods. When it comes to the cold and hot nature of the drug, all four drugs in the prescription are warm products. Therefore, it can be inferred that Aidi injection is hot and may be more suitable for the body of cancer patients undergoing radiotherapy and chemotherapy. External treatments include enema, acupoint embedding, skin scratching and ginger moxibustion. These methods are rarely studied in the field of intestinal flora research.
Many studies have shown that there is a causal relationship between changes in the intestinal flora and colorectal cancer. Patients with colorectal cancer have poor nutritional status and low systemic and partial resistance, which inhibit the growth of intestinal dominant bacteria, such as Lactobacillus and Bifidobacterium, resulting in the imbalance of the intestinal microenvironment. Meanwhile, intestinal flora imbalance will decrease the immune function of the body, and the decline of immune function will aggravate the flora imbalance, thus Frontiers in Genetics frontiersin.org forming a vicious circle. In addition, chemotherapy drugs further reduce the immunity of patients and interfere with the proportion of normal intestinal flora. Moreover, the more obvious the imbalance is before chemotherapy, the more serious the imbalance is after chemotherapy. Therefore, the anti-cancer research of intestinal flora is of great significance. Lactic acid bacteria and Bifidobacterium strains induce dendritic cell (DC) to mature (Hickey et al., 2021) and produce IFN-γ (IFN-γ), enhancing the cytolytic potential of NK cells . Probiotics induce apoptosis by inhibiting the expression of COX-2, NF KB, and MAPK, suppressing the inactivation of inflammatory bodies, and activating Caspase-3 (Iyer et al., 2008). It also induces cell death through autophagy (Engevik et al., 2019). Bifidobacterium can increase anti-PD-L1 and inhibit tumor volume by inducing anti-inflammatory activity of macrophages and dendritic cells (Xu et al., 2020). Probiotics such as Lactobacillus and Bifidobacterium inhibit the growth of colorectal cancer by suppressing inflammation and angiogenesis, and enhance the intestinal barrier function by secreting short-chain fatty acids (SCFAs) (Koh et al., 2016). Escherichia coli is more prevalent in colorectal cancer tissues (Buc et al., 2013). Enterococcus faecalis produces enterotoxins (e.g., tartary buckwheat glucoside) and reactive oxygen species, which can lead to DNA oxidative damage and intestinal epithelial cell inflammation (Baldassarri et al., 2005). Enterococcus faecalis is responsible for producing reactive oxygen species and superoxide anions, resulting in DNA damage and genomic instability in colorectal cancer (Geravand et al., 2019). Fecal Escherichia coli induces mucosal macrophages to produce DNA damage inducers (Goodwin et al., 2011), such as 4-hydroxy-2nonyl, through COX-2 (Yang et al., 2013). We did a general meta-analysis, separating the patients with gastric cancer and colorectal cancer, to compare the differences between CT only and the three methods combined with CT. For colorectal cancer patients, in Bifidobacteria and Lactobacillus, external treatment plus CT or injection of TCM plus CT, are more effective than CT. For Escherichia coli, the TCM external treatment plus CT and the TCM injection plus CT are more effective than CT only. For Enterococci, We prefer TCM injection plus CT because it exhibits better effect than CT only.
Limitations
The following limitations should be considered in this study. The methodological quality of the effect of TCM on intestinal flora of gastrointestinal cancers is subject to some risk deviation, such as insufficient sample size and short duration. In addition, gastrointestinal cancers are subdivided into gastric and colorectal cancers. Because the number of articles is too small to perform a heterogeneity testing, we did a general meta-analysis to assist the results. TCM is divided into three categories. The external treatment includes enema, the effect of which overlaps with that of oral TCM. However, considering its direct effect on Frontiers in Genetics frontiersin.org intestinal flora and its short duration, it is placed in the external treatment.
Conclusion
In this study, Bifidobacteria and Lactobacilli, Escherichia coli and Enterococci were used as the main therapeutic indicators for comprehensive evaluation. Overall, TCM injection may be the best treatment, followed by TCM external treatment. TCM plays a certain role in the intestinal flora of patients with gastrointestinal cancers through multi-targeted comprehensive intervention. Clinically, it can be used in combination with other therapies depending on the actual situation of patients, and is suitable for the whole treatment process for gastrointestinal cancer patients.
Data availability statement
The original contributions presented in the study are included in the article/supplementary material, further inquiries can be directed to the corresponding authors.
|
v2
|
2022-11-28T14:39:40.438Z
|
2022-11-28T00:00:00.000Z
|
254020177
|
s2orc/train
|
Reduced tumor stiffness quantified by tomoelastography as a predicative marker for glypican-3-positive hepatocellular carcinoma
Background Glypican-3 (GPC3) expression is investigated as a promising target for tumor-specific immunotherapy of hepatocellular carcinoma (HCC). This study aims to determine whether GPC3 alters the viscoelastic properties of HCC and whether tomoelastography, a multifrequency magnetic resonance elastography (MRE) technique, is sensitive to it. Methods Ninety-five participants (mean age, 58 ± 1 years; 78 men and 17 women) with 100 pathologically confirmed HCC lesions were enrolled in this prospective study from July 2020 to August 2021. All patients underwent preoperative multiparametric MRI and tomoelastography. Tomoelastography provided shear wave speed (c, m/s) representing tissue stiffness and loss angle (φ, rad) relating to viscosity. Clinical, laboratory, and imaging parameters were compared between GPC3-positive and -negative groups. Univariable and multivariable logistic regression were performed to determine factors associated with GPC3-positive HCC. The diagnostic performance of combined biomarkers was established using logistic regression analysis. Area-under-the-curve (AUC) analysis was done to assess diagnostic performance in detecting GPC3-positive HCC. Findings GPC3-positive HCCs (n=72) had reduced stiffness compared with GPC3-negative HCCs (n=23) while viscosity was not different (c: 2.34 ± 0.62 versus 2.72 ± 0.62 m/s, P=0.010, φ: 1.11 ± 0.21 vs 1.18 ± 0.27 rad, P=0.21). Logistic regression showed c and elevated serum alpha-fetoprotein (AFP) level above 20 ng/mL were independent factors for GPC3-positive HCC. Stiffness with a cutoff of c = 2.8 m/s in conjunction with an elevated AFP yielded a sensitivity of 80.3%, specificity of 70.8%, and AUC of 0.80. Interpretation Reduced stiffness quantified by tomoelastography may be a mechanical signature of GPC3-positive HCC. Combining reduced tumor stiffness and elevated AFP level may provide potentially valuable biomarker for GPC3-targeted immunotherapy.
Introduction
Hepatocellular carcinoma (HCC) ranks as the third leading cause of cancer death worldwide (1). Early-stage HCC can be treated curatively with surgical resection, transplantation, transarterial chemoembolization, or ablation. Despite therapeutic advances, less than 40% of HCC patients are eligible for potentially curative treatment (2).
Multityrosine kinase inhibitors, such as sorafenib, were the first systemic therapy for advanced HCC (3). However, due to a strong and broad resistance of HCC to cytotoxic chemotherapy, systemic therapy based on antiangiogenic tyrosine kinase inhibitors has been used primarily in advanced disease (4,5). Recently, the quest for HCC treatment has focused on tumor antigen-specific immunotherapy and other approaches modulating the immunogenicity of HCC (6). Meanwhile, agents targeting the programmed cell death protein-1 and cytotoxic T lymphocyte antigen 4 have been approved for HCC treatment (7)(8)(9). Despite these encouraging developments in immunotherapy, there is an ongoing need to identify further molecular targets and develop biomarkers to assess treatment responses.
Glypican-3 (GPC3), a member of heparan sulfate proteoglycans anchored to the cell membrane, is highly expressed in >60% of all HCCs but not in benign hepatic lesions, hepatic cirrhosis, hepatitis, or in healthy liver tissue (10)(11)(12). Its overexpression has been associated with poorer prognosis (10,(13)(14)(15)) and identified as a rational specific diagnostic biomarker or target for immunotherapy in HCC (16,17). Various immunotherapies targeting GPC3 have been under investigation, including GPC3-targeted antibody treatment, peptide/DNA vaccine treatments, chimeric antigen receptor T cells therapy, immunotoxin use, and genetic therapies (10). he usefulness importance of GPC3 as a therapeutic target for both antibody-and cell-based immunotherapies has been explored in previous studies (18). Currently, GPC3 expression is detected mainly through immunohistochemical staining of HCC tissue samples obtained by surgical resection or fine-needle biopsy (10). Given the diagnostic and therapeutic importance of GPC3 and the lack of non-invasive detection methods for GPC3, a quantitative imaging biomarker for the detection of GPC3 with high sensitivity and specificity is urgently needed.
Tomoelastography, an advanced MR elastography (MRE) technique based on multiple frequencies, is an emerging noninvasive imaging technique for quantifying biomechanical properties of soft tissues in vivo (19). Tomoelastography yields quantitative maps of shear wave speed (c in m/s) and loss angle (j in rad) as surrogates of tissue stiffness and viscosity, respectively. Tomoelastography has been applied for the biomechanical characterization of a variety of tumors in vivo, including pancreatic cancer (20,21), neuro-tumors (22), prostate cancer (23, 24), rectal carcinoma (25), and liver tumors (26,27). These studies have unveiled the relationship between biomechanical properties and changes in tissue microstructure associated with tumor progression including remodeling of the extracellular matrix (ECM) and collective cellular behavior (20,26).
We hypothesize that biomechanical parameters might be sensitive to GPC3 expression in HCC as GPC3 is an ECM component that mediates cell-ECM and cell-cell interactions and promotes cell growth. To test this hypothesis, we conducted an exploratory study using tomoelastography to investigate the correlation between the biomechanical properties of HCC and their GPC3 expression levels, and to develop prediction models of GPC3-positive HCC.
Study population
This prospective single-center cohort study was approved by the institutional review board (No. RJ2018-209), and written informed consent was obtained from all study participants. From July 2020 to August 2021, 156 consecutive participants with suspected HCC were enrolled and underwent preoperative tomoelastography. Sixty-one participants were excluded due to lack of pathological results (n = 19), previous HCC treatment (n = 3), or poor MRI image quality due to iron deposition and/or motion artifacts (n = 39). Finally, 95 participants (mean age, 58 years ± 1; 78 men and 17 women) with 100 HCC lesions were included. A flowchart of participant recruitment is shown in Figure 1.
Clinical MRI for HCC diagnosis
All participants underwent routine multiparametric MRI, which consisted of T1-weighted, T2w, diffusion-weightedimaging with b-values of 0, 50, and 800 s/mm 2 , and multiphase dynamic contrast-enhanced imaging with Gd-DTPA. These routine clinical MRI examinations were performed within one week before surgery on systems from different vendors (Siemens, Philips, United Imaging) depending on their availability. All imaging parameters of the multiparametric MRI protocol are compiled in Supplemental Table T1.
Tomoelastography
Tomoelastography examination was performed on a 1.5-Tesla MRI scanner (Magnetom Aera, Siemens, Erlangen, Germany) one day before surgery for all patients. The setup was similar to that described in Shahryari.et al (27). Briefly, mechanical vibration of 30, 40, 50, and 60 Hz were generated and transferred sequentially to the liver using four pressure pads driven by compressed air. Two anterior and two posterior pads, operating at 0.4 and 0.6 bar, respectively, were placed near the liver region. Three-dimensional wave fields were acquired using a single-shot, spin-echo echo-planar MRI sequence with flowcompensated motion-encoding gradients. Fifteen contiguous axial slices with a field of view of 384×312 mm 2 (matrix size: 128×104) and 3×3×5 mm 3 resolution were acquired during free breathing as proposed in Shahryari.et al (28). Further imaging parameters were: echo time of 59 ms; repetition time of 2050 ms; parallel imaging with GRAPPA factor 2; MEG frequency of 43.48Hz for 30, 40, 50Hz vibration frequencies and 44.88Hz for 60Hz vibration frequency; MEG amplitude of 30mT/m. Total acquisition time was approximately 3.5 mins. Multifrequency wavefield data were processed using the pipeline available at https://bioqic-apps.com. Full field-of-view maps of shear wave speed (c) and loss angle (j) of the complex shear modulus were generated. As c is proportional to the square root of the storage modulus (real part of the complex shear modulus) while j continuously changes from 0 (pure solid properties) to p/2 (pure fluid properties), these two parameters are also considered surrogates for stiffness and tissue fluidity, respectively. Henceforth, we will use c and j for providing quantitative information, while "stiffness" and "fluidity" are reserved for discussing qualitative parameter changes.
Image analysis
Based on imaging features such as tumor size, non-rim arterial phase enhancement (APHE), non-peripheral washout ("washout") in the portal venous phase (PVP) or delayed phase (DP), and enhancing capsule ("capsule"), Liver Imaging Reporting and Data System (LI-RADS) categories ranging from LR1 to LR5 as well LR-M (malignant, not HCC-specific) and LR-TIV (Tumor In Vein) were assigned to each lesion using LI-RADS version 2018 (29).
For tomoelastography, regions of interest (ROIs) were manually drawn on T2w tomoelastography magnitude images using conventional T2w MR images for anatomical orientation. One main slice showing the primary lesion at its largest crosssectional extension and its two adjacent slices were selected for defining ROIs of tumors. ROIs were also manually drawn to encompass as much of the background liver as possible on three consecutive sections with the largest liver cross-sectional coverage on the central c-and j-map slices. The measurement results were averaged and then used as the representative parameters. Additionally, two radiologists -Rater#1 with 12 years of experience and Rater#2 with 2 years of experienceindependently analyzed tomoelastography data in all 95 patients for testing interobserver variability.
Histopathological analysis
Lesion specimens were obtained from surgical resection. Presence of microvascular invasion, Edmondson-Steiner grade, liver fibrosis stage, and inflammation grade were assessed in hematoxylin and eosin (H&E)-stained specimens. Immunochemistry staining was performed to verify GPC3 expression based on protocol described in Feng et al. (30).
Flowchart of participant inclusion and exclusion.
A sample was classified as positive for GPC3 expression when >10% of tumor cells showed GPC3 cytoplasmic staining. Ki-67 expression was assessed by noting the percentage of positively stained cells. All specimens were analyzed by a pathologist with 16 years of experience in hepatic pathology who was blinded to all radiological and clinical results.
Statistical analysis
For group comparison, the c2 test was used for qualitative parameters while Student′s t-test or the Mann-Whitney U-test was applied for quantitative measures. Interobserver agreement regarding mechanical parameters was tested using intraclass correlation coefficients (ICCs). Univariable and multivariable analyses of a backward logistic regression were used to determine predictive factors for GPC3-positive HCC. The diagnostic model was established using logistic regression analysis. Area-under-the-curve (AUC) analysis was done to assess diagnostic performance in detecting GPC3-positive HCC. AUC values were compared using the Delong test. All statistical analyses were performed with SPSS software (version 26; SPSS), GraphPad Prism software (GraphPad Prism for Windows, version 8.0), and MedCalc software (MedCalc Software Ltd). P < 0.05 was considered to indicate statistically significant differences.
Clinicopathological characteristics of participants
The GPC3-positive group included 72 participants (mean age, 58 years ± 12; 57 men and 15 women) with 76 lesions while the GPC3-negative group included 23 participants (mean age, 60 years ± 9; 21 men and 2 women) with 24 lesions. In participants with multiple lesions, all lesions of the same individual were found to be either positive or negative for GPC3 expression.
MRI characteristics of participants
Representative axial T2w images, arterial phase images, and delayed phase images for participants with (a) positive and (b) negative GPC3 expression are shown in Figure 2. Immunohistochemical analyses of GPC3 were also shown for these two patients where the cytoplasmic/membranous staining of GPC3 was significantly higher in patient with positives GPC3 expression. LI-RADS categories are summarized in Table 2. There were no LR1 or LR 2 cases among our participants, and the majority of lesions were categorized as LR-5 (73%). The presence of imaging features such as non-rim APHE (P = 0.68), washout (P = 0.51), and enhancing capsule (P = 0.69) did not differ significantly between the two groups. The distribution of LI-RADS categories was also similar between the two groups (P = 0.40).
Mechanical properties of HCC and background liver
ICC of interobserver reliability of mechanical properties based on all participants evaluated by two raters was 0.942 (95% CI: 0.916, 0.961) for tumor c, 0.809 (95% CI: 0.728, 0.827) for tumor j, 0.928 (95% CI: 0.889, 0.952) for background liver c, and 0.741 (95% CI: 0.635, 0.820) for background liver j, suggesting good concordance and data consistency. Bland-Altman plots are shown in Figure 3. Figure 2 shows tomoelastography c and j maps of GPC3positive and negative participants. It is apparent that the GPC3postivie HCC is softer (lower c-value) than the GPC3-negative tumor. We observed significantly lower c values in HCCs of the GPC3-positive group (2.34 ± 0.62 vs 2.72 ± 0.62 m/s, P = 0.01) than those of GPC3-negative group. HCC j was not different between these two groups (1.11 ± 0.21 vs 1.18 ± 0.27 rad, P = 0.21). In background liver, neither c (2.06 ± 0.40 vs 2.08 ± 0.43 m/s, P = 0.87) nor j (0.76 ± 0.15 vs 0.81 ± 0.24 rad, P = 0.26) was sensitive to GPC3 expression. Group comparisons of the biomechanical properties in both HCCs and background liver are compiled in Table 3 (Table 4).
Discussion
With the urgent clinical need for improving HCC immunotherapy, noninvasive detection of GPC3 expression of Representative axial T2-weighted images; arterial phase images; delayed phase images; axial diffusion-weighted images (DWI) at b-value of 800 sec/mm 2 ; axial tomoelastography c and j maps, and immunochemistry-stained section images of tumors (magnification, ×20) obtained in a patient with GPC3-positive HCC (A) and in a patient with GPC3-negative HCC (B).
HCC is of great interest. In this study, we have investigated the macroscopic mechanical manifestation of GPC3 expression using viscoelastic parameters quantified by in vivo tomoelastography. A key finding of our study was that GPC3positive HCC had lower stiffness than GPC3-negative HCC. Diagnostic power in predicting GPC3-positive HCC was highest for the combination of tomoelastography-quantified tumor stiffness and serum marker AFP. The conventional LI-RADS categories for imaging-based classification of HCC were not sensitive to GPC3 expression in our study population, suggesting that tumor morphology and vascularity are not directly linked to GPC3 upregulation. Tissue stiffness quantified by tomoelastography, on the other hand, was found to be sensitive to GPC3 expression. Our observation that GPC3-positive HCCs were softer than GPC3-negative HCCs seems counterintuitive at first glance, considering that malignant liver lesions usually have higher stiffness than benign tumors (27). However, rather than comparing malignant with benign tumors, we here addressed the influence of a specific protein within groups of malignant HCCs, which both had abnormally high stiffness values compared with surrounding liver tissue and other benign lesions reported in the literature (27). Another study suggests that GPC3-possitive HCCs possess more metastatic potential since GPC3 expression promotes cancer cell proliferation and epithelial-mesenchymal transition (EMT) (10). Several cell biomechanics studies confirm that metastatic cancer cells become soft, which promotes unjamming and facilitates invasion through interfaces and blood vessels (31)(32)(33). Recently, EMT has been reported to cause cancer cells to soften and migrate into their matrix environments (34,35). The biomechanical properties of surrounding tissue can also affect the stiffness of the embedded lesion (33,36). However, we observed no difference in the biomechanical properties of background livers between the two groups of participants, suggesting that the observed soft signature of GPC3-positive HCCs reflects tumor-intrinsic properties that are the collective behavior of soft and unjammed cancer cells due to GPC3promted EMT (37). Bland-Altman plots show agreement of c and j values evaluated by two independent raters in both HCC (A: c value of tumor; C: j value of tumor) and background liver (B: c value of liver; D: j value of liver)..
FIGURE 4
Scatter plots of mechanical parameters (A) c (stiffness) and (B) j (fluidity) comparing GPC3-positive and GPC3-negative groups. *P < 0.05. Tissue fluidity, as quantified by loss angle j, showed no sensitivity to GPC3 expression. Since GPC3 is known to upregulate cell motility, we expected GPC3-rich HCC to behave more fluid-like than GPC3-negative HCC, similar to high-grade tumors in the prostate (24, 38). However, considering that GPC3 is a proteoglycan with negatively charged heparan sulfate chains, its hydrophilic water-binding capacity on HCC cell surfaces could reduce water mobility and turn tissue into a more solid-like state, as known for high-grade glioma in the brain (22). Thus, we hypothesized that the counteracting effects of cell unjamming and water immobilization render j insensitive to GPC3 expression in HCC.
The best diagnostic performance in detecting GPC3-positive HCCs was achieved by combing stiffness and AFP level. The high specificity of AFP level for tumors with GPC3 expression might be related to the shared transcription factors zinc fingers, AFP regulator 2 (Arf2), and homeoboxes 2 (Zfh2) (39)(40)(41). As AFP is a serum marker commonly used for clinical HCC screening, it is routinely available. In our study population, the insufficient sensitivity of AFP in detecting GPC3-positive HCC was well compensated for by stiffness, which lacks specificity. Therefore, combining the serum biomarker and the tomoelastography-derived imaging biomarker may be a promising approach for the identification of GPC3-postive HCC. Owing to its noninvasive nature, tomoelastography could also be of value for monitoring and predicting outcome of immunotherapy targeting GPC3.
Our study has limitations. First, it was a single-center study. A multicenter study including other hospitals where tomoelastography is availability is planned. Second, the sample size was relatively small, especially in the GPC3-negative group. However, patient distribution in the GPC3-positive and -negative groups reflects the demographic distribution of GPC3-positive cases in a general HCC population (10). Third, clinical MRI examinations were performed on different scanner systems. However, LI-RADS categories are based on qualitative interpretation of MR images and, according to the guidelines, are not system-dependent (29). Finally, the scope of our study didn't cover the post-surgical outcome assessment which is of high interest and relevance. This aspect will be incorporated in our future studies to extend the prognostic value of our method.
In summary, reduced stiffness quantified by in vivo tomoelastography is a mechanical signature of GPC3-positive HCC. The macroscopic softening observed in GPC3-positive HCCs could be a collective reflection of HCC cell softening as a Unless otherwise specified, data in parentheses are numerators/denominators and data in brackets are 95% CIs. AUC of combined stiffness(c) and AFP level, denoted as c + AFP, was obtained by using probabilities estimated from logistic regression. result of EMT. The combined use of HCC stiffness and AFP level provided high diagnostic accuracy in detecting GPC3 expression and could be considered a viable biomarker for identifying GPC3-positive HCC and predicting therapeutic outcome.
Data availability statement
The raw data supporting the conclusions of this article will be made available by the authors, without undue reservation.
Ethics statement
The studies involving human participants were reviewed and approved by Ruijin Hospital Ethics Committee, Shanghai Jiaotong University School of Medicine (No. RJ2018-209). The patients/participants provided their written informed consent to participate in this study.
|
v2
|
2022-11-28T14:40:54.517Z
|
2022-11-28T00:00:00.000Z
|
254020078
|
s2orc/train
|
Desmoid tumour of the chest wall in paediatric post-operatory of heart transplant
We will report a case of a desmoid tumour (DT), which developed at the surgical site of the pacemaker after a late childhood heart transplant. Patients with idiopathic dilated cardiomyopathy followed up in the paediatric cardiology service. It evolved with the dissociation of ventricular rhythm caused by severe heart failure, which led to the implantation of a cardiac resynchronization device prior to heart transplantation. The progression to end-stage heart disease culminated in a heart transplant at 12 years old. One year after the transplant, at the age of 13 years, he presented a progressively growing mass on the generator site of the resynchronization device. The initial decision was to remove the device. During the removal surgery, there was no haematoma or fluid collection. However, there was a progression of the lesion. The lesion was biopsied with the anatomopathological diagnosis of a DT. Resection surgery happened 4 months after the start of the mass growth. At that time, the tumour reached 20 cm in diameter. The lesion infiltrated the pectoralis major muscle and this muscle was resected partially en bloc with the lesion. The defect had primary closure. The patient evolved without postoperative complications and was discharged on the 14th postoperative day. The surgical specimen came with negative circumferential margins. However, the deep margin was microscopically positive. Due to deep involvement, the patient underwent adjuvant radiotherapy. Currently, the patient is under clinical follow-up and has no evidence of tumour recurrence. DT is a rare tumour, with unpredictable courses. Surgery can be considered in the progression of lesions. Treatment is justified by long survival after a heart transplant and in DT patients. DT is a differential diagnosis to be considered in progressive growth lesions.
We will report a case of a desmoid tumour (DT), which developed at the surgical site of the pacemaker after a late childhood heart transplant. Patients with idiopathic dilated cardiomyopathy followed up in the paediatric cardiology service. It evolved with the dissociation of ventricular rhythm caused by severe heart failure, which led to the implantation of a cardiac resynchronization device prior to heart transplantation. The progression to end-stage heart disease culminated in a heart transplant at 12 years old. One year after the transplant, at the age of 13 years, he presented a progressively growing mass on the generator site of the resynchronization device. The initial decision was to remove the device. During the removal surgery, there was no haematoma or fluid collection. However, there was a progression of the lesion. The lesion was biopsied with the anatomopathological diagnosis of a DT. Resection surgery happened 4 months after the start of the mass growth. At that time, the tumour reached 20 cm in diameter. The lesion infiltrated the pectoralis major muscle and this muscle was resected partially en bloc with the lesion. The defect had primary closure. The patient evolved without postoperative complications and was discharged on the 14th postoperative day. The surgical specimen came with negative circumferential margins. However, the deep margin was microscopically positive. Due to deep involvement, the patient underwent adjuvant radiotherapy. Currently, the patient is under clinical follow-up and has no evidence of tumour recurrence. DT is a rare tumour, with unpredictable courses. Surgery can be considered in the progression of lesions. Treatment is justified by long survival after a heart transplant and in DT patients. DT is a differential diagnosis to be considered in progressive growth lesions. KEYWORDS paediatric heart transplantation, desmoid tumour, pacemaker, chest wall tumour, dilated cardiomyopathy (DCM)
Introduction
Heart transplantation is the treatment of choice for children with refractory congenital heart disease and cardiomyopathies. The tumours are transplant-related complications with challenging management.
A desmoid tumour (DT) is a rare type of tumour. DT consists of clonal fibroblastic proliferation from deep fascia or soft tissues. The tumour has unpredictable behaviour: spontaneous regression, maintenance, and growth are possible. DT does not give metastasis. However, local recurrence is frequent (1).
In this paper, we report DT in a heart transplantation patient. To our knowledge, it is the first case of such association. This case had challenging management due to the development and growth phase of adolescence in addition to the post-heart transplant status with the oncologic disease.
Case report
A brown male had idiopathic dilated cardiomyopathy (DCM), which required a cardiac resynchronization device implant at 10-year-old due to severe heart failure with ventricular rhythm dissociation. He had no other past medical issues and also no familiar related disease. Due to the progression to end-stage heart disease, the patient had a heart transplant at 12 years old. The anatomopathological report of the explant confirmed idiopathic DCM. He used tacrolimus and mycophenolate for immunosuppression and without graft dysfunction. One year after the transplant, at the age of 13 years, he presented a progressively growing mass on the generator site of the resynchronization device. The initial decision was to remove the device. During the surgical procedure, there was no haematoma or fluid collection.
However, there was a progression of the lesion. A PET-CT was performed with the finding of an important uptake lesion at the thoracic wall with SUVmax 7.8. The lesion was biopsied with the anatomopathological diagnosis of a DT. Resection surgery happened 4 months after the start of the mass growth (Figure 1). At that time, the tumour reached 20 cm in diameter. The lesion infiltrated the pectoralis major muscle and microscopically did not invade the intercostal muscles or ribs. The pectoralis major partially was resected en bloc with the lesion (Figure 2). The defect had primary closure. The patient evolved without postoperative complications and was discharged on the 14th postoperative day.
The report from the surgical specimen confirmed that the lesion was a DT (Figure 3). The circumferential margins were negative. The profound margin was microscopically positive. Due to margin compromising, the patient received adjuvant 60 Gray radiotherapy administration 2 months after surgery. There is no evidence of tumour recurrence in a 4-year followup.
Discussion
DT is associated with mutations in the Wnt/β-catenin pathway in the majority of cases. There is a hereditary type of disease with germline mutations in adenomatous polyposis coli (APC) being part of the familial adenomatous polyposis. There are also sporadic mutations related to DT (2). In the paediatric population, DT is associated with more gene mutations and a higher gene mutation rate than in adult cases, described in the literature the mutation rate of three exons of CTTNNB1 (3). DT can be related to local trauma, and surgery is associated with 28% of DT cases (4). In this case report, DT appeared at the surgical site of a resynchronization device implant, which is a previous site of surgical trauma.
In one study with 192 included patients with DT, 11% of the sample was paediatric. In this subgroup, the median age is 15 years, with female predominance of 64%. The median tumour size was 5.3 cm. In children, all tumour sites were extraabdominal. Lesions were predominant in the extremities, and only 15% were in the trunk (2).
There is no report of DT after a heart transplant in the literature. There are reports of DT in patients with lung, liver, and renal recipients (5). Transplant patients are at higher risk for developing tumours due to immunosuppressive therapy, Frontiers in Pediatrics particularly non-melanoma skin cancer and non-Hodgkin's lymphoma (6). In the literature, 12.1% of heart posttransplant patients had malignancies diagnosed, and in this population, post-transplant lymphoproliferative diseases were the most common (7). Once a growing mass develops, it should trigger an investigation. DT is diagnosed by an anatomopathological study of the lesion. Active surveillance is the initial approach to DT for asymptomatic patients (1). The unpredictable course of DT can justify this. Moreover, there is no difference in event-free survival between active surveillance and surgery (1). If there is a growing lesion, active treatment (with medical treatment and/or surgery) should be considered (1).
There are some considerations for surgery management. Between R0 and R1, there is no difference in the recurrence outcome. R1 resection is acceptable when the functionality is an issue (1). Based on the same outcome from R0 and R1 surgery, in the paediatric populations that are still at a time of physiological growth, sparing of structures should be considered and the decision is performed after multidisciplinary discussion.
Radiotherapy seems an adjuvant approach for DT, especially after R1 resection. However, the difference between surgery and surgery plus radiotherapy is not statistically significant (1).
DT has a high recurrence rate (24%-76%), despite the 10year overall survival rate being higher than 90% (8). In paediatric heart transplants, post-operatory survival is 13.1 years for those more than 11 years of age at transplant (9). Long-term survival after transplant or DT justifies intervention in this case.
New lesions after transplantation require investigation and diagnosis, considering immunosuppression. DT is a rare aetiology; however, this disease consists of differential FIGURE 3 Pathological findings of the resected specimen. The tumour cells (fibroblasts and myofibroblasts) lack cytological atypia, form long, "sweeping" fascicles, and show nuclear beta-catenin expression. These findings are consistent with desmoid fibromatosis. (A) Hematoxylin-eosin, 100×. (B) Immunohistochemistry for beta-catenin, 100×.
Data availability statement
The raw data supporting the conclusions of this article will be made available by the authors, without undue reservation.
Ethics statement
The studies involving human participants were reviewed and approved by the Ethics Committee of the Heart Institute of the School of Medicine, University of Sao Paulo. Written informed consent to participate in this study was provided by the participants' legal guardian/next of kin. Written informed consent was obtained from the individual(s), and minor(s)' legal guardian/next of kin, for the publication of any potentially identifiable images or data included in this article.
Author contributions
OF and ESN designed the study and edited the manuscript. OF, ESN, and EA cared for the patient and contributed sample collection. OF, ESN, EA, AJ, MJ, and PF revised the paper. All authors contributed to the article and approved the submitted version.
|
v2
|
2022-11-28T14:42:14.460Z
|
2022-11-28T00:00:00.000Z
|
254020045
|
s2orc/train
|
SLC2As as diagnostic markers and therapeutic targets in LUAD patients through bioinformatic analysis
Facilitative glucose transporters (GLUTs), which are encoded by solute carrier 2A (SLC2A) genes, are responsible for mediating glucose absorption. In order to meet their higher energy demands, cancer cells are more likely than normal tissue cells to have elevated glucose transporters. Multiple pathogenic processes, such as cancer and immunological disorders, have been linked to GLUTs. Few studies, meanwhile, have been conducted on individuals with lung adenocarcinoma (LUAD) to evaluate all 14 SLC2A genes. We first identified increased protein levels of SLC2A1, SLC2A5, SLC2A6, and SLC2A9 via HPA database and downregulated mRNA levels of SLC2A3, SLC2A6, SLC2A9, and SLC2A14 by ONCOMINE and UALCAN databases in patients with LUAD. Additionally, lower levels of SLC2A3, SLC2A6, SLC2A9, SLC2A12, and SLC2A14 and higher levels of SLC2A1, SLC2A5, SLC2A10, and SLC2A11 had an association with advanced tumor stage. SLC2A1, SLC2A7, and SLC2A11 were identified as prognostic signatures for LUAD. Kaplan-Meier analysis, Univariate Cox regression, multivariate Cox regression and ROC analyses further revealed that these three genes signature was a novel and important prognostic factor. Mechanistically, the aberrant expression of these molecules was caused, in part, by the hypomethylation of SLC2A3, SLC2A10, and SLC2A14 and by the hypermethylation of SLC2A1, SLC2A2, SLC2A5, SLC2A6, SLC2A7, and SLC2A11. Additionally, SLC2A3, SLC2A5, SLC2A6, SLC2A9, and SLC2A14 contributed to LUAD by positively modulating M2 macrophage and T cell exhaustion. Finally, pathways involving SLC2A1/BUB1B/mitotic cell cycle, SLC2A5/CD86/negative regulation of immune system process, SLC2A6/PLEK/lymphocyte activation, SLC2A9/CD4/regulation of cytokine production might participate in the pathogenesis of LUAD. In summary, our results will provide the theoretical basis on SLC2As as diagnostic markers and therapeutic targets in LUAD.
Introduction
Lung adenocarcinoma (LUAD), the most prevalent NSCLC subtype, has a high morbidity and mortality rate that makes it a global public health concern (Liu et al., 2015). Even though traditional treatment approaches involving curative resection, targeted therapy, or immunotherapy have seen enormous advancements in recent years, it is crucial to comprehend the molecular pathogenesis and etiology of LUAD to develop new prognostic and therapeutic targets for LUAD (Tong et al., 2018).
Tumor cells exhibit a distinct metabolism from normal cells, converting to higher glycolysis demands (the Warburg effect) and glucose intake for ATP synthesis to meet their energy needs. Facilitative glucose transporters (GLUTs), which are encoded by 14 SLC2A genes, are responsible for mediating this process. Based on function and sequence similarity, these transporters can be divided into three groups. Additionally, they differ in terms of tissue location and their affinity for the substrate (glucose and other hexoses like fructose). GLUT-1-4 and GLUT-14 are classified as Class 1 GLUTs, whereas GLUT-5, GLUT-7, GLUT-9, and GLUT-11 are Class 2 GLUTs. GLUT-6, GLUT-8, GLUT-10, GLUT-12, and GLUT-13 (H(+)-myo-inositol transporter HMIT) are classified as Class 3 GLUTs (Cura and Carruthers, 2012). Several clinical diseases, including cancer and autoimmune illness, are associated with SLC2As (Hu et al., 1999;Macintyre et al., 2014;Yin et al., 2015;Jodeleit et al., 2018;Tilekar et al., 2020a). Previous research has determined the upregulation of SLC2As and their roles in certain malignancies. Additionally, numerous types of researches have focused on GLUT-inhibitors to slow the growth of tumors (including breast cancer, osteosarcoma, and NSCLC) and other proliferative illnesses (Sanli et al., 2010;Storozhuk et al., 2012;Storozhuk et al., 2013;Hardie and Ashford, 2014). GLUT inhibitors have shown encouraging results in the treatment of tumors, particularly when combined with other chemotherapy, radiation, immunotherapy, pathway-specific oncogenic-targeted medicines, other anti-metabolic, or epigenetic medications (Granchi et al., 2016). However, off-targets and low potency, which is a result of cancer cell potency to adopt alternative strategies for glucose supply, still exist (Tilekar et al., 2020b). Additionally, in specific tumor forms, glucose uptake does not coincide with GLUT-1 expression, suggesting the participation of other transporters. To put it another way, GLUT-1 may have an impact via working with other GLUTs. All these reports serve as a reminder that to evaluate the transport members' roles in a particular cancer type, they must be considered as a whole. The same is true for LUAD; we could only reliably anticipate outcomes and identify patients who would respond better to particular GLUT inhibitors if we thoroughly evaluated the metabolic profiles in LUAD.
To explore the molecular landscape of LUAD patients, we first evaluated the DNA methylation, mRNA, and protein levels of 14 SLC2As in this study. Then, to better grasp the potential of SLC2As as diagnostic biomarkers and prognosis indicators of LUAD, we further investigated the relationship between the expressions of 14 SLC2As and clinical data. A theoretical foundation for SLC2As as therapeutic targets in LUAD is provided by our exploration of the molecular mechanisms that SLC2As contribute to the pathophysiology of LUAD.
Ethic statement
Samples of tumor tissues and adjacent tissues were taken from 6 LUAD patients from The First Hospital of Jilin University. Each participant gave their written informed consent in accordance with the principles of the Declaration of Helsinki. Additionally, the hospital's institutional ethics committee gave its approval for this investigation.
Transcriptional level of SLC2As analysis via ONCOMINE and UALCAN database ONCOMINE (Rhodes et al., 2004) is the largest integrated database mining platform and cancer gene chip database. The difference in SLC2A mRNA expression between LUAD patients and healthy lung tissues was examined. The p threshold was set at 1E-4 and the fold change threshold was set at 2. UALCAN (Chandrashekar et al., 2017) is a comprehensive online analytic tool that uses RNA-seq and clinical data from 31 different cancer types from the TCGA database. The SLC2As mRNA expression profiles and DNA methylation levels in individuals with LUAD were compared to those in healthy tissues using the UALCAN database. Additionally, the UALCAN database was used to evaluate the relationship between the expression of SLC2As and clinicopathologic characteristics. The p-value was calculated using Student's t-test, and the threshold was set at 0.05.
Analysis of SLC2As protein levels using the human protein altas database
The Human Protein Altas (HPA) (Uhlén et al., 2015) is a website that allows users to investigate each protein's expression level and location in 20 cancer types that are extremely prevalent. We employed HPA to examine how the expression of GLUTs varied between LUAD patients and healthy lung tissue. downloaded from the TCGA dataset (https://portal.gdc.com). To choose the appropriate terms for the nomogram, univariate and multivariate cox regression analysis were used. With the use of the R program "forestplot," the forest was utilized to display the p-value, HR, and 95% confidence interval for each variable (Xiong et al., 2020). Based on the outcomes of the multivariate cox proportional hazards analyses a nomogram was created to forecast the overall recurrence over the next 1, 2, 3, 5 year. The nomogram offered a graphical depiction of the elements that may be used to determine a patient's unique risk of recurrence based on the points assigned to each risk factor using the "rms" R program (Jeong et al., 2020;Xiong et al., 2020).
Construction and evaluation of the prognostic risk model of SLC2As
Kaplan-Meier plotter (Győrffy et al., 2013) was employed to examine the relationship between the transcriptional levels of SLC2As and the survival of LUAD patients. p ≤ 0.05 was used to define the statistical significance level.
From the TCGA dataset, RNA-sequencing expression (level 3) profiles and associated clinical data for LUAD were obtained (https://portal.gdc.com). Univariate Cox regression was used to assess the 14 genes in question, and candidate genes were chosen if they satisfied the screening requirement of p < 0.05. Following that, we used the R software's "glment" package to perform LASSO regression on high-dimensional data to identify the most effective prognostic factors (Xu et al., 2021). Three genes were chosen, and a risk score was also computed for each of them. Based on the median expression of SLC2A genes, patients were split into high-risk and low-risk groups. Using the KM survival approach, the association between SLC2A genes and survival rates was examined. The p-value of KM survival curves was determined using log-rank testing. The receiver operating characteristic (ROC) curve was created to evaluate the model's accuracy. To find LUAD prognostic variables, univariate and multivariate Cox regression analyses were performed. R (foundation for statistical computing 2020) version 4.0.3 was used to implement all the analysis techniques and R packages (Supplementary Material S1). A p-value of 0.05 was regarded as statistically significant.
Co-expression genes of SLC2As mRNA in lung adenocarcinoma
We wanted to further explore the underlying mechanism SLC2As regulating LUAD. Thus, we analyzed the co-expression profiles in LUAD using the cBioPortal database (Cerami et al., 2012). The top 50 positively co-expressed genes and 50 negatively co-expressed genes were selected based on Spearman's correlation.
Gene ontology (GO) and kyoto encyclopedia of genes and genomes (KEGG) enrichment analysis
Metascape (Zhou et al., 2019) is a web-based database that incorporates over 40 different gene functions. The co-expressed genes were enriched using GO and KEGG analyses. We defined minimum overlap as 3, minimum enrichment as 1.5, and p ≤ 0.05 as significant.
Protein-protein interaction (PPI) networks of the member of SLC2As via Cytoscape Cytoscape (Smoot et al., 2011), a software focusing on open source network visualization and analysis, provides the basic function layout and query network. The Search Tool for the Retrieval of Interacting Genes/Proteins (STRING) database was used to build a PPI network to evaluate the potential PPI of co-expressed genes (Szklarczyk et al., 2021). PPI pairs with a minimum interaction value of 0.4 were chosen, and Cytoscape 3.8.2 was used to display the network. According to the degree score of each gene node, the CytoHubba plugin for Cytoscape approved the top 10 core genes.
The association between SLC2As and immune cells infiltration in patients with LUAD
TIMER (Li et al., 2017) investigates in detail the immune infiltration status of different cancer types. In our study, the correlation between the immune cell marker genes and SLC2As in the correlation module was used to evaluate the relationship between SLC2As expressions and the infiltration of immune subtypes in LUAD patients. All the markers' genes with coefficients greater than 0.35 were chosen.
Quantitative polymerase chain reaction
We reanalyzed our prior projected SLC2A3, SLC2A6, SLC2A9, and SLC2A14 expression level results, including paired tumor and surrounding tissues from 6 primary LUAD patients diagnosed in The First Hospital of Jilin University from June 2021 to June 2022, to see if the mRNA expressions of SLA2As are parallel to those in clinical samples. A TRIzol-based (Invitrogen) technique was used to extract the RNA, and RT EasyTM (with gDNase) was used to create complementary deoxyribonucleic acid (FORE GENE).
On an ABI StepOnePlus
Frontiers in Pharmacology frontiersin.org 03 machine from Applied Biosystems, using the Power q-PCR SYBR Green Mix, all PCRs were run in triplicate (Yeasen). Using the Cttechnique, the relative mRNA expression of several genes was measured. One of the housekeeping genes was GAPDH.
The additional information included a list of the primer sequences (Comate Bioscience) ( Table 1). We calculated relative gene expression levels with 2 −ΔΔCT , visualizing data with Graphpad 9.0.
Stastical analysis
Univariate survival analysis with Kaplan-Meier and logrank tests. Multifactor survival analysis was conducted using COX regression models. By calculating the area under the curve using the pROC software package, we were able to assess the specificity and sensitivity of SLC2As in prognosis of LUAD. The continuous variables were compared using independent t-tests. Categorical data were tested with chi-square tests. Statistical significance was defined as a two-sided p-value < 0.05. All data processing was done in R4.0.3 software.
Functional annotation of SLC2As
The overview of the research design is present in Supplementary Figure 2C). KEGG pathway analysis indicates pathway 04931: SLC2As and insulin resistance were linked (Supplementary Material S2; Figure 2D). Additionally, SLC2As were linked to many diseases, such as intestinal atresia, pregnancy-related diabetes, hypouricemia, Lesch-Nyhan syndrome, gestational diabetes, arterial tortuosity syndrome, meningomyelocele, and addictive behavior (Supplementary Material S2; Figure 2E).
Abnormal expressions of SLC2As in patients with LUAD
We initially determined the mRNA and protein expression of SLC2As using the ONCOMINE, UALCAN, and HPA databases to investigate the diagnostic and therapeutic relevance of SLC2As in LUAD patients. In the UALCAN database, we first verified the mRNA expression of SLC2A family members, The findings in Figures 1A-K demonstrated that LUAD tissues had lower levels of SLC2A3, SLC2A6, SLC2A9, SLC2A12, and SLC2A14 than normal lung tissues and higher levels of SLC2A1, SLC2A5, SLC2A7, SLC2A8, SLC2A10, and SLC2A11. The ONCOMINE database, which was different from UALCAN database, was used to quantify the mRNA expressions of 14 SLC2A genes in 20 different types of malignancies and compare them to normal tissues. LUAD tumor tissues showed higher mRNA expressions of SLC2A1, SLC2A5, and SLC2A12 and lower expressions of SLC2A3, SLC2A4, SLC2A6, SLC2A9, and SLC2A14 ( Figure 1L). Together, these findings demonstrated that individuals with LUAD had transcriptionally upregulated levels of SLC2A1, SLC2A5, and downregulated levels of SLC2A3, SLC2A6, SLC2A9, and SLC2A14. Using the HPA database, we attempted to identify the protein levels of SLC2As in LUAD. According to the findings in Figure 2, GLUT-1 protein expression was shown to be low in lung tissues and high in LUAD tissues ( Figure 2A). Additionally, while low or medium protein levels were expressed in LUAD tissues, GLUT-5, GLUT-6, and GLUT-9 were not detected in normal lung tissues ( Figures 2B-D). In summary, GLUT-1, GLUT-5 GLUT-6, and GLUT-9 protein levels were overexpressed in patients with LUAD.
Correlation between SLC2As family mRNA expressions and clinical tumor stage
To further explore the relation of SLC2As with clinical characters, the association between SLC2As expressions and patients' cancer stages in LUAD patients by UALCAN database was then investigated. As shown in Figure 3, SLC2A1, SLC2A5, SLC2A10, and SLC2A11 levels tended to be higher in patients with advanced tumor stages, which shows that these molecules may be involved in the development of malignancies in LUAD patients. Furthermore, the highest expression of SLC2A1, SLC2A5, SLC2A10, and SLC2A11 was observed in stage 4, whereas SLC2A5 and SLC2A11 expression in stage 3 was lower than in stage 2. This suggests that the difference in sample sizes between stage 2 (n = 125) and stage 3 (n = 85) may be a reasonable explanation for the contradictory results. Furthermore, SLC2A3, SLC2A6, SLC2A9, SLC2A12, and SLC2A14 levels were lower in patients with advanced tumor stages, suggesting that these genes might act as a barrier to the progression of LUAD. Interestingly, the expression levels of SLC2A1, SLC2A5, SLC2A10, SLC2A11, SLC2A3, SLC2A6, SLC2A9, SLC2A12, and SLC2A14 differed in stage I LUAD tissues compared to normal tissues, suggesting that these molecules could act as non-invasive biomarkers for LUAD early detection. All of these findings open the door for these SLC2A genes to be used as possible biomarkers for the early identification and precise stratification of LUAD patients.
Construction and evaluation of SLC2Asrelated prognostic model
Kaplan-Meier plotter online tool was used to predict the value of SLC2As in gauging the prognosis of LUAD. Lower Figure 3). Furthermore, we ran univariate and multivariate Cox regression tests to see if the risk model of 14 SLC2As had distinct prognostic features for LUAD. SLC2A1, SLC2A7, and SLC2A11 were chosen as independent predictors for survival in LUAD patients in univariate Cox regression analysis, with SLC2A1, SLC2A7 serving as risk factors and SLC2A11 as a favorable factor in LUAD ( Figure 4A). SLC2A1, SLC2A7, and SLC2A11 were also statistically significant in multivariate Cox regression analysis ( Figure 4B), suggesting that these three genes may be the reliable predictors in LUAD. A nomogram based on SLC2A1, SLC2A7, and SLC2A11 to forecast the 1, 2, 3, and 5 year overall recurrence was created ( Figure 4C). The observed vs. predicted rates of the 1-, 2-, and 3-year OS showed excellent consistency in the correlation plots ( Figure 4D). While attempting to uncover predictive gene sets for LUAD using the LASSO approach , λ was chosen when the minimum sum of squared residuals was found. We ultimately discovered three genes, including SLC2A1, SLC2A7, and SLC2A11 for subsequent multivariate analysis ( Figures 5A,B). The risk score of 3 genes was also calculated for further univariate and multivariate Cox regression analyses. The hazard ratio between the low-expression sample and the high-expression sample is represented as HR (High risk).
Based on the integrated model with cutoff values at the median expression of the three candidate genes, patients were categorized into high-risk and low-risk groups. The selected dataset's risk score, survival period, and survival status. Risk score is shown in the top scatterplot, ranging from low to high ( Figure 5C). The risk score of various samples, which corresponds to survival time and survival status, is represented by the scatter plot distribution ( Figure 5D). The gene expression from the signature is displayed in the bottom heatmap. SLC2A1 and SLC2A7 levels that were higher and SLC2A11 levels that were lower indicated significant risk in LUAD patients ( Figure 5E). The risk model from the dataset underwent a Kaplan-Meier survival analysis, and a log-rank test was used to compare Frontiers in Pharmacology frontiersin.org Frontiers in Pharmacology frontiersin.org 07 the outcomes of the various groups. Compared to the low-risk group, the high-risk group consistently had a poor prognosis ( Figure 5F). By using ROC curves, we also compared the prognostic effect of risk factors. Areas under the curve (AUC) for 1-year OS, 3-year OS and 5-year OS were 64.8%, 67.1%, and 61.3%, respectively ( Figure 5G), demonstrating that the combination of SLC2A1, SLC2A7, and SLC2A11 might serve as a marker of prognosis of LUAD.
Methylation levels of SLC2As in LUAD patients
The upstream factor that dysregulates the expression of SLC2A was then identified. DNA methylation, one type of epigenetic change, involves adding a methyl group to the cytosine's C5 position to create 5-methylcytosine. This occurs primarily at CG and CH (CH = CA, CT, and CC) locations (Wang et al., 2021). It has been suggested that DNA methylation has a role in a variety of biological processes, particularly the genesis of cancer. Next, we attempted to investigate how DNA methylation by SLC2As affects LUAD. According to data from the UALCAN database, LUAD patients' tumor tissues had hypomethylation of SLC2A1, SLC2A2, SLC2A5, SLC2A6, SLC2A7, SLC2A11 and hypermethylation of SLC2A3, SLC2A10, and SLC2A14 compared to normal tissues ( Figure 6).
Construction of a network of SLC2As and co-expressed genes and identification of potential "hub" genes The functions and pathways in which SLC2As are involved in LUAD patients will next be further clarified. We performed GO and KEGG enrichment analyses to investigate the biological functions of the co-expression profiles of SLC2A1, SLC2A5, SLC2A6, and SLC2A9 in LUAD patients (whose protein (Figures 7A-D). The genes that co-express SLC2A1 were primarily enriched in the centromeric region of the chromosome and were grouped during the mitotic cell cycle process. SLC2A5-coexpressed genes were particularly rich in those that negatively regulated immune system function, immunological receptor activation, and osteoclast differentiation. Lymphocyte activation, cytokine-mediated signaling pathways, and the positive modulation of immune response were among the gene functions enriched in SLC2A6 co-expression. The regulation of cytokine production, the positive regulation of immune response, and the regulation of cell activation were all enriched in the genes co-expressed with SLC2A9. According to the degree score of each gene node, the CytoHubba plugin for Cytoscape selected the top 10 core genes ( Figures 7E-H, e-h). The core gene BUB1B (e), which was engaged in the mitotic cell cycle process and might be the most significant gene among those connected with SLC2A1, had the highest degree score. CD86 (f), a gene involved in the negative regulation of immune system activity, was the most significant gene for SLC2A5. The gene PLEK (g), which was involved in lymphocyte activation, was the most significant gene for SLC2A6. The CD4 (h) gene, which controlled cytokine production, was the most significant gene for SLC2A9. These results suggest that SLC2As are implicated in LUAD through orchestrating immune cells.
SLC2As expressions are correlated with infiltration of immune cells
Different illness states can stimulate immune cells (Fridlender et al., 2009;Murray, 2017). In LUAD patients, we attempted to determine whether SLC2As are correlated with the marker genes of different immune cell types, such as CD8 + T cells, monocytes, T cells (general), M1 and M2 macrophages, B cells, neutrophils, tumor-associated macrophages (TAMs), natural killer cells, and DCs. We also examined T cells with various subtypes, including fatigued T cells and T-helper type 1 (Th1), Th17, Th2, and Treg (Supplementary Material S4). SLC2As substantially linked with the majority of marker genes of various types of immune cells and diverse functional T cells in LUAD after tumor purity-correlated modifications. SLC2A3, SLC2A5, and SLC2A14 expressions were all shown to be substantially linked with M2 macrophages and monocytes. Additionally, SLC2A6 expression was highly connected with M2 macrophages, M-DC, monocytes, and Treg cells, while SLC2A9 expression was significantly correlated with T cells, Th1 cells, and monocyte infiltration (Supplementary Material S2; Figure 4). Expressions of SLC2A6 and SLC2A9 were positively correlated with TAMs (Supplementary Material S4). These findings show how these molecules are involved in enlisting and activating various immune cell subtypes to take part in the pathogenesis of LUAD. Additionally, there was a positive correlation between the levels of SLC2A3, SLC2A5, SLC2A6, SLC2A9, and SLC2A14 and markers of T cell exhaustion (TCE) (PDCD1, CTLA-4, LAG3, HAVCR2, GZMB), identifying that the elevated level of these molecules implied the presence of TCE in LUAD (Figure 8). The mRNA expression in clinical samples of LUAD We selected SLC2A3, SLC2A6, SLC2A9, and SLC2A14 as verified targets in our clinical samples since prior research has demonstrated higher expression of SLC2A1 and SLC2A5 in LUAD patients. Patients numbers 2 and 6 had lower levels of SLC2A3, SLC2A6, SLC2A9, and SLC2A14 than the surrounding normal tissue. However, patient number 1 had elevated levels of SLC2A3, SLC2A6, and SLC2A14, whereas patient number 3 had elevated levels of SLC2A3, SLC2A6, and SLC2A9. In patient number 4 and 5, elevated levels of SLC2A3, SLC2A6, SLC2A9, and SLC2A14 were discovered (As shown in Figure 9; Supplementary Material S5).
Discussion
Three classifications have been established for GLUTs (Hardie and Ashford, 2014). Class 1, which includes GLUTs 1-4 and GLUT-14 and contains glucose as its substrate, has a substantially lower affinity for fructose (Mueckler and Thorens, 2013). GLUT-5, GLUT-7, GLUT-9, and GLUT-11 are all members of class 2. Fructose serves as GLUT-5's primary substrate, and it has a higher affinity for it than for glucose (Tatibouët et al., 2000). While GLUT-7 and GLUT-11 have the same affinity for glucose as fructose (Manolescu et al., 2007;Cheeseman, 2008) GLUT-9 transports urate along with fructose in the physiological range (Cheeseman, 2008;So and Thorens, 2010). Class 3, which consists of GLUT-6, GLUT-8, GLUT-10, Frontiers in Pharmacology frontiersin.org , is challenging to characterize. The existing evidence indicated that GLUT-12 transports glucose (Macheda et al., 2005) and GLUT-13 transports myo-inositol (Holman, 2020). However, it is still unknown what the other members substrates are (Holman, 2020). SLC2As have reportedly been implicated in multiple diseases, including cancer. This study is the first comprehensive biological analysis of the 14 SLC2A genes in LUAD patients. The results of the researchers' numerous studies on SLC2As expressions in LUAD at the mRNA and protein levels are Frontiers in Pharmacology frontiersin.org 12 inconsistent or even conflicting. One study identifies SLC2A1 may be a crucial glucose transporter in LUAD patients as SLC2A1 mRNA and protein levels are elevated in LUAD patients, and its overexpression is a potential indicator for lower differentiated tumor grade and poor prognosis (Younes et al., 1997a;Minami et al., 2002;Maki et al., 2013;Chai et al., 2017;Weng et al., 2018a;Guo et al., 2020). However, another study demonstrates that GLUT-1 protein expression is absent in healthy lung tissues but positive in 14 of 24 adenocarcinomas and that the levels of expression are correlated with greater tumor sizes, less differentiation of the tumor, and positive lymph node metastases (Ito et al., 1998). LUAD patients did not exhibit altered SLC2A3 and SLC2A5 expressions at the mRNA level when compared to healthy donors. However, compared to the primary tumor, lung cancer metastases have higher levels of SLC2A3 and SLC2A5, highlighting their significance in tumor metastasis (Kurata et al., 1999). Another study uses immunohistochemical analysis to show that GLUT-3 and GLUT-5 are expressed at the same levels as those of healthy lung tissues (Holman, 2020), while GLUT-4 expression is positive and GLUT-2, GLUT-3, and GLUT-5 are negative in LUAD patients (Brown et al., 1999). Regarding GLUT-3 protein levels, numerous investigations show that they are absent in healthy lung tissues (Younes et al., 1997b) and increased in nonsmall cell lung cancer (de Geus-Oei et al., 2007;Suzawa et al., 2011). Compared to healthy tissues, the level of SLC2A5 mRNA is higher in LUAD tissues. Additionally, a worse prognosis is connected to SLC2A5 overexpression (Weng et al., 2018a; Frontiers in Pharmacology frontiersin.org Weng et al., 2018b). GLUT-3, GLUT-4, and GLUT-5 have been discovered to be overexpressed in LUAD patients at the protein level (Younes et al., 1997b;Flavahan et al., 2013;Chai et al., 2017). In a different study, GLUT-2, GLUT-3, GLUT-4, GLUT-5, GLUT-6, GLUT-9 expression levels were tested in lung adenocarcinoma and only GLUT-3 is positive in 1 of 8 lung adenocarcinoma patients (Godoy et al., 2006). Neither GLUT-3 nor GLUT-4 is positively stained in normal lung epithelia while lung cancers have elevated levels of SLC2A3 and SLC2A4 (Ito et al., 1998). H1299 (NSCLC cell line) has high SLC2A12 mRNA expression (Zawacka-Pankau et al., 2011), while lung cancer cell line A549 has high levels of GLUT-12 expression (Pujol-Gimenez et al., 2015). The predictive value of the SLC2As in LUAD patients has also been examined. Increased GLUT-3 levels are a potential indicator of a poor prognosis and a biomarker for lower tumor differentiation in Stage I non-small cell lung cancer patients, highlighting the significance of GLUT-3 for early diagnosis and prognostic accuracy (Younes et al., 1997b;Maki et al., 2013). According to a different study, patients with NSCLC who have high levels of the mRNAs SLC2A1, SLC2A2, SLC2A3, SLC2A4, SLC2A5, SLC2A6, SLC2A7, SLC2A9, SLC2A11, and SLC2A14 have a considerably worse overall survival (Du et al., 2020). Downregulated levels of SLC2A10 in lung cancer indicate a poor prognosis and increased aggressiveness of tumors, suggesting that SLC2A10 may play a crucial role in the progression of cancer (Jian et al., 2021).
In our study, we show that transcriptional levels of SLC2A1, SLC2A5 are upregulated and those of SLC2A3, SLC2A6, SLC2A9, SLC2A14 are downregulated in LUAD patients, supporting the role of SLC2A1, SLC2A5 as oncogenes and SLC2A3, SLC2A6, SLC2A9, SLC2A14 as tumor suppressor genes. Inhibiting GLUT-1, GLUT-5, GLUT-6, and GLUT-9 may be used as a therapy for LUAD patients as a result of the increased protein levels of these enzymes that were shown in our study. SLC2As' mismatched mRNA and protein levels in LUAD patients could be explained by changes in turnover (transcription and degradation), as well as post-transcriptional and post-translational modifications like phosphorylation, acetylation, ubiquitination, and methylation, as well as sumo of the SLC2As or GLUTs. Furthermore, the upregulation of GLUT-1, GLUT-5, GLUT-6, and GLUT-9 suggests that fructose and glucose may both play important roles in LUAD metabolism, supporting the development of blockades for these molecules as potential new medications or biomarkers for the treatment or detection of LUAD. Reexamining the mRNA expression of SLC2A3, SLC2A6, SLC2A9, and SLC2A14 revealed that 2 of 6 patients had lower levels of these genes than those predicted by RNA-seq methods in LUAD samples. The results from the other four LUAD patients were different, showing higher levels of SLC2A3, SLC2A6, SLC2A9, and SLC2A14 in LUAD patients. The differing experimental platforms could be the cause of the varied expression levels between RNA-seq and q-PCR. Nearly the whole exon region of a gene is covered by RNA-seq, which also considers the expression levels of each exon region. However, q-PCR does not account for the entire length of the gene when designing primers or amplifying.
Because patients in the same phase might have quite different clinical outcomes, even at an early stage, it is important to identify novel tumor biomarkers in order to accurately estimate patient prognosis and predict responsiveness to a specific therapy. The next step is to assess if tumor stages can be identified based on SLC2As expression levels. A lower differentiation grade tumor is implied by overexpression of SLC2A1, SLC2A5, SLC2A10, SLC2A11and lower levels of SLC2A3, SLC2A6, SLC2A9, SLC2A12, and SLC2A14, emphasizing the possibility of these molecular roles for predicting the course of the tumor. Interestingly, the expression levels of SLC2A1, SLC2A3, SLC2A5, SLC2A6, SLC2A7, SLC2A9, SLC2A10, SLC2A11, SLC2A12, and SLC2A14 all differed in stage 1 compared to normal tissues, strongly proposing these molecules as possible markers for the early diagnosis of LUAD. Secondly, we establish the importance of low levels of SLC2A1, SLC2A2, SLC2A3, SLC2A4, SLC2A5, SLC2A9, SLC2A14 and high levels of SLC2A10, SLC2A12, and SLC2A13 as biomarkers for favourable prognosis. Results for SLC2A1, SLC2A3, SLC2A5, and SLC2A10 are in line with earlier investigations. It is intriguing that individuals with LUAD who had high levels of SLC2A9 and SLC2A14, which were previously identified as suppressor genes in our investigations, have lower survival rates. We think that these molecules may be the source of the resistance to chemotherapy and radiation. Analyses using the LASSO technique are used to investigate the most important factors. SLC2A1, SLC2A7, and SLC2A11 are three SLC2As that have been discovered as possible predictive biomarkers. SLC2A11 is an indicator of a favorable outcome in LUAD, but high expression of SLC2A1 and SLC2A7 is a characteristic of an adverse prognosis. The combination of SLC2A1, SLC2A7, and SLC211 is also supported by the ROC curve as a possible biomarker for 1year, 3-year, and 5-year survival. In conclusion, SLC2As may someday serve as critical clinical markers for LUAD patients, allowing for earlier identification, more precise risk classification, and individualized survival prediction.
The role of epigenetic regulators, such as DNA methylation, on SLC2As deregulation, was identified using the UALCAN database to investigate the upstream mechanisms causing the abnormal SLC2As expression. Focusing on how epigenetic alteration affects cancer etiology, both suppressor gene suppression caused by excessive methylation in gene promoters and oncogene activation or chromosomal instability caused by widespread hypomethylation can occur in malignancies (Merlo et al., 1995;Rosty et al., 2002;Gaudet et al., 2003). Particularly, the development of DNA methylation liquid biopsy has made early cancer diagnosis and treatment recommendations Frontiers in Pharmacology frontiersin.org possible (Brikun et al., 2018;Shen et al., 2018;Zhao et al., 2018). In our research, hypomethylation occurs on oncogenes including SLC2A1, SLC2A5, SLC2A7, and SLC2A11. Additionally, hypermethylation of tumor suppressor genes, such as SLC2A3 and SLC2A14, is observed in LUAD patients, suggesting that DNA methylation may be the cause of the aberrant expression of SLC2As in LUAD. There is a lot of interest in treatments that target epigenome alterations, such as DNA methyltransferases (DNMTs). DNMTs have been used as anti-cancer drugs, specifically as potential chemotherapy or radiotherapy sensitizers, to increase treatment efficacy (Gravina et al., 2010). Given the significance of DNA methylation affects SLC2As, DNMTs have a potential for correcting these aberrant SLC2As expressions in LUAD. To determine the level of DNA methylation in LUAD, future studies will need to carefully implement animal and cell line research. These results will lay the groundwork for DNA methylation as sensitive prognostic, predictive biomarkers, and therapeutic targets in LUAD. What role did the aberrant SLC2As play in LUAD pathogenesis? Due to the co-expressed genes' enrichment in GO and KEGG pathways associated with immune cells, we concentrate on the relationship between SLC2As and immunological signatures. Recently, numerous tumors have been successfully treated using a variety of immunotherapy techniques, including immune checkpoint blockades (PD-1, CTLA4), cellular therapy, and therapeutic vaccinations, including LUAD (Del Paggio, 2018;Christofi et al., 2019). However, not every immunotherapy is successful in treating patients due to patients' limited tumor immunity and the heterogeneity of checkpoint inhibitors (Sasidharan Nair and Elkord, 2018;Liu et al., 2020). In addition, tumor cells are prone to switch from oxidative metabolism to glycolysis and lactic acid fermentation even in normal conditions. The metabolic alteration leads to hypoxia, production of acid, poor in nutrients and abundance of immune-modulatory metabolites, consequently contributing to the resistance to immunotherapy (Ramapriyan et al., 2019). Therefore, we aim to better understand the connection between SLC2As and immune cell infiltration in LUAD, which will aid in identifying patients who may benefit from immune therapy. The alteration of the tumor microenvironment caused by circulating monocytes and macrophages, which are drawn to the tumor, promotes the growth of malignancies (Chanmee et al., 2014). Macrophages are generally classified into two subpopulations, classically activated pro-inflammatory macrophages (M1) and alternatively activated macrophages (M2). M2 macrophages are involved in promoting the growth and invasion of lung cancer cell, while M1 mac rophages inhibit lung cancer cell proliferation and activity via increasing cancer cell chemical sensitivity and decreasing angiogenesis (Yuan et al., 2015). It is interesting to note that in LUAD patients, M2 and monocyte expression levels are favorably linked with SLC2A3 and SLC2A5 expression levels. Th1, monocytes, and T cells had a positive correlation with SLC2A6 levels. M2, TAM, M-DC, monocytes, and Treg cells all exhibit favorable correlations with SLC2A9 expression levels. In LUAD patients, SLC2A14 expression is favorably linked with M2, monocytes, and TAM. These findings reveal that members of the SLC2A family may contribute to carcinogenesis by controlling M2 polarization and drawing monocytes and Tregs to tumor locations. However, more research into the underlying mechanism is still required. Additionally, it has been suggested that TCE plays a role in various malignancies and chronic infections, a condition marked by a decline in T cell activity, persistent expression of inhibitory receptors, and a transcriptional state distinct from that of functioning effector or memory T cells and inhibiting pathways elevated in exhaustion can reverse the dysregulated state and reinvigorate immune responses (Wherry and Kurachi, 2015). According to our findings, expression of SLC2A3, SLC2A5, SLC2A6, SLC2A9, and SLC2A14 is positively correlated with the TCE marker gene, suggesting that these molecules may reflect the presence of TCE in LUAD. All these findings supported the use of SLC2A3, SLC2A5, SLC2A6, SLC2A9, and SLC2A14 as therapeutic targets and biomarkers for evaluating the effectiveness of immunotherapy.
Finally, we suggest multiple pathways in which SLC2As were involved in LUAD, including SLC2A1/BUB1B/mitotic cell cycle, SLC2A5/CD86/negative immune system process regulation, SLC2A6/PLEK/lymphocyte activation, and SLC2A9/CD4/ cytokine production regulation. The results that an increased level of GLUT-1 is positively correlated with F-18 fluorodeoxyglucose (FDG) uptake indicate the involvement of GLUT-1 in the accumulation of FDG in LUAD patients (Brown et al., 1999;Gu et al., 2006;Wink et al., 2017;Vanhove et al., 2019). However, as confounders in PET positron emission tomography-computer tomography (PET-CT) analysis, inflammatory pseudotumor, tuberculoma, and organizing pneumonia may present a similar picture with lung malignancies. We hypothesize that the combination of GLUT-1, GLUT-5, GLUT-6, and GLUT-9 may distinguish the inflammation (necrosis) lesions from malignancies in light of the increased protein expression of GLUT-1, GLUT-5, GLUT-6, and GLUT-9 in LUAD patients in our study. However, the hypothesis needs further investigation.
GLUT inhibitors have been used in numerous studies to treat NSCLC. A GLUT-1 inhibitor called WZB117 prevents the proliferation of the NSCLC cancer cells (H1299 and A549) (Liu et al., 2012). Oxime-based GLUT-1 inhibitors reduce the proliferation of the cancerous H1299 cell line (Tuccinardi et al., 2013). The GLUT-2 inhibitor quercetin lowers the risk of developing lung cancer (Rastogi et al., 2007). Small interfering RNA (siRNA) for GLUT-1 increases NSCLC cell susceptibility to gefitinib treatment (Suzuki et al., 2018). Anti-GLUT-1 antibodies reduce non-small cell lung cancer cell growth by 50% (Rastogi Frontiers in Pharmacology frontiersin.org et al., 2007). However, the findings that both glucose and fructose are energy sources in LUAD remind us that cancer cells can switch to a different option for their energy requirements, so we recommend that the best course of action may be to completely inhibit GLUT-transporters. Blocking GLUT-1, GLUT-5, GLUT-6, and GLUT-9 may display beneficial efficiency in LUAD therapy. A better understanding of the universal expression profiles of GLUTs and the tissue distribution of GLUTs will pave the way for transforming the GLUT inhibitors into clinical application in LUAD.
Conclusion and outlooks
The prognosis of patients with LUAD can be correctly stratified with the use of a thorough examination of their metabolic profiles. Our findings might suggest SLC2As as biomarkers that could help distinguish between low-risk LUAD patients and advanced LUAD patients. Moreover, SLC2As could serve as prognostic signatures to predict 1, 3, and 5 year survival in LUAD patients. SLC2As are abnormally expressed in LUAD due to DNA methylation, and SLC2As that are dysregulated promote LUAD by changing the immunological microenvironment. We also suggest several pathways that could be involved in LUAD, including SLC2A1/BUB1B/mitotic cell cycle, SLC2A5/CD86/negative immune system process regulation, SLC2A6/PLEK/lymphocyte activation, and SLC2A9/CD4/cytokine production regulation. These findings open the door to the use of these SLC2A molecules as LUAD biomarkers and treatment targets.
Due to their propensity to mimic other inflammatory diseases, cancers diagnosed by PET-CT were likewise less sensitive and specific. GLUTs should work together as radiotracers to efficiently image LUAD tumors and provide early identification, accurate tumor grading, and prognosis prediction.
The future trend will be to completely inhibit GLUT-1, GLUT-5, GLUT-6, and GLUT-9 as therapeutic targets. Our findings revealed that LUAD uses fructose (a GLUT-5 and GLUT-9 substrate) as a different type of energy source. Since GLUT-5 and GLUT-9 are not universally expressed as GLUT-1, blocking the transport of fructose may be an appealing method to inhibit the metabolism of glucose. In other words, it is important to consider the high specificity. We advise exosomes or nanoparticles loaded with GLUT inhibitors as a viable option that might be safely and conveniently delivered to combat LUAD.
The GLUT function has previously been studied using cell lines, but this method has the disadvantage of not compressing other tissue-matrix components. To shed light on the significance of glucose carriers in LUAD patients, it is necessary to conduct these experimental and clinical trial tests in SLC2A conditional knockout mice, which enable GLUT knocking out in specific cells. Another related problem is that we still do not fully comprehend how SLC2As regulate various immune cell subtypes, such as TCE, M2, T cells, and monocyte in LUAD.
Data availability statement
The original contributions presented in the study are included in the article/Supplementary Material, further inquiries can be directed to the corresponding author.
Ethics statement
The studies involving human participants were reviewed and approved by The Academic Committee of The First Hospital of Jilin University. The patients/participants provided their written informed consent to participate in this study.
|
v2
|
2022-11-28T15:02:26.855Z
|
2022-11-28T00:00:00.000Z
|
254020340
|
s2orc/train
|
Increased prevalence of human papillomavirus in fresh tissue from penile cancers compared to non-malignant penile samples: a case-control study
Background HPV has been detected in approximately 50% of invasive penile cancers but with a large span between 24 and 89%, most likely due to different types of tumors and various methods for HPV analysis. Most studies of HPV in penile cancer have been performed using paraffin-embedded tissue, argued to be at risk for contaminated HPV analysis. Viral activity of HPV, by the use of HPV mRNA expression is well studied in cervical cancer, but seldom studied in penile cancer. The aim was to determine prevalence of HPV types in fresh tissue of penile cancers compared to non-malignant age-matched penile controls. Additional aims were to analyze the viral expression and copy numbers of HPV16-positive tumors and 10 mm adjacent to the tumor. Methods Fresh tissue from penile cancer cases was biopsied inside the tumor and 10 mm outside the tumor. Controls were males circumcised for non-malignant reasons, biopsied at surgery. PCR and Luminex assays were used for identification of HPV types. HPV16-positive samples were investigated for copy numbers and expression of HPV16-mRNA. Results Among tumors (n = 135) and age-matched controls (n = 105), HPV was detected in 38.5% (52/135) and 11.4% (12/105), respectively (p < 0.001), adjusted odds ratio 12.8 (95% confidence interval 4.9–33.6). High-risk HPV types were found in 35.6% (48/135) of tumors and 4.8% (5/105) of controls (p < 0.001). Among tumors and controls, HPV16 was present in 27.4% (37/135) and 1% (1/105), respectively (p < 0.001). Among HPV16-positive penile cancers, mean HPV16 viral copy/cell was 74.4 (range 0.00003–725.4) in the tumor and 1.6 (range 0.001–14.4) 10 mm adjacent from the tumor. HPV16-mRNA analysis of the tumors and 10 mm adjacent from the tumors demonstrated viral activity in 86.5% (32/37) and 21.7% (5/23), respectively. Conclusions The prevalence of HPV was significantly higher in penile cancer (38.5%) than among age-matched non-malignant penile samples (11.4%). HPV16 predominates (27.4%) in penile tumors. HPV16 expression was more common in penile cancer than in adjacent healthy tissue, strongly suggesting an etiological role for HPV16 in the development of penile cancer. Supplementary Information The online version contains supplementary material available at 10.1186/s12885-022-10324-w.
Background
Penile cancer is a rare cancer worldwide, with an incidence of 0.45-1.7/100000 in Europe [1]. In Sweden the overall five-year relative survival is 82% [2]. Histologically, penile cancer is classified as squamous cell carcinoma (SCC) in about 95% of cases [3]. Different histological morphologies of SCCs are observed in penile cancer with usual type (keratinized), verrucous, basaloid, and warty being most prevalent. Human papillomavirus (HPV) is frequently detected in basaloid, warty and warty-basaloid penile SCC-lesions [4].
Two major pathways of malignant transformation to penile cancer have been described; one HPV-driven and the other derived from inflammatory skin diseases such as lichen sclerosus (LS) and lichen planus (LP) [5]. Other risk factors are phimosis, balanitis, smoking, treatment with Psoralen plus ultraviolet light A (UVA) and immunosuppression following organ transplantation [6][7][8][9].
HPV has been detected in approximately 50% of invasive penile cancers but with a large span between 24 and 89%, most likely due to different types of tumors and various methods for HPV analysis [10][11][12][13]. HPV types are classified as low-risk (LR) or high-risk (HR) depending on their oncogenic potential [14]. According to WHO, the following HR types are oncogenic HPV16, 18,31,33,35,39,45,51,52,56, 58, and 59 [14]. Most studies of HPV in penile cancer have been performed using paraffin-embedded tissue, argued to be at risk for contaminated HPV analysis [15,16]. Only a few studies have been performed using fresh tissue from penile cancer [12,17,18].
Viral activity of HPV, by the use of HPV mRNA expression is well studied in cervical cancer [19,20], but seldom studied in penile cancer [21].
To the best of our knowledge no study has been published analyzing HPV among biopsied fresh tissue from both penile cancer and from age-matched penile nonmalignant samples.
The primary aim of this study was to determine the prevalence of different HPV types in fresh tissue of invasive penile cancer and 10 mm adjacent to the tumor, and to compare that to corresponding HPV prevalence in fresh biopsies from age-matched non-malignant penile controls. A secondary aim was to conduct a blinded review of subtype of penile cancer and correlate penile cancer subtype to the prevalence of HPV. Furthermore, we aimed to determine copy numbers, status of integration and viral activity among HPV16-positive samples inside the tumor and 10 mm adjacent to the tumor.
Materials and methods
The study was approved by the ethical board in Lund with diary number 2015/907. Inclusion criteria were men over 18 years, having penile cancer surgery at Skane University Hospital (SUH) in Sweden between 22nd of June 2015 and 10th of August 2021. SUH is one of two national referral centers for penile cancer. Excised tumor tissues were transported fresh to the Department of Pathology, SUH and a 3 mm single-use punch biopsy was taken from the tumor and submerged in 1 mL RNAlater (Ambion). Another 3 mm single-use punch biopsy was taken 10 mm outside the macroscopic margins of the tumor and submerged in 1 mL RNAlater (Ambion).
Controls comprised age-matched men over 18 years, circumcised for non-malignant reasons at urological departments in Skane. At surgery, a biopsy of approximately 5 mm was taken from excised penile skin, and submerged in 1 mL RNAlater (Ambion) as described [22].
The biopsies were transported to the Department of Microbiology where they were transferred to 1 mL GITSsolution (4 M guanidinium thiocyanate, 22 mM NaCitrate and 5% Sarcosyl (N-Lauroylsarcosine sodium salt) and 1% mercaptoethanol) and incubated at room temperature overnight. Then DNA was extracted with the Total NA-kit (Roche, Stockholm, Sweden) using MagNA Pure LC (200 μL input and 100 μL output). Sample adequacy was assessed by testing 5 μL of the sample for the human beta globin gene with a real-time PCR [23]. Simultaneous identification of 40 genital HPV types was carried out by MGP-PCR in 25 μL, containing 5 μL of extracted material and subsequent Luminex analysis [24,25] The integration of HPV-DNA into the human genome most frequently disrupts the E2 gene [26]. As a surrogate marker for the physical status of HPV16, the quantity of HPV16 E2 gene was determined as described by Letsolo et al. [27]. We used the mean log10 values of E2 and E7 copy numbers from each sample and calculated the ratio of E2/E7 gene copy numbers of HPV16 to investigate the presence of integrated, mixed and episomal forms common in penile cancer than in adjacent healthy tissue, strongly suggesting an etiological role for HPV16 in the development of penile cancer.
Keywords: Penile cancer, Human papillomavirus, HPV. HPV16 expression, Non-malignant penile controls of HPV16. HPV16 was classified as follows: 'integrated' when no E2 copy numbers could be detected and E7 copy numbers were present; 'mixed status' when E2/E7 ratios were 0.1-0.8; and 'episomal status' when the presence of E2/E7 copy number ratio was > 0.8. The samples were analyzed in duplicate. In addition, another aliquot (200 μL) of the GITS-lysate was used for mRNA extraction using the Oligotex Direct mRNA Mini Kit (Qiagen). The extraction was performed according to the manufacturer's protocol for isolation of PolyA mRNA from animal tissues. The mRNA was eluted by adding 45 μL of Oligotex elution buffer (70 °C) to the column and centrifuging for 1 minute at maximum speed. Purified mRNA was stored at − 80 °C until use. Quantitative PCR of HPV16 E7 mRNA was analyzed in triplicate and performed as previously described [27]. To compensate for the smaller elution volume of the mRNA extraction (45 μL) compared to that of the DNA extraction (100 μL), the HPV16 mRNA copy numbers were divided by 2.5. The HPV16 mRNA expression level was given as HPV16 mRNA copy numbers per HPV16-DNA copy.
Histopathological diagnosis and classification of the subtype of penile cancer was retrospectively reviewed by two experienced pathologists subspecialized in uropathology and participating in the national multidisciplinary team conference of penile cancer in Sweden. A recent study showed that pathologists who have experience of penile cancer diagnostics have a good concordance in identifying HPV-related and non-HPV-related histological subtypes of penile cancer [28].
The glass slides were retrieved from the pathology archive, and one representative slide of the tumor was chosen for each case in hematoxylin-eosin (H&E) stain. Assessment of histological subtype and histological grade was carried out using glass slides (106 cases) and high-resolution digital slides (40 cases). The slides were scanned using NanoZoomer S360 (S60 for large histologic sections) by Hamamatsu, and Sectra IDS7 software. The pathologists were blinded to the results of the HPV detection by PCR in the tumor material to avoid any bias in tumor assessment. The histological subtypes were determined according to the WHO criteria in "Classification of tumors of the urinary system" and the International Society of Urological Pathology recommendations (2016) [4,29]. For classification of stage TNM 8 was used. Following the separate assessment of all cases, the results were compared to identify eventual discrepancies, which were found in six cases where the diagnosis was difficult to make without HPV status. p16INK status was used in five cases and HPV result in one case and thereby the pathologists agreed upon the final diagnosis.
Circumcised skin was subjected to routine histopathological examination at the Department of Pathology at SUH. All specimens were stained with haematoxylin and eosin. All diagnoses were performed by the expert team of six uro-pathologists belonging to the Swedish national Penile Cancer Center in Malmö.
All cases and controls completed a questionnaire, regarding medical history, medication, smoking habits, number of sexual partners and former symptoms and procedures performed on the penis (Supplementary 1). Controls completed the questionnaire in connection with the circumcision, while penile cancer cases completed the questionnaire after surgery. If the questionnaire was not returned, a new letter was sent to the patient and if not returned, the patient was informed by phone and if necessary, a further questionnaire was sent.
Statistical analysis
The statistical analysis was performed using SPSS, version 26, IBM Statistics, IBM Corp., Armonk, NY, USA. Correlation was calculated with Chi-square tests and Fisher's exact test in small numbers. When p < 0.2, odds ratios were calculated with multiple logistic regression adjusted for > 10 sexual lifetime partners, smoking, former smoking, former skin disease, former phimosis, former penile biopsy, former penile surgery and former genital warts.
Results
The study included 135 men with penile cancer, with a median age of 72 years (interquartile range 66-79 years) (Fig. 1). Histopathological tumor stage according to the TNM-classification was pT1 in 25.2% (34/135) of cases, pT2 in 48.1% (65/135), pT3 in 25.9% (35/135) and pT4 in 0.7% (1/135). The 135 penile cancer cases, were agematched within +/− 2 years with 105 controls circumcised for non-malignant reasons, median age 71 years (interquartile range 62-76 years) ( Table 1). The vast majority of both cases and controls were heterosexual, having sex only with women. A history of phimosis was more common among the penile cancer cases than among the controls, 55.1 and 37.6%, respectively, (p = 0.017). Having previously had a punch biopsy taken for histopathologic evaluation was more common among the penile cancer cases (20.5%) than the controls (2%), (p < 0.001). Previous surgery on the penis was more common among the penile cancer cases (31.5%) than among the controls (11.9%), (p = 0.001). Having had a diagnosis of penile cancer before was only seen in the penile cancer cases (11.6%) and not among the controls 0%.
Adjacent to the tumor, HPV was found in 30.3% (40/132) of the samples. HR HPV types were detected in 25.8% (34/132) of the samples, with HPV16 present in 17.4% (23/132). Only LR HPV types were seen in 4.5% (6/132) of the samples. All cases of HPV occurrence adjacent to the tumor also had at least one HPV type identical to that in the tumor, except for one case where HPV6 was adjacent to the tumor but HPV-negative in the tumor. In two samples 10 mm adjacent to the tumor, the HPV analysis was not adequate, due to no detectable human DNA in the sample. In one sample 10 mm adjacent to the tumor, the analysis was not performed.
Discussion
To the best of our knowledge, this is the largest study using fresh penile cancer tissue for HPV analysis, and the only one with age-matched penile controls. We observed that HPV was three times more common in invasive penile cancer (38.5%) than in non-malignant controls (11.4%), and that HR HPV was seven times more common in invasive penile cancer (35.6%) than in non-malignant controls (4.8%). HPV16 was the predominant HPV type.
Only a few other studies have searched for the presence of HPV in fresh penile tissue. Martins et al. found HPV in 89% (49/55) of penile cancer cases, which was substantially higher than our HPV prevalence (38.5%) among invasive penile cancer cases [12]. In comparison to our PCR method, they used a different approach with nested PCR, which in general has high analytical sensitivity but could be affected by an increased risk of cross-contamination [30]. However, our result is more like that of Levi et al., who found 56% HPV in fresh penile cancer tissue in Brazil [17]. In addition, our HPV prevalence (38.5%) among the penile cancer cases is in alignment with the average HPV prevalence of around 50% among penile cancers [13] as well as that of cancer of the vulva, which is in the range between 34 and 45% [31].
In our study, HPV16 was found to be the predominant HPV type, in agreement with other studies of HPV in penile cancer [13].
In the present study we analyzed HPV also outside of the tumor in order find out possible differences between tumors and adjacent healthy tissue. Interestingly, HPV was relatively frequently detected (30.3%) in the tissue adjacent to the tumors. However, there was a tendency of a higher proportion of HPV16 positive tumors compared to that of the adjacent tissue (27.4% vs. 17.4%, p = 0.0573). Furthermore, our finding of a higher prevalence of HPV16 viral activity in penile cancer cases (86.5%), than in samples taken adjacent to the tumor (21.7%), suggests that HPV is more active in the tumor and probably has a role in the malignant transformation process.
The observed mean HPV16 viral load (74.4 virus copies per cell) in the tumor was similar to that of Heideman et al., who found a mean HPV16 load of 72 copies per cell [21]. Other studies on viral load in penile cancer are scarce, but viral load in penile cancer appears to be low compared to viral load in the vulva, where a median of 14,676 HPV16 copies/cell (range between 499 and 1,477,442) was observed [32]. Integration of HPV in our study was 40.5% (15/37), which was much lower than in a study by Huang et al. using highthroughput viral integration detection (HIVID) in frozen specimens from penile cancer surgery and showing Table 3 HPV type distribution among 135 penile cancer subtypes and in 105 non-malignant penile controls HR High risk, LR Low risk. *HPV66, 68 and 73 were here classified as high risk, according to WHO they are potential high risk types [14] a, c, d, e, f Samples double HPV positive for marked HPV types. b One sample was positive for 4 HPV types integration of HPV in 92.1% (35/38) [33]. Interestingly, and in comparison with cervical cancer, they showed that HPV E2 was significantly less likely to be involved in HPV integration than expected (p = 1.25 × 10 − 5 ). Next-generation sequencing appears to yield a higher HPV integration rate than the E2/E7 ratio method used in our study, which is affected by limitations such as decreased detection of HPV integration when a large excess (at least 10-fold) of episomal HPV16 is simultaneously present [15].
In our study, the HPV prevalence was highest in basaloid subtypes of penile cancer (100%), followed by warty subtypes (88.9%) and warty-basaloid subtypes (85.7%). This is in alignment, but slightly higher than former studies where a meta-analysis showed the pooled prevalence of HPV to be 84% in basaloid penile cancers, 58.7% in warty subtypes and 75.7% in warty-basaloid subtypes [13].
The strengths of our study were that HPV was analyzed in fresh biopsies both in and adjacent to the tumor, and that biopsied age-matched controls were used. Another strength was that not only the presence of HPV16 DNA was studied; also the viral activity was investigated in HPV16-positive samples, both in and adjacent to the tumor. A further strength is that histological subtypes of penile tumors were reviewed by two experienced uropathologists, blinded to each other.
One limitation was that compared to the controls, who completed the questionnaire at the hospital before the treatment, there was a relatively high proportion of missing questionnaires (Table 1) from the penile cancer patients because the form had to be sent to them after the treatment and was not always returned. Regarding former smokers, another limitation of the questionnaire was that smoked pack-years were not asked for. Further limitations were that a large number of the non-malignant controls did not have normal histological tissue. In 78.1% of the controls, the histological diagnosis was LS, LP or lichenoid dermatitis, which are potential premalignant inflammatory skin diseases, with increased risk of penile intraepithelial neoplasia and penile cancer [34][35][36]. One further limitation could be the possible discrepancy in location of HPV between cases and controls since the tissue used for HPV analysis in the controls was circumcised foreskin, but the penile cancer tumors had different penile locations.
Knowledge of HPV as a strong risk factor (adjusted OR 12.8) for invasive penile cancer is important in the work of preventing penile cancer. The nine-valent HPV vaccine targets the HPV types HPV6, 11,16,18,31,33,45, 52 and 58, covering the majority of HR HPV types found here, which leads to the conclusion that vaccination of boys is important for preventing development of penile cancer. Knowledge about viral activity in penile cancer tumors, further indicates the important role of HR HPV in the malignant transformation.
|
v2
|
2022-11-28T15:02:27.408Z
|
2022-11-28T00:00:00.000Z
|
254021251
|
s2orc/train
|
Short-course pembrolizumab and continuous afatinib therapy for recurrent or metastatic head and neck squamous cell carcinoma: a real-world data analysis
Objectives The optimal duration of anti-PD-1 for cancer therapy has not been tested, especially when using combination therapy. Epidermal growth factor receptor (EGFR) pathway blocker was the top compound that enhanced T-cell killing of tumor cells in a high-throughput immune-oncology screen, possibly by stimulate the antigen presentation machinery and other mechanisms. We explored the effect of combination of EGFR inhibition with a short course of anti-PD-1 therapy in patients with recurrent or metastatic head and neck squamous cell carcinoma (R/M HNSCC). Method We analyzed the effect of a short course of anti-PD-1 with continuous afatinib on the survival of a real-world cohort of R/M HNSCC patients. Patient characteristics, treatments, efficacies, and toxicities were reviewed and recorded for analysis. Results From November 2016 to May 2018, 51 consecutive patients received pembrolizumab and afatinib. The cutoff date was June 30, 2022. The most common toxicities (all grades) were diarrhea (62.7%), skin rash (43.1%), mucositis (31.4%), and paronychia (23.5%). The objective response rate was 54.9% (95% confidence interval [CI] 40.3–68.9%). Median progression-free survival was 5.9 months (95% CI: 4.4–7.6 months), and the median overall survival was 10.5 months (95% CI: 6.8–16.5 months). The 12-month, 24-month, 36-month, and 48-month survival rate was 47.0%, 22.5%, 17.7%, and 12.6% respectively. Conclusions This retrospective study showed that short course pembrolizumab with afatinib therapy has acceptable efficacy in R/M HNSCC patients. The durable response and long-term survival rates were similar to prospective clinical trials. Short course anti-PD-1 therapy, especially in combination with EGFR blocker, is worth for further prospective study.
Introduction
Anti-programmed death-1 (anti-PD-1) antibodies, including pembrolizumab [1,2] and nivolumab [3], have been shown to be efficacious in the treatment of head and neck squamous cell carcinoma (HNSCC) in a first-line or platinum-refractory setting. However, the optimal duration of anti-PD-1 therapy for HNSCC patients has not been systemically investigated. In the CHECKMATE 141 study [3], the pivotal investigation of anti-PD-1 in HNSCC, enrolled patients took nivolumab until disease progression, intolerable toxicity, or patients' wishes to discontinue. In the KEY-NOTE 040 [1] and KEYNOTE 048 [2] studies, patients received a maximum of 35 cycles (about two years) of pembrolizumab. For other types of cancer, the duration of application of anti-PD-1 or programmed cell death ligand-1 (PD-L1) antibody was different. The duration of treatment was 12 months in an adjuvant trial using durvalumab after concurrent chemoradiation in advanced non-small-cell lung cancer patients [4]. Ipilimumab, a cytotoxic T-lymphocyte-associated protein-4 (CTLA-4) antibody, showed a durable response in metastatic melanoma patients with only four cycles of therapy [5]. These studies showed the possibility of a shorter course of anti-PD-1 for cancer therapy.
Anti-PD-1 combination therapy has been used for overcoming intrinsic resistance and improving treatment efficacy in HNSCC. Several phase II studies have shown the effectiveness of epidermal growth factor receptor (EGFR) pathway inhibition for improving anti-PD-1 efficacy in HNSCC patients. Two studies that used cetuximab with pembrolizumab [6] or nivolumab [7] for HNSCC reported an improved response rate. A phase II study using afatinib also showed activity with pembrolizumab in platinum-refractory HNSCC patients [8]. The afatinib-pembrolizumab study also showed that afatinib may augment antigen-presentation machinery in the tumor microenvironment. Retaining afatinib in cancer therapy may be a strategy to maintain an inflamed microenvironment and to enhance the efficacy of anti-PD-1.
Combing with that best partner to enhance T-cell killing of tumor cells, a shorter course anti-PD-1 therapy may be feasible. We retrospectively reviewed real-world data from a medical center in Taiwan to explore the efficacy of a short course of pembrolizumab combined with continuous afatinib for HNSCC patients.
Ethics consideration
The medical record retrospective review focusing on recurrent or metastatic HNSCC patients taking anti-PD-1 was approved by the institutional review board (IRB) of the National Taiwan University Hospital (NTUH), Taipei, Taiwan (IRB approval number: 201710031RINB). Informed consent has been waived by the IRB of NTUH, Taipei, Taiwan, as this was a retrospective study. All methods were performed in accordance with the relevant guidelines and regulations.
Data collection
Patients with head and neck cancer fulfilling the following criteria were enrolled for analysis: (1) documented HNSCC (excluding nasopharyngeal carcinoma); (2) recurrent or metastatic disease not suitable for further curative treatment; (3) no other concurrent cancers; and (4) taking a combination of pembrolizumab and afatinib for palliation. After obtaining positive results in a phase II trial [8], we focused on patients taking a short course of pembrolizumab with continuous afatinib in this realworld data set. Patients were excluded if they took pembrolizumab until disease progression or completing 35 cycles of therapy.
The study analyzed the following characteristics: age, the curative treatment plan, and history of chemotherapy or anti-cancer therapy. Patients' history of alcohol drinking, betel nut chewing, and cigarette smoking were also recorded. Definitive therapy included surgical tumor excision, radiotherapy alone, or chemoradiation. Time from definitive therapy to recurrence or metastases was defined from the last date of definitive therapy to the first date of known recurrence or metastases.
Toxicity analysis
The medical records and laboratory data were reviewed for toxicity analysis. Severity was evaluated by certified medical oncologists and was recorded regularly in the electronic health record.
Tumor response evaluation
Tumor response was evaluated using contrast imaging (magnetic resonance imaging or computed tomography). In the case of patients who did not have a contrast image evaluation, data on tumor size measured with a ruler were used in the analysis. RECIST 1.1 [9] was used to determine the clinical response of the patient.
Survival analysis
We reviewed medical records as a reference for survival status. Progression-free survival (PFS) was defined as the period from the time of first taking pembrolizumab to the time of disease progression or death. Overall survival (OS) was defined as the period from the time of first taking pembrolizumab to the time of death. For responders defined by RECIST 1.1 [9], the duration of response (DoR) was the period from the time of the first image documenting partial response to the time of disease progression or death. The survival status of patients who did not have a regular follow-up was updated by cancer case managers in the cancer registry of the hospital. The last day of hospitalization of patients discharged from the hospital with critical illness was recorded as the date of death. If a patient's survival status could not be verified by medical records, the cancer registry, or telephone contact, the survival status was censored on the date of the last visit.
The Kaplan-Meier procedure was used for analysis of survival. The Cox proportional hazards regression model was used for multivariate analysis. The log-rank test was used to compare survival. MedCalc (Version 20.111) was used for the analyses.
Patient characteristics
From Nov 2016 to Sep 2018, 51 consecutive HNSCC patients fulfilling the reviewing criteria were included in the analysis ( Table 1). The day for data cutoff was June 30, 2022. Three patients were lost from follow-up before the data cutoff. The most common tumor site in the study was oral cancer (36/51, 70%). A review of treatment history showed that 90% (46/51) of the patients had prior radiotherapy, and 86% (44/51) were cetuximab-naïve. Within 180 days of definitive therapy, 26 patients (26/51, 51%) had a recurrence or distant metastases of the disease, and 19 of them were platinum-refractory.
The majority of patients (67%) took four cycles of pembrolizumab, and 52% of patients took a 200-mg fixed dose of pembrolizumab every three weeks. All patients took 40 mg of afatinib daily as the initial dose of treatment. The prescription of afatinib was maintained until disease progression, intolerable toxicity, or the physician's decision to discontinue. The median treatment duration for afatinib was 5.9 months (range: 0.5 to 25.8 months).
Toxicities
For patients taking pembrolizumab and afatinib, the most common all-grade toxicities ( Table 2) were diarrhea (62.7%), skin rash (43.1%), mucositis (31.4%), and paronychia (23.5%). The overall rate of grade 3-4 toxicities was 7.8% (4/51) ( Table 2). Thirty-seven (72.5%) patients had dose reduction for toxicity. Tumor bleeding occurred in two patients after taking pembrolizumab and afatinib, and one patient's death was caused by this condition. Both events were considered disease-related. One patient experienced grade 3 pneumonitis after pembrolizumab and afatinib treatment. Among the 51 patients in the cohort, 36 (70.6%) had dose reductions. After the dose was adjusted, the most common dose of afatinib was 40 mg daily in a 2 days on/1 day off schedule (32 patients).
Clinical response and survival analysis
In this cohort, 47 patients had contrast images for disease evaluation, while two patients were given a physical examination. The tumors were measured by rulers, and the size of tumor was recorded in the medical record. One patient was diagnosed with clinical progression. One patient did not have evaluable disease. In the case of the 47 patients with contrast images for evaluation, the median number of examinations of the contrast images was 3 (range: 2-12). The median interval of contrast image evaluation was 3.1 months (range: 0.5-20.4 months). The objective response rate (ORR) was 54.9% (95% CI, 40.3-68.9%) (Fig. 1), and all 28 responders had contrast images for evaluation. Eleven of the 51 patients (21.6%) had stable disease at first evaluation, and another 10 (19.6%) showed disease progression. The ORR of cetuximab-experienced patients was 57.1% (4/7). The median PFS was 5.9 months (95% CI: 4.4-7.6 months; Fig. 2A), and the median OS was 10.5 months (95% CI: 6.8-16.5 month; Fig. 2B). The 12-month, 24-month, 36-month, and 48-month survival rate was 47.0%, 22.5%, 17.7%, and 12.6% respectively.
Palliative therapies were continued in several patients following disease progression. Patients received chemotherapy in 37 cases, cetuximab in 25 cases, anti-PD-1 in 9 cases, and ipilimumab in 2 cases. A total of eight patients received radiotherapy for palliation. In nine cases, no further therapy was continued.
Subgroup analysis
We included the history of alcohol drinking, cigarette smoking, betel nut chewing, cetuximab use, cancer types (oral vs. non-oral), time from definitive treatment to recurrence, and pembrolizumab dose (200 mg vs. 2 mg/kg) in the Cox proportional hazards regression analysis of OS. No difference was observed in this analysis (Table 3). There was no significant difference in PFS (log-rank p = 0.23, Fig. 3A) and OS (log-rank p = 0.31, Fig. 3B) between pembrolizumab doses. Regarding the exposure of cetuximab, there was no significant difference in PFS (log-rank p = 0.07, Fig. 3C) and OS (logrank p = 0.43, Fig. 3D). In these cohorts, the response to the therapy predicted the PFS and OS benefits (logrank test of PFS: p < 0.0001; Fig. 3E; log-rank test of OS: p < 0.0001; Fig. 3F). Regarding different time from definitive treatment to recurrence or metastases, there was no difference in PFS (Fig. 3G, log-rank p = 0.47) and OS (Fig. 3H, log-rank p = 0.35).
Discussion
This is a retrospective analysis of real-world data for patients using limited cycles of pembrolizumab with continuous afatinib for the treatment of HNSCC. The It was an appropriate time for discussing further treatment plans with the patients and their family. In this retrospective analysis, the reasons for holding pembrolizumab treatment are not written down in medical records. However, financial restraint could be the most possible reason to hold the therapy. In this study, the treatment of short-course pembrolizumab plus continuous afatinib still showed a comparative clinical effect. The ORR of recurrent and/or metastatic HNSCC patients to the treatment was 54.9%. The median PFS was 5.9 months, and the median OS was 10.5 months. The toxicities were tolerable and manageable. The response rate was comparable to that in the prospective phase II study using afatinib-pembrolizumab for HNSCC [8].
The long-term survival rate of this study were also close to the results of CHECKMATE 141 [10], KEYNOTE 040 [1,11], and KEYNOTE 048 [2]. The 24-month survival rate of 22.5% was numerically similar to the long-term follow-up results in CHECKMATE 141, which showed a 24-month survival rate of 16.9% in the nivolumab arm [10]. The 48-month survival rate of this study was 12.6%, which was also similar to the result of KEYNOTE 040, with a 48-month survival rate of 8.3% in pembrolizumab arm [1]. These indirect comparisons demonstrate the feasibility of short-course pembrolizumab with continuous afatinib therapy for HNSCC patients. In addition to regulating tumor growth [12], the EGFR pathway also regulates tumor microenvironment [13,17]. EGFR inhibition can increase MHC expression, enhance dendritic cell function, and increase T cell infiltration into the tumor [13]. In a cancer animal model, afatinib could suppress tumorigenesis by inhibiting the EGFR pathway of macrophages [14]. In a syngeneic mouse cancer model, EGFR TKI suppressed the glycosylation of PD-L1 and sensitized the tumor to anti-PD-1 therapy [15]. In a drug screening study using ovalbumin-specific systems, EGFR TKI, especially afatinib, could enhance the efficacy of anti-PD-1 by improving MHC expression and decreasing PD-L1 expression in tumor cells [16]. These studies support EGFR-targeted therapy, especially afatinib, as a potent partner for checkpoint inhibitor immunotherapy [17]. A phase II study using afatinib and pembrolizumab showed an improved ORR in HNSCC patients [8]. The post-treatment multi-omic analysis in the study also showed enhanced antigen presentation machinery in the tumor microenvironement after taking afatinib and pembrolizumab [8]. These studies indicate the potential of EGFR inhibition for augmenting the efficacy of anti-PD-1 in HNSCC patients.
The high costs of anti-PD-1 and reimbursement constraints limit patients' access to anti-PD-1 therapy [18]. In Taiwan, anti-PD-1 therapy was not reimbursed by National Health Insurance until 2019 [19]. Therefore, a shorter-course and lower-dose anti-PD-1 treatments is highly attractive to patients with financial constraints. The Cox proportional hazards regression analysis in our study showed that a lower dose of pembrolizumab (2 mg/ kg) may have OS benefits similar to those of the standard dose (Table 3, Fig. 3A, 3B). The analysis demonstrated the potential of low-dose short-course pembrolizumab therapy for treating HNSCC patients. In KEYNOTE 010, a phase III study used two doses of pembrolizumab (2 mg/ kg and 10 mg/kg), which also resulted in similar survival benefits [20]. In a real-world study, a lower dose of anti-PD-1 did not result in inferior survival benefits to nonsmall-cell lung cancer patients [21]. This evidence shows the feasibility of lower-dose anti-PD-1 as cancer therapy.
The duration of anti-PD-1 treatment is also of interest. In metastatic melanoma patients, four cycles of the CTLA-4 antibody ipilimumab demonstrated a durable response [5]. The survival benefits are not compromised for patients who discontinue anti-PD-1 therapy due to immune-related adverse events [22,23]. Observations from these clinical studies indicate that a shorter course of anti-PD-1 could be an effective alternative to chemotherapy. Our study also showed that patients with clinical response (CR or PR) have a better prognosis than patients with stable disease or disease progression (Fig. 3E, 3F). Therefore, patients with a good clinical response may be suitable for a shorter course strategy. A prospective study is ongoing to ascertain whether short-course anti-PD-1 is feasible for melanoma patients with clinical response [24]. The study may show the potential utility of a short course of anti-PD-1 in cancer therapy. The report also identified several challenges that require further investigation. A key issue in TKI and anti-PD-1 combination therapy is the management of TKI associated toxicities. In this cohort, 70.6% of patients required dose reductions. In other clinical trials using afatinib-pembrolizumab [8], lenvatinib-pembrolizumab [25] or carbozantinib-pembrolizumab [26] combination therapies in HNSCC, a significant portions of patients required dose adjustment. A appropriate dose selection or a different dosing schedule for TKIs is essential for further utilizing anti-PD1 and TKI combinations. In addition, the median DoR of this cohort was 6.2 months, which is shorter than the median DoR of pembrolizumab monotherapy in KEYNOTE 040 [1] and KEYNOTE 048 [2] trials. It is possible that afatinib may not effectively modulate the microenvironment in every responders in this cohort. The key to extending the duration of response of anti-PD-1 combinations is to study the difference of microenvironment between each durable responder and non-durable responder.
This study has several limitations. First, it is a retrospective study. Efficacy might have been overestimated and toxicities underestimated. The heterogeneous characteristics in our study also limited further subgroup analysis for predicting treatment benefits. Second, the cost of these treatment was not reimbursed in Taiwan in this retrospective study period. Patients who can afford the cost of therapy may reflect a better family support and financial status. The prognosis of these patients could be better in this cohort. Lastly, PD-L1 expression serves as a biomarker for predicting clinical response to anti-PD-1 therapy. However, PD-L1 testing is not widely available in Taiwan at this time. As a result, it may be difficult to determine the correlation between PD-L1 expression and clinical response rate. Our prospective study found that higher PD-L1 expression was associated with better outcomes in patients with HNSCC receiving afatinibpembrolizumab [8].
In conclusion, this retrospective analysis of real-world data showed acceptable efficacy of short-course pembrolizumab with continuous afatinib against HNSCC. The substantial long-term survival rates support the possibility of using short-course pembrolizumab for HNSCC. Short course of pembrolizumab also provides incentives to reduce medical costs. The feasibility of short-course anti-PD-1 warrants a prospective randomized study to confirm its efficacy.
|
v2
|
2022-11-29T06:16:46.701Z
|
2022-11-28T00:00:00.000Z
|
254042764
|
s2ag/train
|
Regional Differences in Intestinal Contractile Responses to Radial Stretch in the Human Lower Gastrointestinal Tract.
Background/Aims
Radial stretch evokes an increase or decrease in contractions in the lower gastrointestinal tract via mechanosensory enteric neurons that project into the muscle layers. We aim to elucidate the differences in stretch reflexes according to their location in the human colon.
Methods
We used healthy intestinal smooth muscle tissue excised during elective colon cancer surgery. Conventional intracellular recordings from colonic muscle cells and tension recordings of colonic segments were performed. Radial stretch was evoked through balloon catheter inflation. Changes in the membrane potential and frequency, amplitude, and area under the curve of muscle contractions were recorded before and after the radial stretch at proximal and distal segment sites.
Results
In intracellular circular muscle recordings, hyperpolarization was noted at the distal site of sigmoid colonic segments after radial stretch, in contrast to depolarization at all other sites. In tension recordings at proximal ascending or sigmoid colonic segment sites, contractile activation was observed with statistically significant increases in the frequency, amplitude, and area under the curve after radial stretch. Distal sites of ascending and sigmoid colonic segments showed increase and decrease in contraction, respectively.
Conclusions
Radial stretch in the human colon (in vitro) evokes excitatory activity at both proximal and distal sites of the ascending colon and at the proximal site of the sigmoid colon, whereas it elicits inhibitory activity at the distal site of the sigmoid colon.
|
v2
|
2022-11-29T06:16:48.811Z
|
2022-11-28T00:00:00.000Z
|
254041962
|
s2ag/train
|
Perspectives on the future of urothelial carcinoma therapy: chemotherapy and beyond.
INTRODUCTION
Despite recent developments in the landscape of urothelial carcinoma (UC) treatment, platinum combination chemotherapy still remains a milestone. Recently immunotherapeutic agents have gained ever-growing attractivity, particularly in the metastatic setting. Novel chemotherapeutic strategies and agents, such as antibody-drug conjugates (ADCs), and powerful combination regimens have been developed to overcome the resistance of most UC to current therapies.
AREAS COVERED
Herein, we review the current standard-of-care chemotherapy, the development of ADCs, the rationale for combining therapy regimens with chemotherapy in current trials, and future directions in UC management.
EXPERT OPINION
Immunotherapy has prompted a revolution in the treatment paradigm of UC. However, only a few patients experience a long-term response when treated with single-agent immunotherapies. Combination treatments are necessary to bypass resistance mechanisms and broaden the clinical utility of current options. Current evidence supports the intensification of standard-of-care chemotherapy with maintenance immunotherapy. However, the optimal sequence, combination, and duration must be determined to achieve individual longevity with acceptable health-related quality of life. In that regard, ADCs appear as a promising alternative for single and combination strategies in UC, as they specifically target the tumor cells, thereby, theoretically improving treatment efficacy and avoiding extensive off-target toxicities.
|
v2
|
2022-11-29T06:16:48.998Z
|
2022-11-28T00:00:00.000Z
|
254043160
|
s2ag/train
|
Isolated aniridia caused by a novel PAX6 heterozygous deletion mediated by multi-exon complex rearrangement.
PURPOSE
Mutations in PAX6 gene (chromosome 11p13) encoding a transcriptional regulator involved in oculogenesis mostly present with aniridia. Aniridia is not uncommon in the Philippines but only limited information is available as yet. The purpose of this study was to present a novel, deletion mediated by complex rearrangement in PAX6 gene causing an isolated aniridia in a Filipino girl.
PATIENTS AND METHODS
The patient is an 8-year-old girl who came in due to leukocoria with associated nystagmus and esotropia. She presented with subnormal vision, nystagmus, aniridia, and cataractous lenses in both eyes. The family history reveals presence of the aniridia and cataract with the mother and a sibling. The patient underwent lens extraction without intraocular lens implantation bilaterally, where patient subsequently underwent intraocular lens implantation on her left eye. Systemic workup was performed including whole abdomen, renal ultrasound, blood chemistry, and urinalysis. Targeted cataract panel with WT1 and PAX6 genes revealed a novel, heterozygous PAX6-inherited mutation from the mother. This variant is a complex rearrangement in PAX6 involving partial deletions of exons 3-5, including the initiator codon. Deletions of PAX6 are part of a contiguous gene deletion syndrome - Wilms tumor, aniridia, genitourinary anomalies, and intellectual disability syndrome - and therefore evaluation of the WT1 gene was necessary to rule out this life-threatening syndrome.
CONCLUSION
This rare, complex rearrangement of multiple exons and deletions in PAX6 causing an isolated aniridia phenotype is probably the first reported case. The patient was managed by a multidisciplinary team and the guardians were counseled regarding the prognosis and complications.
|
v2
|
2022-11-29T06:16:49.170Z
|
2022-11-28T00:00:00.000Z
|
254043080
|
s2ag/train
|
Applicability of multi-dimensional convolutional neural networks on automated detection of diverse focal liver lesions in multiphase CT images.
PURPOSE
To investigate the applicability of multi-dimensional convolutional neural networks (CNNs) together with multiphase contrast-enhanced CT images on automated detection of diverse focal liver lesions (FLLs).
METHODS
We trained detection models based on 2.5D and 3D CNN frameworks using 567 patients with 3892 FLLs and validated on a relatively large independent cohort of 1436 patients with 4723 lesions. The detection performance across different phases (arterial, portal venous and combined phases) were assessed for the 2.5D model. The lesions were divided into two groups with a cutoff size of 20 mm, and further subdivided into four subgroups of <10 mm, 10-20 mm, 20-50 mm, and ≥50 mm, to verify the detection rates for lesions of different sizes for the 2.5D and 3D models. McNemar's test was used to compare the detection sensitivities among different methods. In addition, sensitivity with 95% confidence intervals and free-response receiver operating characteristics (FROC) curves were plotted for visualization of the detectability.
RESULTS
In the 2.5D model, the detection rate of portal venous phase outperformed arterial phase, and a combination of the two phases further improved the performance over single phase. The detection sensitivities in the arterial, portal venous and combined phases were 0.737 vs 0.802 vs 0.832 for all lesions. The 3D model was superior to the 2.5D model for detecting benign lesions (0.896 vs 0.807, p < 0.001), malignant lesions (0.940 vs 0.918, p = 0.013) and all lesions (0.902 vs 0.832, p < 0.001) regardless of size division. Particularly, the 3D model showed higher sensitivity than the 2.5D model in detecting lesions smaller than 20 mm (0.868 vs 0.759, p < 0.001). For lesions larger than 20 mm, both the 3D and the 2.5D models achieved excellent detection performance.
CONCLUSIONS
The proposed CNN detection model was demonstrated to adaptively learn the feature representations of diverse focal liver lesions and generalize well to a large-scale validation dataset. The use of multi-phase significantly improved the detectability of FLLs compared to single phase. 3D CNN framework showed an enhanced capability over the 2.5D in the detection of FLLs, particularly small lesions. The promising performance shows that the proposed CNN detection system could be a powerful clinical tool for early detection of hepatic tumors. This article is protected by copyright. All rights reserved.
|
v2
|
2022-11-29T14:39:22.131Z
|
2022-11-28T00:00:00.000Z
|
254046534
|
s2orc/train
|
The delivered dose assessment in pancreas SBRT with the target position determined using an in-house position monitoring system
Purpose This study assessed the delivered dose accuracy in pancreas SBRT by incorporating the real-time target position determined using an in-house position monitoring system. Methods and materials An online image-based position monitoring system, SeedTracker, was developed to monitor radiopaque marker positions using monoscopic x-ray images, available from the Elekta XVI imaging system. This system was applied to patients receiving SBRT for pancreatic cancer on the MASTERPLAN Pilot trial (ACTRN 12617001642370). All patients were implanted pre-treatment with at least three peri-tumoral radiopaque markers for target localisation. During treatment delivery, marker positions were compared to expected positions delineated from the planning CT. The position tolerance of ±3mm from the expected position of the markers was set to trigger a gating event (GE) during treatment. The dosimetric impact of position deviations and actual dose delivered with position corrections was assessed by convolving the plan control point dose matrices with temporal target positions determined during treatment. Results Eight patients were treated within this study. At least one GE was observed in 38% of the treatment fractions and more than one GE was observed in 10% of the fractions. The position deviations resulted in the mean(range) difference of -0.1(-1.1 - 0.4)Gy in minimum dose to tumour and 1.9(-0.1- 4.6)Gy increase to Dmax to duodenum compared to planned dose. In actual treatment delivery with the patient realignment, the mean difference of tumour min dose and duodenal Dmax was reduced to 0.1(-1.0 – 1.1)Gy and 1.1 (-0.7 - 3.3)Gy respectively compared to the planned dose. Conclusions The in-house real-time position monitoring system improved the treatment accuracy of pancreatic SBRT in a general-purpose linac and enabled assessment of delivered dose by incorporating the temporal target position during delivery. The intrafraction motion impacts the dose to tumour even if target position is maintained within a 3mm position tolerance.
Introduction
Pancreatic cancer is the 12th most common cancer worldwide, accounting for 495 773 new cases and 466 003 deaths in 2020 (1). The management of pancreatic cancer continues to be challenging with high mortality and a poorer prognosis compared to other cancers; the 5-years overall survival is only 9% (2). The majority of pancreatic cancer patients are diagnosed at an advanced stage and 80-90% of patients have unresectable cancer at the time of diagnosis which attributes to the poor prognosis (2). Recent studies have shown improvement in survival for locally advanced and borderline resectable pancreatic cancer patients treated with neoadjuvant chemotherapy followed by Stereotactic body radiotherapy (SBRT) (3,4). This combined treatment approach is shown to have a high success rate in downstaging locally advanced and borderline resectable pancreatic tumours to resectable disease, with a negative microscopic margin (R0) in relatively high percentage of cases (3,4). Additional studies have been carried out to determine the role of dose escalation in SBRT for improved local control and survival benefits (5,6).
Accurate and safe delivery of pancreatic SBRT is imperative, but challenging due to the proximity of radiosensitive gastrointestinal Organs at Risk (OARs) to the tumour. Additionally, the pancreas and abdominal organ motion due to respiration, deformation and peristalsis poses a greater challenge in the safety and accuracy of pancreatic SBRT. This necessitates the use of appropriate motion management and quantification of patient specific target motion for radiotherapy planning to mitigate the uncertainties arising from this motion. The Internal Target Volume (ITV), derived using respiratory correlated four-dimensional Computed Tomography (4D CT) image sets, are widely used to determine and encompass the position of target volume during treatment. Gated or breathhold radiotherapy offers the best method of reducing respiratory motion, however not all patients are suitable for breath-hold or gated treatments (7,8). Other methods used to reduce motion include abdominal compression (AC) or voluntary breath-hold.
Whilst motion management strategies ensure the target motion is accounted for based on the planning dataset, it does not ensure the accuracy of target position during treatment delivery. Studies have shown inconsistencies in the target motion range between planning and treatment fractions (9,10). These studies also have reported the difference in the reproducibility of target position between breath-hold sessions during treatment (9,10). The target position uncertainties due to these factors can result in suboptimal treatment delivery in pancreatic SBRT with reduced dose to the tumour and potentially very high dose to OARs.
SBRT dedicated linear accelerators (linacs) such as Cyberknife and Vero systems, have real-time target position monitoring and tracking abilities, enabling the safe delivery of pancreatic SBRT. These systems use stereoscopic images to identify the position of fiducial markers implanted in or in the vicinity of tumours to determine the target position during treatment. Recent studies have shown the successful implementation of Magnetic Resonance image guided radiotherapy delivery systems in pancreatic SBRT and its ability to safely limit the dose to OARs using online adaption and gated treatment delivery (11,12). The demonstrated efficacy of pancreatic SBRT has enabled its widespread uptake in clinics worldwide using general-purpose C-arm linacs. Vinogradskiy et al. reported the fiducial marker-based real-time position monitoring in pancreatic SBRT using the triggered imaging option available in the Varian linac (13). Recently our group reported the first clinical implementation of real-time position monitoring in pancreatic SBRT on an Elekta linac using planar images acquired from the XVI system and an in-house developed position monitoring software (14). In this study, we investigated the accuracy of dose delivered to pancreatic SBRT patients treated within 'Mfolfirinox And STEreotactic Radiotherapy for Patients with Locally Advanced paNcreas cancer (MASTERPLAN): a feasibility study' (ACTRN 12617001642370) by incorporating the real-time position information derived using in-house developed position monitoring system, SeedTracker.
Patient data
Patients treated within the MASTERPLAN pilot study were considered for this study. The MASTERPLAN pilot study is a three-centre feasibility study investigating whether SBRT in addition to chemotherapy with modified FOLFIRINOX (Oxaliplatin, irinotecan, 5-fluorouracil; mFOLFIRINOX), is a feasible treatment option for patients with borderline resectable pancreatic adenocarcinoma (BRPC) or unresectable pancreatic adenocarcinoma (UPC). Eight patients were recruited for this pilot study. The characteristics and tumour staging of the patient cohort is shown in Table 1.
Radiotherapy treatment simulation
Radiotherapy commenced 2 to 4 weeks after 4 cycles of mFOLFIRINOX as per the study protocol. Prior to the radiotherapy simulation process, the patients were inserted with 4 gold fiducial markers (EchoTip Ultra Fiducial Needle, Cook Medical LLC, IN, USA) in or in the vicinity of tumour in the pancreas with endoscopic ultrasound guidance. The markers were implanted with Endoscopic Ultrasound guidance and typically inserted via a needle through the duodenum or stomach. The placement of 4 markers were recommended to be on the periphery but not within the tumour to reduce the risk of bleeding. One marker was recommended to be between the duodenum and right sided aspect of the tumour to allow accurate delineation of the duodenum. The other markers were to be inserted on the periphery of the tumour on each of the other planes where possible (e.g. superior, to the left of the tumour and inferior). This was not always possible due to the location of the tumour and vessels. The small needle used for insertion through the stomach or duodenum does not have significant risk for damage of the OARs and is a routine part of biopsy and diagnosis for pancreatic cancer.
Patients were assessed for an appropriate motion management strategy by the Radiation Oncologist at a minimum of 3 days post fiducial marker insertion. The choice of motion management depended upon patients' ability to tolerate and comply with a particular motion management requirement and was decided under fluoroscopic x-ray image guidance by the following hierarchical process: 1. If the patient could tolerate the Active Breathing Coordinator (ABC) device (Elekta Ltd, UK) and was able to hold their breath in an exhale state for a minimum 15 seconds(s) with the stability and reproducibility of the marker positions within 2mm, the simulation and treatment was performed using ABC assisted Exhale Breath Hold (EBH) strategy. 2. If the patient did not comply with EBH requirements, firstly the Superior-Inferior (SI) motion range of the markers in a free breathing state was determined using fluoroscopic images. Abdominal compression (AC) using Omni V SBRT position System (Bionix, USA) was performed and the markers' motion range was reassessed with the optimal abdominal compression that was comfortable to the patient. If the AC reduced the markers' motion range ≥ 5mm in comparison to free breathing, AC compression was selected as a motion management option 3. If neither the ABC device nor AC was tolerable or had <5mm difference compared to free breathing, the patient was simulated and treated using a free breathing approach.
For the patients who were eligible for the EBH motion management option, the planning CT with contrast was acquired in EBH with an ABC device. For patients who were eligible for AC and free breathing, the planning CT with contrast was acquired at comfortable voluntary EBH of the patient. Additionally, 4D CT images were acquired to generate the ITV for treatment planning.
Treatment planning
The following two Planning Target Volumes (PTVs), receiving 30 Gy and 45 Gy in 5 fractions, were contoured by a radiation oncologist for treatment planning: PTV 30Gy: ITV + 5mm safety margin PTV 45Gy: PTV 30Gy excluding Stomach, Duodenum and Small Bowel with 5mm safety expansion A dual arc Volumetric Modulated Arc Therapy (VMAT) plan for Elekta linac with Agility treatment head was generated using Pinnacle treatment planning system (TPS). The motion management techniques used for the patients are shown in Table 1. The PTV 45Gy was planned with an inhomogeneous dose within the volume with D1cc not exceeding 58.5 Gy (130% of 45Gy). The GI OARs doses were limited to the guideline values during the planning process (5,15).
Treatment delivery
The treatment was delivered on an alternate treatment day schedule. The stability and reproducibility of the EBH and reproducibility of AC on each treatment day was verified using fluoroscopic x-ray images prior to the acquisition of the verification CBCT. For patients simulated with EBH, the verification CBCT was acquired during EBH, with the CBCT images registered with the reference planning CT to ensure the accurate match of fiducial positions and the internal organs that can be seen on CBCT images. For the AC and free breathing patients cohort, 4D CBCT images were acquired for position verification. The exhale phase of the 4D CBCT dataset was matched with the reference CT to quantify the position offset and table corrections. The 4D CBCT dataset was used to ensure the motion range of fiducials/target volume within the ITV determined from the planning 4D CT.
Real-time position monitoring
The positional accuracy of the target during treatment delivery was monitored using an in-house developed software system, SeedTracker. The fluoroscopic x-ray images acquired during treatment delivery using the XVI system were processed by the SeedTracker system in real-time to identify the position of the implanted markers and compared to the expected positions based on the reference planning position at each imaging angle. If the position of the markers exceeds the set tolerance value the system will alert the user to interrupt the treatment and reposition the patient. In the events where position deviations were observed, the table corrections were performed based on the 3D offsets determined by CBCT based verification. The details on the principle of operation of the SeedTracker system can be found elsewhere (14, 16,17).
A position tolerance of ±3mm with a maximum deviation duration of 5s was set to trigger the gating event (GE) to interrupt the treatment delivery and perform the patient realignment. For the treatment with AC and free breathing techniques the position tolerance + ITV extent was used as a tolerance window, while for EBH treatment only the position tolerance was used as a tolerance window.
Delivered dose assessment
The actual dose delivered to the tumour and OARs in each treatment fraction was calculated by convolving the control point (CP) dose matrices of the treatment plan with the target positions determined during the delivery of the respective CPs. The 3D position of the target for this convolution process was determined using the real-time 2D monitoring data. In FB and AC motion management techniques the 3D position of the tumours was calculated using the following two steps: • Firstly, the SI trajectory of each breath cycle was divided into 10 equidistant positions between maximum inhale and exhale positions. The 3D position of the target at each of these discrete position was determined using the 2D data with the angular separation of 45°using the variable angle stereoscopic method (17).
• Based on this 3D position distribution cloud, the 3D position corresponding to the 2D data of the real-time trajectory was determined using the Maximum Likelihood Estimation (MLE) method.
For the 3D position estimation in the EBH technique, firstly the 3D position of the tumour at identical SI positions was calculated based on the variable angle stereoscopic method, then the 3D position corresponding to the 2D data of the real-time trajectory was determined using MLE.
In the gating events (GE) where the treatment was interrupted and position correction was performed, the dose that would have been delivered with the position deviation was calculated by introducing the determined position deviations to the CP dose.
The difference in dose volume histogram (DVH) metrics such as D98, Dmax, minimum and mean dose to Gross Tumour Volume (GTV) and Dmax to duodenum, small bowel and stomach were compared between planned and delivered dose. The statistical difference between the DVH metrics of the dose delivered with and without position correction was performed using the Wilcoxon signed rank test.
Motion management
Of the 8 patients treated within this feasibility study, EBH and AC techniques were used for 2 and 3 patients respectively. The remaining patients who could not tolerate the ABC device and had no benefit from AC were treated with a free breathing approach (Table 1).
Gating events
The number of GEs resulting in each of the treatment fractions is shown in Figure 3A. At least one GE occurred in 7 of the 8 patients and a total of 19 GEs occurred in 40 treatment fractions. In patient 3, GEs occurred in 4 of the 5 treatment fractions. The magnitude of 3D position correction that triggered GEs is shown in Figure 3B. Of the observed GEs 7 occurred just before the start of treatment after initial CBCT based verification, 7 occurred just before the start of the second treatment arc and 4 occurred during the delivery of the treatment arc. A maximum position difference of 6mm, 4mm and 4mm was observed in Lat, AP and SI direction in one GE of patient 6. Figure 4 shows the original planned and delivered GTV and OARs dose as assessed by DVH metrics for each of the fractions with real-time monitoring and position corrections. The dose that would have been delivered without position corrections is also shown in the same figures. The mean (range) difference between the planned and delivered dose with and without position correction for the whole treatment is shown in Table 2. The planned Dmax to GTV and the delivered Dmax with and without position corrections is shown in Figure 5. The mean dose, minimum dose and D98 to GTV agreed with the planned dose in both corrected and not corrected treatment scenarios with the mean difference of -0.4Gy,0.1Gy and 0.2Gy respectively ( Figures 4A, B and Table 2). In 7 out of 8 patients the delivered Dmax to duodenum was higher than the planned dose in each of the treatment fractions ( Figure 4C). If the position correction were not performed the Dmax to duodenum would have seen a mean increase of 0.8Gy in comparison to the planned dose ( Figure 4C and Table 2). In individual fractions, the Dmax to stomach and small bowel for treatment delivered without position corrections are within the range of actual treatment delivered with corrections ( Figures 4D, E). The mean difference between planned and delivered Dmax to stomach was -0.5Gy and this difference would have been -0.9Gy for treatment without position corrections ( Table 2). The Dmax to small bowel would have received higher than the planned dose, maximum by 1.6Gy in fraction 5 of patient 1, if position corrections were not performed ( Figure 4E). The statistical significance of the dose difference between the treatment fractions delivered with and without position correction is shown in Table 2. The statistically significant differences was found in Dmax to the duodenum between treatments delivered with and without position corrections.
Discussion
In this work we reported the feasibility of real-time position monitoring using an in-house developed system for the safe and accurate delivery of pancreas SBRT on a general purpose linear accelerator. This is to our knowledge the first implementation for pancreas treatment on an Elekta Linear accelerator, with the patient cohort treated in this study covering both free breathing and the application of motion management techniques such as AC and EBH. A number of intrafraction position deviations during the treatment delivery were detected by the system in the studied patient cohort and position corrections were performed to improve the accuracy of treatment delivery. The delivered dose assessment, by incorporating the target position during treatment delivery, showed that the dose delivered to the duodenum and stomach would have been higher than the planned if the position deviations were not identified and corrected.
The pancreas real-time position monitoring and target tracking using implanted gold fiducials has been in practice for some time in SBRT dedicated treatment delivery systems such as Cyberknife and Vero (18)(19)(20). Zhang et al. reported various movement patterns of pancreas in 498 datasets for 29 patients' Cyberknife treatments and observed position deviations of >5mm in 50% of the datasets analysed with treatment times that exceeding > 240s (19). Recently, Vinogradskiy et al. reported the real-time pancreas position monitoring in SBRT using a Varian True beam accelerator with triggered imaging capability (13). The tracking data from 68 patients treated with AC or respiratory gating were analysed in this study and reported that 32% of all treatment fractions required patient realignment due to position deviations. This is comparable to our study results, with GEs and patient realignment occurring in 38% of the treatment fractions. The small sample number could be the reason for the relatively higher rate of GEs observed in this study.
Akimoto et al. quantified the intrafraction pancreas tumour motion using the orthogonal kV imaging subsystem available in Vero system and reported a greater magnitude of motion in SI direction followed by AP and LR directions (20). In our study the intrafractional tumour position determined using the SeedTracker system showed similar results for patients treated with FB and AC techniques ( Figure 2) and was consistent with the motion determined using the planning 4D CT dataset. The intrafraction tumour motion determined by SeedTracker showed that the tumour movement range does exceed the ITV in the majority of the fractions for patients treated with the FB and AC technique (Figure 2). In particular for two of the patients (Patients 3 and 8) treated using the AC technique, the magnitude of motion in SI direction during treatment delivery was consistently less than the ITV magnitude in the SI direction derived based on the planning 4D CT. Minn et al. compared the pancreatic tumour motion quantified using planning 4D CT with the intrafraction motion determined using the imaging subsystem available in Cyberknife system and found that tumour motion determined during treatment did not correlate with the motion quantified using 4D CT (9). In EBH treatment, the stability and reproducibility of tumour position varies during the treatment and results in the spread of tumour position in all three directions during dose delivery ( Figure 2). Studies have reported variations in tumour position of up to 1cm during the Deep Inspiration Breath Hold treatment in Liver SBRT due to poor breath-hold reproducibility (21, 22). The position deviations detected in the patients treated with EBH technique in our study agree with previous studies ( Figure 3B) (21, 22). The accuracy of dose delivered to the target and OARs is paramount in understanding the efficacy of treatment; this is particularly important in pancreas SBRT as the evidence continuously evolves favoring the improvement in overall survival. The error in target position, interplay effects between target motion and treatment delivery parameters and inter and intrafraction internal anatomy position changes and deformation contributes to the accuracy of dose delivered to the target volume and OARs. In this study, both the dose difference that resulted from detected position deviations and the actual delivered dose with patient realignment was calculated by incorporating actual target positions determined during delivery to the 3D dose resulting from each CP of the VMAT plan generated for each of the patients. The spread in GTV dose volume metrics indicates that in actual delivery with patient realignment the min dose and D98 to GTV were reduced by 1.0Gy and 0.6Gy respectively ( Table 2). This could be attributed to the residual error and relatively high sensitivity of the plan to interplay effects between the target motion and dose delivery. In four of the six patients treated with either FB or AC, the target motion during the treatment delivery and position deviations blurs the Dmax to GTV ( Figure 5). In the patients treated with BH techniques the Dmax delivered to GTV was marginally high, The GTV Dmax of original plan and delivery with and without position corrections. maximum by 0.7Gy, compared to planned dose. Whilst generally the target motion and random position deviations blurs the dose, the reason for the increase in Dmax with motion and position deviation in the studied cases could be due to the position of the high fluence in the VMAT arcs and its interplay with the target motion. Vinogradskiy et al. reported that the target shift observed in their study resulted in point dose differences averaging 23 ± 22% of the prescription dose to tumour (13). This is relatively high in comparison to the tumour dose difference observed in our study. In their study they have reported the position shift up to 10mm in SI direction with an average radial shift of 5.9mm. Moreover, in the dose estimation, it was assumed that the position deviation occurred during the entire fraction of the treatment. In our study majority of the position, shifts were ≤5mm with one exception where 6mm in SI direction was detected ( Figure 3B). In this study the dosimetric impact of the position shifts was accounted for only the duration of time it was present in the treatment delivery and the dose calculation was performed using the actual plan which is more realistic than the estimation based on a dosimetric model. Potentially with improved accuracy of dose delivery, PTV margins may also be reduced safely to limit OAR dose while increasing dose delivered to the target.
The impact of motion and position deviations on the dose delivered to OARs was also evaluated in this study. Overall, the mean (range) dmax to duodenum was increased by 1.1 (-0.7 -3.3)Gy compared to the plan delivered with position corrections ( Table 2 and Figure 4C). This increase in dose could be due to the combined effect of residual position error (Figure 2), dose gradient in the target and duodenum interface and interplay effect between the motion and dose delivery. In contrast to the duodenum, the Dmax to the stomach and small bowel was reduced in comparison to the planned dose. The range of deviation of some of the metrics are larger with position correction in comparison to without position correction ( Table 2). This could be due to the combined effect of interplay between the dynamic delivery, target volume and OARs motion, and the direction of position deviation during treatment. The direction of position deviation occurring during treatment may reduce the dose to one structure (e.g. target volume) and improve agreement between planned and delivered dose for other structures (e.g. OARs).
In addition to the improved treatment accuracy, the other main advantage of real-time position monitoring is that it enables calculation of delivered dose by incorporating the target position determined during treatment delivery. In our study, we found that due to residual set-up error and target motion ( Figure 2) the minimum dose and D98 to GTV was reduced by up to 1Gy and duodenal Dmax was increased by up to 3.3Gy in some patients (Table 2 and Figure 4). A position tolerance limit of 3mm was applied in this study. Though reducing the magnitude of tolerance limit may reduce the dose difference arising from residual error, the influence of interplay between target motion and treatment delivery remains. Moreover, reducing the tolerance limit may increase the occurrence of treatment interruptions and increase the treatment time which is inconvenient to patients, particularly those treated with AC and EBH techniques. Robust plan optimisation methods are shown to generate an optimal treatment plan which increases the robustness of target coverage to set-up uncertainties and sparing of OARs (23, 24). Future studies are warranted to investigate the application of robust planning methods to pancreatic SBRT which could minimise the dose difference to tumour and OARs arising from setup uncertainties and target motion. It should be considered that when such robust optimisation planning methods are clinically implemented, the real-time monitoring and dose assessment process presented in this study would play a vital role in the evaluation, validation and quality assurance of the treatment delivered.
Bae et al. reported that duodenal Dmax is the best predictor of duodenal toxicity in pancreatic SBRT and Verma et al. reported that V35,V30 and V25 to duodenum correlates well with duodenal toxicity (25,26). The dosimetric predictors reported in these studies are based on the planned dose against the histopathologic and clinician-assessed outcome measures. The dosimetric assessment performed in this study quantified the magnitude of difference in the delivered dose when treatment is performed with commonly practiced position tolerance limit in the clinics.
We acknowledge that this study has some limitations. Firstly, the patient number in this study is small being a pilot trial to assess the safety of pancreatic SBRT, which was new to Australian centres at the time, and this trial allowed successful implementation of an in-house developed real-time position monitoring system. The tools developed and the process implemented in this study could be expanded to a larger study or routine clinical practice to improve the safety and accuracy of pancreatic SBRT. Secondly, the implanted fiducial markers were used as a surrogate to determine the target position -these are subject to inaccuracies that could arise due to target deformation or marker migration. Previous studies have demonstrated the inter and intrafraction deformation of tumour border in the pancreas (27). However, using multiple markers for tracking minimises the errors arising from these sources. The intrafraction deformation of tumour borders is shown to be in the range of 1-2mm, which is smaller compared to the magnitude of uncertainties arising from breathing motion and position deviations (28). In this study, 4 markers were implanted and used for tracking in 7 out of 8 patients and in one patient 3 markers were used as the implantation of the 4 th marker was not clinically achievable. Further, the interfraction deformation of target and OARs are not considered in this study as the visualisation of tumour and OARs is challenging on the daily setup CBCT images and may lead to larger uncertainties. MR images acquired on MR guided RT systems enable daily plan adaption to account for target and OARs variations and are shown to benefit the pancreatic cancer patients where the tumour to adjacent OAR distance is ≤ 3mm (29, 30). Finally, for the delivered dose assessment, the OARs motion is assumed to be the same magnitude and moves in synchronisation with the target. Whilst it is a reasonable approximation for the OARs close to the fiducials/ tumour, this may have limitations in the motion quantification for distal OARs as they may exhibit varying magnitude, phase and direction of motion. However, the OARs receiving high dose is likely to be the proximal regions to the tumour volume and the delivered dose calculated in this study will be closer to the actual dose than the assumption of planned dose.
Conclusion
An in-house developed position monitoring system for multiple fiducial based target position tracking in pancreas SBRT treated with free-breathing, abdominal compression and EBH motion management techniques was successfully implemented. Position corrections were required in 38% of the treatment fractions and resulted in improved accuracy of the dose delivered to tumour and OARs. To our knowledge, this is the first study to assess and report the delivered dose that incorporates temporal target position during treatment delivery in pancreatic SBRT. The intrafraction motion impacts the dose to tumour even if the target position is maintained within a 3mm position tolerance.
Data availability statement
The original contributions presented in the study are included in the article/supplementary material. Further inquiries can be directed to the corresponding author.
Ethics statement
The studies involving human participants were reviewed and approved by Human Research and Ethics Committee, South Western Sydney Local Health District, Sydney, New South Wales, Australia. The patients/participants provided their written informed consent to participate in this study.
Author contributions
SA developed the study concept and drafted the manuscript. TY, MJ, DP and ML contributed to study administration, data analysis and manuscript revision. All authors were involved in the running of the study and the revision and approval of the final manuscript.
|
v2
|
2022-11-30T06:17:05.288Z
|
2022-11-28T00:00:00.000Z
|
254069233
|
s2ag/train
|
Maternally Expressed Gene 3 negatively regulated Decorin to Supresse Angiogenesis, Proliferation and Migration of Endothelial Cells.
BACKGROUND
Angiogenesis of tumor cells is highly associated with tumor-secreted factors and matrix proteins. However, the underlying mechanism of tumor-secreted factors and matrix proteins during angiogenesis is rarely discussed.
OBJECTIVES
This study investigated the relationship between the maternally expressed gene 3 (MEG3), a tumor-secreted growth factor, and Decorin, a tumor-secreted matrix protein, and evaluated their derivate roles in human endothelial cell development.
METHODS
Human endothelial cells were transiently transfected with a plasmid expressing antisense of Decorin mRNA (shDecorin) and silencing mRNA of MEG3 (siMEG3) or MEG3 over-expressive vectors. A series of qPCR and Western blot analysis was applied to characterize the expressions of MEG3 and Decorin in all transfected cells. Moreover, scratch, Transwell, and Matrigel neovascularization assays were performed to examine three key processes of endothelial cells' angiogenesis, including tubulogenesis, proliferation, and migratory levels. In addition, the cell viability was evaluated at each step via the MTT test.
RESULTS
The overexpression of MEG3 inhibited angiogenesis and migration of endothelial cells by preventing the expression of Decorin. At the same time, the inhibition of MEG3 via siRNA resulted in an increased expression of Decorin, enhanced tube formation levels, and promoted endothelial cell proliferation and migration. Furthermore, Decorin's knockdown suppressed the angiogenesis and migration of endothelial cells without affecting the expression of MEG3. Importantly, the stimulation of HUVEC cells with exogenous Decorin protein alleviated most phenotypes induced by the upregulation of MEG3.
CONCLUSION
Our study demonstrated the anti-growth effects of MEG3 on vasculogenesis and migration of endothelial cells. Thus, by blocking the expression of Decorin in HUVECs, the overexpression of MEG3 repressed their development and might potentially alleviate the ischemic stroke.
|
v2
|
2022-12-07T20:01:54.881Z
|
2022-11-28T00:00:00.000Z
|
254351203
|
s2ag/train
|
Giant Sternal Pilomatricoma: An Unusual Tumor at an Uncommon Site
Abstract Pilomatricoma, pilomatrixoma, or calcified epithelioma of Malherbe is an uncommon, benign, isolated tumor of hair matrix primarily seen in children and young adults. The most common location is the head and neck region. It usually manifests as a small nodular mass. Here we report a rare case of giant pilomatricoma over the sternum in a 60-year-old male patient with an unusual clinical and radiological presentation mimicking a calcified sebaceous cyst.
|
v2
|
2022-12-07T20:08:58.738Z
|
2022-11-28T00:00:00.000Z
|
254346982
|
s2orc/train
|
Cutting-Edge Developments in Oncology Research
Abstract The field of oncology research has made many successful advances, and new discoveries have started making headlines. As an example, the identification of immune checkpoint inhibition mechanisms in carcinogenic cells led to the development of immunoassays, which have helped many cancer convalescents recover. This article covers the most advanced cutting-edge areas of cancer research: exosomes, microbiomes, immunotherapy, nanocarriers, and organoids. Research on exosomes advances cancer detection and treatment modalities, as well as further understanding of mechanisms that regulate carcinogen cell division, proliferation, invasion, and metastasis. Microbiome consents the researchers to understand the disease cancer. Immunotherapy is the third method in the treatment of cancer. Organoid biology will be further expanded with the aim of translating research into customized therapeutic therapies. Nanocarriers enable cancer specific drug delivery by inherent unreceptive targeting phenomena and implemented active targeting strategies. These areas of research may also bring about the advent of the latest cancer treatments in the future. Malignant infections are one of the leading grounds for demise in the society. Patients are treated with surgery, radiation, and chemotherapy. In chemotherapy, the malignant cells are destroyed and the tumor burden is reduced. However, in most cases, resistance to chemotherapy develops. Therefore, there is a constant need for new additional treatment modalities and chemotherapeutic complex rules. Due to the rapid development in cancer research, I can only mention a few goals and treatment options that I have chosen; However, this review specializes in new and admirable significant strategies and compounds.
Introduction singular manner to detect cancer. Hence, liquid biopsies can be accomplished more habitually and could be used to monitor carcinoma expansion, track a patient's response to treatment, or as a "scrutiny" method for people who have completed the treatment but are at high risk of their disease recurring. 1 This approach can be used to authenticate the efficacy of a malignancy treatment drug by analyzing a couple of liquid scintigraphy tissue sections in the duration of a limited number of weeks. 1 These techniques permit for a great deal faster and less expensive sequencing of nucleic acids, that is, DNA and RNA in comparison with the formerly used Sanger sequencing (dideoxy chain termination sequencing), and thus have reformed the field of genetic makeup and cell biology. NGS additionally permits on behalf of less complicated exposure of transmutations in mutagen sections, which leads to improvement in numerous novel proxies that can be used to treat the patients. 1 Innovative maneuvers, medicines, and drugs have been devised and advanced for cancer treatment. Keyhole surgery using robotics has advanced and has made it feasible to envisage the motion of the tongs in three dimensions. This approach is at present utilized in esophageal, gastrocolic, and celiac cancer surgical procedures. [3][4][5] Currently, immunotherapy have become a further approach for handling cancer patients. Honjo and Allison detected the insusceptible checkpoint, which brought the improvement in insusceptible checkpoint inhibitors. 6 Notwithstanding these advances, gastrointestinal cancer malignancy is still a prime hassle in the way of latest treatment techniques. In this review article, the introduction and description describe five new regions of cancer research that could make contributions to cancer treatment in the upcoming times: exosomes, microbiome, immunotherapy, nanocarriers, and organoids. Despite its accepted application in medical oncology, clinicians and biomedical scientists are nevertheless struggling with an incredibly low degree of expertise of diverse cellular and subcellular techniques and understanding of treatment mechanisms of chemotherapeutics already utilized in medical oncology. 1 There is no uncertainty that the certification of innovative chemotherapy-sensitive target molecules can optimize treatment success in clinical oncology.
The Role of Exosome Investigation in Oncology
An exosome is a minor molecule (micro vesicle) that is oozed out from cells. Its outer face has macromolecules derived from cellular membranes that measure between 15 and 150 nm in proportions. In addition, proteins and nucleic acids are determined in the matrix of exosomes. 7 In recent times, several scholars have concluded that exosomes are concerned in numerous ailment mechanisms. 1 Exosomes, which contain microRNAs, mRNAs, and proteins, have proven useful for retaining a wide range of practical amalgams. 8,9 Countless cells practice the secretion of exosomes to express each other, and those exosomes also serve the goal of reaching remote cells. Malignant cancer cells can also release exosomes that incorporate particles that are conducive to cancer progression. Exosomes initiated by cancer cells can also destroy the blood-cerebral barricade, which subsidizes brain tumor. 10,11 Malignant cancer cells are additionally influenced via exosomes that surround normal cells. 12 Thus, in addition to the tumor microenvironment and premetastatic niche development, exosomes become deeply involved in cancer cell division, propagation, incursion, and metastasis. 13 Exosomes can also be applied to identify most cancers. Categories which are established in numerous body fluids, including blood, plasma, and urinal fluids. The identification and interpretation of exosomes from most malignant cancer cells are used to make detections on the occurrence of the disease. 14 In the meantime, innumerable vesicles, such as many proteins (nucleotides), DNA, and microRNAs, are present in exosomes from ordinary cells; it is essential to separate them for most of them are associated with cancer. 1 Currently, exosome exposure strategies are being developed for exosomes within the plasma of many periampullary and hepatopancreatic cancer patients, with exosomes constant in the bladder of most cancer patients. Therefore, the similarity of the mechanisms that control most cancer cell division, proliferation, invasion, and metastasis, along with improvements in most cancer detection and treatment techniques is strongly influenced by exosome research. 1 While the discharge of exosomes from most malignant cancer cells can be restricted, the tumor microenvironment and signal transduction that facilitate the formation of the premetastatic region of interest cannot be achieved. Research is currently underway converging on the elimination of most cancerous exosomes. 15,16
Implementation of Microbiome in Cancer Research
Different variety of pathogens live in the human anatomy out of which bacteria have the maximum essential association with the human anatomy. Bacteria can survive at any place inside the human anatomy, such as the digestive system, respiratory system, and oral cavities. 17 In particular, the bacteria in the gut are abundant in types and amounts. 1,[18][19][20] The average populance of different bacteria observed in the mortal gut is called the microbiome.
Modern improvements with NGS have produced even more specialization to the duodenal microbiome. 21 Bacteria in human microbiome primarily belong to four files: Firmicutes, Bacteroides, Proteobacteria, and Enterobacteriaceae. Of these, the most prominent species are Firmicutes and Bacterioidetes. 22 Dysbiosis is a circumstance where the multiplicity of the microbiome is abridged. Dysbiosis has been reported to be related with several ailments, comprising seditious bowel disease, colorectal cancer, diabetes, and allergic diseases. 23 Atopobium parvulum and Actinomyces odontolyticus proliferate with size in the early stages of colorectal cancer (adenoma or intramuscular) over the course of the cancer advancement. 2,24 This suggests that a specific microbe may be related with the primary junctures of colorectal cancer remission, which may be convenient for understanding premature exposure of cancer.
Countless researches have likewise been led to clarify the connection among the microbiome and the human immune system. 25 Immunoglobulin A (IgA) antibodies, one of the utmost essential factors in the intestinal resistant system, are assumed to have a function in removal of pestilent microbes and restoring the intestinal environment. IgA antibodies detect, eradicate, and counteract infectious bacteria and toxins. It additionally preserves a mutual association by opening and capturing the host's typical microbiome. 26 Recent research has identified W27IgA antibodies, which have the ability to bind to many bacteria. 27 This antibody called W27IgA apprehends to a portion of serine hydroxymethyl transferase, an enzyme intricated in bacterial growth. W27IgA antibodies bind to them and suppress the growth of Escherichia coli. The W27IgA antibody, however, does not attach to bacteria that overpower enterocolitis, including bifidobacteria and lactic acid bacteria. 27 Thus, the microbe is intensely concerned with the resistance of the human gut. Lately, it has been installed that besides being involved in the intestinal immune system, microbiome also plays a broader role in the human immune system. 1 As the exploration of the microbiome progresses, its links to pathophysiology of numerous ailments such as cancer as well as its supervision of the human immune system become clear. It is, moreover, associated with lymph node metastasis, hepatocellular carcinoma, and remote metastasis. 28,29 The research and study of the microbiome provide some evidence in improving and treating gastrointestinal cancer.
The Growth of Immunotherapy in Cancer Treatment
For the last few decades, surgery, chemotherapy, and radiation therapy have been the primary techniques of therapy for most cancers. Along with to these treatment options, immunotherapy has freshly fascinated universal interest. 30 An individual's immune system is stimulated by the cancer antigens to attack cancerous cells under typical conditions. Nevertheless, occasionally the immune system does not treat cancer cells as nonself or is unable to assault them. Even though therapies that prompt the immune system to counter against cancer cells have been analyzed for a long time, the usage of an affected person's own immune system to treat cancer has not been recognized. Lately, the immunoassay center has demonstrated the effectiveness of both immunosuppressive measures and chimeric antigen receptor (CAR)-T cell therapy. 31 There are two main fundamental reasons why it may be problematic to prove the effectiveness of anticancer therapy for some time. Signal transduction by immune checkpoint compounds, including Programmed death 1 and CTLA4, overpowers cytotoxic T lymphocytes (CTLs). 32 Suppression of immune checkpoint molecules that neutralize antibodies can initiate the subdual of cancer-specific CTLs which instantly activate the immune system and promote cancer eradication. Immunoassay has been shown to be effective and clinically applicable in many solid cancers, including melanoma, 33 lung cancer, 34 gastric cancer, and esophageal cancer. 35 In addition to PD-1 and CTLA4, new immunoassay molecules containing LAG3 T cell Ig and ITIM domain and Signal regulatory protein ɑ are also being actively studied. 36 Although this treatment is favorable, cancer cases that answer to these treatments are narrow. This is due to the fact that the use of this treatment calls for the incidence of cancer-specific CTLs in the patient's body.
A second problem with immunotherapy is that T cells do not apprehend the exact cancer cell antigens and the immune accelerators are very weak. By delivering CTLs to the victim's body that recognize the exact cancer cell-specific antigen, CAR-T cells strengthen the immune accelerator. The CAR is made up of single chain Fv antigens (CD28, 4-1BB) and constitutive molecules (CD3z, 4-1). Next, CAR is instigated into T cells taken from cancer patients and CAR-T cells cells are generated. CAR-T cells secrete a specific antigen of cancer cells and are activated to damage these cells. The CAR-T cells link with high antibody specificity to cancer-specific antigens, as well as to cancer cells that are very proliferative and possess strong cytotoxic activity. The CAR-T treatment is operative in leukemia, including B-cell acute lymphoblastic leukemia and myeloma. 37 While CAR-T cell therapy has a high beneficial effect, an obstinate and severe malignant singularity known as cytokine release syndrome has been acknowledged in some patients. 32 The recent treatment for microsatellite instability-high colorectal cancer includes nivolumab and ipilimumab. The progression-free survival rates (9 months) and 12-month survival rates (71%) for the Nivolumab Plus Ipilimumab Cohort of Checkmate-142 were 87 and 85%, respectively. 38 Therefore, it is predicted that the further specialization of the cancer immune system and the improvement of different immunotherapies will subsidize to momentous improvements in cancer treatment. One hassle with immunotherapy is that there is no conclusive extrapolative biomarker. 1 To find the new biomarker, we assess cytolytic activity (CYT) ratings. CYT rating is based on GZMA and PRF1 mRNA expression levels as a new measure of cancer immunity. 1 Advances in biomarker novelty may assist many gastrointestinal cancer patients.
Use of Organoids in Cancer Research
The three-dimensional (3D) organoid arrangement is a biological culture-based, innovative, and physically applicable cellular stage. 39 The organoid is a small and abridged model of an organ that is fashioned in vitro in 3D and represents the actual microscopic anatomy. With a few cells cultured from the tissue or cultivated cells as the preliminary substance, the organoids nurture and transmit into the vault membrane cellular pool, which subsidizes to their self-regenerative and distinction capabilities. 39 A wide variety of cancer tissues and cells can also be studied to determine the traits of the stem embryonic stem cells or prompted pluripotent stem cells. 40 The organoid structure is commonly referred to in 3D 39 for the growth of stem cells or their innate cells. The phylogeny and practical properties of diverse varieties of cancer tissue have been replicated in single-cellular suspensions or organoids generated from cell masses. In addition to culture-propagated cancer cells, these masses are quarantined from murine embryonic cells and humanoid tissues or cultured cells. The arrangements of organoids display the capability of cancer cells to self-regenerate, proliferate, and differentiate, and offer insight into important molecular pathways and biome elements in many cancer treatment. 40 Organoid systems have also been applied to the analysis of many genetic and biological processes, including locomotion, pressure reaction, cellular-cellular communiqué, and cell exchanges with a wide variety of cells, including fibroblasts, endothelial cells, and inflammatory cells.
Organoids, although not a complex and convenient technology, do require precise media, enhancements, and several intricate techniques, 41 and their solicitation is mainly dedicated to the treatment of cancers (colorectal, prostate, breast, ovary, and esophageal cancer). 40,42 The keratinocyte serum-free medium was modified to produce endoscopic esophageal biopsies, commemorated human esophageal epithelial cells, and 3D organoids from the murine esophagus. 2,43 3D organoid systems have materialized as a sturdy apparatus in basic fundamental research over the past few years that can be used for customized medication. 44 In maximum circumstances, it may be beneficial to organize the patient's organoid to investigate the susceptibility of new therapeutic agents to the treatment of cancer. 44 Therefore, it seems that organoid biology is becoming more broaden with the purpose of interpolating research into customized medicine.
Nanocarriers: Cutting-Edge Antineoplastic Drug Carriers in Cancer Treatment
Biological nanocarriers are frictional nanomaterial systems that can deliver small molecular weight drugs or macrocellular anticancer agents, such as genes or proteins, to subcutaneous tissues during targeted treatment and accumulate in tumors in the same way as molecular carriers like antibodies and peptide-drug conjugates do. 45 Furthermore, nanocarriers attenuate dilapidation, lessen renal absorption, extend its half-life in the bloodstream, aggregate the payload of cytotoxic drugs, reverse the kinetics of anticancer drugs, and increase the solubility of insoluble anticancer drugs. 45 In most cancers, angiogenesis produces new blood vessels for the tumor, but these new vessels have enlarged permeability or enhanced permeability and retention (EPR) effect, resulting in inactive nanocarriers as well as poor lymphatic drainage of the tumor tissue by delivering the release of chemotherapeutic agents into the tumor homeostat. 46 To take advantage of the abnormalities of tumor vascularization, nanocarriers must have a sufficiently diffuse half-life to target the tumor environment passively, inhibiting the movement of the mononuclear phagocyte system (MPS) and reticuloendothelial system by transporting anywhere in the bloodstream and releasing anticancer drugs into the tumor. 47 For this resolution, the nanocarrier size to exit MPS should not exceed 400 nm and is more effective by the EPR effect in tumors less than 210 nm 48 in diameter. Moreover, the surface of these nanoscale carriers must be hydrophilic and neutral or simply ionic to escape plasma proteins (opsonins) and stop macrophage attack. 49 This is accomplished by coating the carrier exterior with hydrophilic polymers such as polyethylene glycol (PEG) 50 or synthetic copolymers of polyethylene oxide (hydrophilic block) and propylene oxide (hydrophobic block). 51 Further, blood vessels and cells contain negatively charged molecules that can repel nanocarriers with negatively charged exteriors. Therefore, one must use slightly negative or positive exteriors. 52 On the surface of nanocarriers for containing active targeting, chemotherapeutic drugs are present by a combination of various components, such as monoclonal antibodies, antibody fractions, peptides, and growth factors. 53 In fact, nanocarriers permit the inclusion of multiple pursuing ligands due to the surface-to-area-to-volume ratio that comes with many binding options. 45 The active targeting target does not increase the total tumor accretion of cytotoxic drugs at the site, but submissively allocates cytotoxic drugs in superior quantities than the consolidated systems to the tumor because the preliminary accretion of nanocarriers in the tumor affects the consequence of EPR before the target is formed. 42,54 Nevertheless, the active cellular target enhances healing efficiency by reducing specificity and increasing the intake. 45 Moreover, the use of peptides aims to defeat the multicellular resistance of nanocarriers and avoid the restrictions of sedentary targets, as in some hypovascular tumors. 55,56 Active targeting nanocarriers can intensify antitumor capacity several times compared with nontargeting carriers. [57][58][59] From tumor vasculature penetration, it can be accredited to this clinical failure because there are fundamentally certain restrictions on the procurement and entry of cancer cells. 60 Furthermore, in budding tumors, cancer cells are close to the endothelial barrier and bind to receptors that initially penetrate the rest of the tumor, targeting nanocarriers. In this cutting-edge world, specific techniques have been defined to address these defects that reduce the transport of nutrients and oxygen to the tumor and increase the antitumor potential of nanocarriers by releasing less molecular anticancer drugs near the tumor vasculature. [59][60][61] An extra drawback that contributes to the state-of-the-art clinical miscarriage of dynamic targeting nanocarriers is the inclusion of target in nanocarriers, which have enhanced immunogenicity and plasma protein absorption, reducing their blood flow time and their capability to passively target tumors. 59 Among nanocarriers, there are polymer therapeutics (polymer-protein and polymer-drug conjugates) in which the drug is nonpolarly bonded or conjugated to the polymer, and particulate drug nanocarriers, in which the drug is trapped inside specific structures made from specific materials like polymers (polymeric micelles, dendrimers, and polymeric nanoparticles [NPs]) or organometallic compounds (chiral and zigzag carbon nanotubes). 2,62 Polymer Therapeutics: Explicit Biomarkers for Cancer Treatment In polymer therapeutics, there are polymer-protein conjugates and polymer-drug conjugates, which are, among other things like nanosized linear water-soluble polymeric macromolecular structures that are joined to antitumor proteins and anticancer peptides by cleavable linkers proteins or small molecules that can be united with anticancer drugs and are constant for the transference period of the cytotoxic component and discharges anticancer drug into the tumor. 63 The synergistic combination of anticancer proteins with polymers diminishes its immunity and escalates its constancy and diffusion interval in the blood, 64 but in the case of polymer-drug amalgamations, the polymers deliver improve the circulating time in blood for cytotoxic drugs, with improved aqueous solubility. Passive beleaguered delivery to tumors and low toxicity increase the remedial value of the anticancer drug. 63,65 In both cases, these constructions can be measured as "new chemical entities" with a penchant for drug carriers, with low drug loading and limited potential for active targeting due to the limited number of compound sites available in the polymer. 64 In combination, PEG-L-asparaginase (pegaspargase or Oncasper), a polymer-protein conjugates, is administered intravenously. 66,67 Pegaspargase is a primary polymer-protein conjugate authorized through the U.S. Food and Drug Administration (FDA) in 1990s for the treatment of acute lymphoblastic leukemia. 43 Recent research does not have any new FDA approvals for cancer treatment, but there are enzymes (arginine deaminase) and bio biological response modifiers (interlukin 2, interferon-, and antibody fragments). 68,69 Research on polymer-drug compounds for the cure of age-related, 54 cancer currently consists of at least 20 compounds (most of which are in closed state) 62 and are mainly used Instead of conventional cytotoxic drugs, for instance, platinates, 70 doxorubicin, camptothecin, paclitaxel, methotrexate, and irinotecan. In phase III clinical trials, Xyotax (CT-2103 or OPAXIO), a polyglutamic acid (PGA)-paclitaxel conjugate, and NKTR-59, a polymeric conjugate of irinotecan, are close to commercialization. 53,71 In 1994, a manmade polymer-drug conjugate based on N-(2-hydroxypropylene) methacrylamide-doxorubicin became the key component in medical trials. Since then, no further polymer-drug conjugates based on artificial polymers such as HPMA, PGA or PEG have been submitted for medical trials. Additionally, numerous natural polymers can be classified as polymer-drug conjugates, though only some polysaccharides, hyaluronic acid, human serum albumin, and dextran have reached the stage of clinical trials. 53 The most notable breakthrough in the direction of medical use of polymer-drug conjugates is the docosahexaenoic acid-paclitaxel conjugate (Taxol), which has recently entered the phase III clinical trials of cancer treatment. 2,72 Although nearly all polymer-drug conjugates use passive targeting, active mechanisms with targets such as antibodies, peptides, and folate have evolved over the years. 53 Polymer-drug conjugates 53 are also being researched for their potential to inhibit specific kinases, accelerate apoptosis, or reduce angiogenesis (polycystic ovary syndrome). 73
Conclusion
As the exosomes enter the bloodstream or urinal tract, if the apprehending system is in place, it will become a much less intrusive test to make out cancer. 1 Since exosomes contain not only DNA but also other genetic material and proteins, it is a novel instrument for cancer research that includes the early prognosis of cancer. Normal mobile homeostasis is predicted by the interchange of genetic biological substances across the membrane and enables such transport by vessels that transport the cargo to the suitable destination. They are immersed in the ubiquitous external environment and are featured by specific capabilities contingent on the secreted cell of the foundation. 1 Exosomes contribute to the technique of chemo-organotropic metastasis and additionally involve extra essential chemooncogenic indicators in integrating the selection and function of the analogous exosome in chemoorganotropic metastasis. Ultimately, to detail the complex mechanisms of regulation and cross-communication that exist between cancer and stromal cells, further research is needed. Furthermore, the origin and biological impact of diversity in exosomes continue to be largely unknown due to the deficiency of analytical platforms and accessible equipment. The standard features of the human immune system such as accurate detection and removal of cancer cells, adaptation to the developing tumor, and memory of the immune system appear to be an excellent aggregate to develop an effective defense for long-term cancer regulation.
Microbiome may be an addition in advanced cancer prognosis and treatment. Exposure of a particular microorganism in the gastrointestinal tract can envisage particular cancer proliferation. Microbiome is extraordinarily essential for human health; at contemporary times its function in the context of cancer is clear. Microbial outcomes vary from improving cancer immunity and cancer treatment efficiency to promoting cancer advancement and preventing treatment effectiveness. These broad implications have prompted researchers to analyze these specific interfaces, along with how vicissitudes in the microbiome augment the survival and treatment potential of most cancers. For cancers such as gastric cancer, these interactions have been well established; however, they are rarely understood in other cases. Since nonsmall cell lung cancer is the bulk of lung cancer cases and one of the pinnacle causes of cancer deaths globally, the specificity of the mechanisms that affect microbiome evolution is compulsory for measures and treatment to prolong patient's endurance and treatment reaction.
As the field of cancer immunotherapy has evolved, the focus of treatment has lifted from handling the disease site to treating specific tumor biological symptoms and its relations with the patient's internal cancer autoimmunity set-point. Because the immune system has the ability to recollect and detect and destroy tumor forms, immunotherapy always has integral benefits compared with other therapies that do not have these two main indications. Finding out why immunotherapy treatments work best in some cancers and in some patients is even more thought-provoking, while in others tumors that were once sensitive to treatment may become resistant. To be particularly effective, cancer immunotherapy must discover conducts to change the immune system in patients who show a low or no immune response to their tumors, even to the tumor microenvironment without tumor-infiltration T-cells. Despite the promise of immunotherapy for cancer treatment, only a minority of cancers respond to some of these treatments.
Nanotechnology is pragmatic in cancer treatment and has ushered a new era in cancer treatment. A variety of NPs, including organic and inorganic NPs, are already widely used in the medical treatment of a wide variety of cancers. Furthermore, nanocarrier delivery systems make available better platforms for combination therapy, which can help drug resistance to hypoxia, including flux transporter overexpression, defective apoptotic pathways, and hypoxia in the tumor microenvironment. The use of nanovaccine and synthetic antigen presenting cells has demonstrated greater effectiveness than conventional immunotherapy; however, the medical effectiveness of this treatment is unsatisfactory, and its safety and permissibility must be explored further. Furthermore, the development of immunomodulatory factor-loaded NPs enhances the efficacy of inoculations for immunotherapy.
Organoids can also help solve the problem of drug resistance and lead to the advancement of modified therapies. However, the preparation of organoids takes time and may take even take longer to test for drug resistance. Present-day advances in in-vitro 3D culture technological expertise, comprising organoids, have opened new opportunities for the development of unique, more physical human cancer models. The genetic modification of organoids allows disease modelling in a setting that accesses the biological environment. In addition, organoids can be raised from patient-derived healthy and highly functional tumor tissue, undoubtedly allowing for patient-accurate drug testing and improving personalized treatment regimens. If we can overcome these problems, research on organoids can help overcome cancer. Therefore, these five new cancer research fields will make a significant difference to the diagnosis and treatment of most cancers.
|
v2
|
2022-12-12T05:15:29.712Z
|
2022-11-28T00:00:00.000Z
|
254535309
|
s2orc/train
|
Particle Beam Therapy for Intrahepatic and Extrahepatic Biliary Duct Carcinoma: A Multi-Institutional Retrospective Data Analysis
Simple Summary We examined the outcome of patients with biliary duct carcinoma treated with particle beam therapy, which has a potential advantage to be prescribed at a higher dose. The median survival time (MST) was 21 months in the total population, and were 20 and 23 months for extrahepatic BDC and intrahepatic BDC, respectively. A higher radiation dose EQD2 ≥ 67 Gy improved OS in extrahepatic BDC. PT showed good efficacy for BDC, both eBDC and iBDC, with a low incidence of severe toxicity. Abstract To examine the efficacy and toxicity of particle beam therapy (PT) for biliary duct carcinoma (BDC) and compare the outcomes between extrahepatic BDC (eBDC) and intrahepatic BDC (iBDC). We analyzed multi-institutional data from May 2009 to December 2019. The primary endpoint was overall survival (OS), and the secondary endpoints were local control (LC), progression-free survival (PFS) and toxicity. We included 150 patients with unresectable BDC treated with PT using a median prescribed dose of 70.2 GyRBE (range, 44–77 GyRBE) in 25 fractions (range, 10–38 fractions). With a median follow-up of 13.0 months, median survival time (MST) was 21 months, and 2-year OS was 44.8%. For eBDC and iBDC, the MSTs were 20 and 23 months, respectively. Two-year PFS and LC rates were 20.6% and 66.5%, respectively. Vascular invasion, prescribed dose and serum tumor marker level (carcinoembryonic antigen: CEA) were identified as poor prognostic factors for OS. A higher radiation dose EQD2 ≥ 67 Gy showed superior OS, with a hazard ratio of 0.341. The radiation dose of PT is an important predisposing factor for overall survival. The MST for patients with eBDC given a higher radiation dose was 25 months, compared to 15 months for those given the lower dose and 23 months for patients with iBDC (all iBDC given higher doses). iBDC and eBDC duct carcinomas showed equivalent outcomes with PT, especially when treated with a high radiation dose. In detailed analysis, baseline CEA level in iBDC, and radiation dose and GTV in eBDC were statistically significant predicators for OS. Acute and late toxicity grade ≥3 occurred in 2.2% and 2.7% of patients, respectively, including two late grade-5 toxicities. In conclusion, PT showed good efficacy for BDC, both eBDC and iBDC, with a low incidence of severe toxicity.
Introduction
Biliary duct carcinoma (BDC) comprises a heterogeneous population, including intrahepatic BDC (iBDC) and extrahepatic BDC (eBDC; perihilar, distal cholangiocarcinoma, and gallbladder cancer). These are rare malignancies in most high-income countries, but represent a major health problem in endemic areas [1,2].
Surgery is considered the only curative procedure; however, few patients can undergo upfront resection because of local disease progression [1,3]. For unresectable cases, the standard treatment is systemic chemotherapy, i.e., gemcitabine and cisplatin; however, the prognosis is poor, with a median survival of approximately one year [1,4]. Several studies have suggested that radiotherapy (RT) could improve tumor control and survival, but this lacked a high level of evidence [1,4,5]. One reason for this was the limited prescribed dose of conventional RT, which is restricted by adjacent organs at risk (i.e., intestine, stomach and liver)-this results in tumor progression inside the irradiation field. Technical advancements in RT, stereotactic radiotherapy (SBRT), intensity-modulated radiotherapy (IMRT), respiratory gating and image guidance with computer tomography have enabled the delivery of larger doses to the tumor without elevating the dose in surrounding normal tissues [5][6][7][8]. Additionally, particle beam therapy (PT) using protons or carbon ions has emerged as a highly promising procedure. PT has an advantageous physical property over radiotherapy with photons, as a spread-out Bragg peak (SOBP) offers superior dose distribution for the target volume [9][10][11][12]. Several studies have reported outcomes of PT for BDC [9][10][11][12].
Evidence indicates distinctly different characteristics between iBDC and eBDC, including differing molecular profiles [1,2,13]. Different definitions and statistics were performed between iBDC (one of the liver cancers [14]) and eBDC (an independent category) as separate entities, although some data are available for comparing the differences between iBDC and eBDC for PT [9][10][11][12]. Therefore, we conducted a comparative study of eBDC and iBDC.
This study aimed to examine the efficacy and toxicity of PT for BDC, and compare the outcomes between eBDC and iBDC.
Materials and Methods
This retrospective study included patients with non-metastatic BDC treated with PT at 6 institutions between May 2009 and June 2019. The inclusion criterion was unresectable extrahepatic cholangiocarcinoma unsuitable for curative surgical treatment (patients who refused surgery were deemed unresectable). From 185 patients during initial registration, 35 were excluded for the following reasons: previous surgery or planned surgery (n = 11) and recurrence (n = 24). We included 150 patients in the analysis (Table 1). 49 out of 53 patients with jaundice received stenting after endoscopic or percutaneous drainage.
The most frequently used schedules were 72.6 GyRBE/22 fractions (n = 25), 76 GyRBE/20 fraction and 76 GyRBE/38 fraction (n = 17) (Table S1). One patient stopped treatment for biliary tract infection at 44 Gy/22 fraction. The major systemic therapy agent for concurrent therapy was gemcitabine or TS-1, and was a combination of both cisplatin and gemcitabine for the neoadjuvant (adjuvant) setting. Details of the treatment in each institution have been described elsewhere [9][10][11][12]. In brief, 144 patients were treated with a passive scatter broad beam, and 4 patients with spot scanning. A respiratory gating system (Anzai Medical, Tokyo, Japan) was used in several institutions. Daily image guidance/motion management was performed using gold marker and pretreatment imaging (MVCT, Orthogonal kVX ray, etc.) in several institutions.
All patients were staged according to the 7th edition of the Tumor-Node-Metastasis Staging System (International Union Against Cancer, 2009). We analyzed overall survival (OS) as the primary endpoint. Progression-free survival (PFS), local control rate (LC) and toxicity were analyzed as secondary endpoints. This multicenter retrospective data accumulation study was approved by the institutional review board (Kyoto Prefectural University of Medicine; ERB-C-1747-2) and each participating institution. The study protocol was performed according to the principles of the Declaration of Helsinki. Adverse events were classified according to the National Cancer Institute Common Terminology Criteria for Adverse Events, version 4.0. Acute toxicities were defined as occurring during PT or within 90 days after PT completion, and late toxicities occurred after 90 days.
Statistical Analyses
StatView 5.0 and EZR stat package15 was used for statistical analyses [15]. Percentages were analyzed using chi-square tests, and Student's t-tests were used for normally distributed data. Mann-Whitney U-tests for skewed data were used for comparisons. The Kaplan-Meier method was used to analyze OS, PFS and LC. The time of the event was determined from the start of PT. Cut-off values were set at the median or mean value if they were not specified. For GTV, CTV, PTV and baseline CEA level, we used ROC analysis to define the cut-off values. We used 67 Gy in EQD2 (≈ 80.5 Gy in BED10; α/β = 10) as a cutoff value for the prescribed dose according to the previous study [16]. Cox's proportional hazard model was used for uni-and multivariate analyses (variable p ≤ 0.2 was entered into multivariate analysis). p < 0.05 was considered statistically significant. lymph node involvement and wider distance between the tumor and gastrointestinal (GI) tract than in eBDC. Patients with iBDC underwent a higher dose of radiotherapy and less frequent concurrent chemotherapy than those with eBDC. No background difference was found in patients who underwent proton and carbon (Table S2).
Discussion
The purpose of this study was to evaluate the efficacy and toxicity of PT for BDC and compare the outcomes between eBDC and iBDC. To the best of our knowledge, this is one of the largest series of outcome reports on PT-treated BDC. Our study found that PT showed good efficacy with a low frequency of severe toxicity. Moreover, this is first study to report the importance of a higher radiation dose related to improved outcomes in separated eBDC population and equivalent outcomes between iBDC and eBDC, especially in patients treated with higher radiation doses, as demonstrated.
Radiation dose escalation had been explored for improving the outcomes of several hepatobiliary cancers [16][17][18][19]. In the 20th century, Crane et al. found that EBRT dose (30 Gy, Gy and 54-85 Gy) is dose-dependent with median time to local progression (9 vs. 11 vs. 15 months), and no significant increase in toxicity [17]. However, dose escalation using conventional 3D-CRT is a difficult task, due to the accompanying increased toxicity to adjacent organs. The proximity of BDC to the bowel limits the ability to escalate the radiation dose to above 55 Gy without severe toxicity [5,19,20]. Brachytherapy has been employed to elevate the irradiated dose without elevating the irradiation of adjacent normal tissues [21][22][23]. Brachytherapy improved local tumor control near the bile duct, which increased stent patency; however, this did not translate to longer survival in the entire population [24].
In recent years, several advanced radiotherapy techniques, including SBRT and IMRT, have been introduced for treating BDC [5]. The SBRT technique enabled us to deliver a higher dose than conventional radiotherapy, resulting in improved local control, especially in lung and liver diseases [25]. However, increasing radiation dose also caused severe elevated radiotherapy-related adverse events adjacent to the target volume, i.e., the gastrointestinal tract. Lee et al. reported outcomes of SBRT (MST of 13 months) with a frequency of late toxicity around 10-20% in a systematic review [26]. The IMRT technique may therefore be an alternative to reduce normal tissue toxicity [5], with reported 45-100% LC and 58-81% 1-year survival rates [5].
Tao et al. demonstrated that dose escalation BED > 80.5 Gy10 ( 67 Gy in EQD2, proton or photon) for iBDC improved OS (73% vs. 58% 2-year OS rate) [16]. They increased the doses of radiation delivered to the tumor using a smart simultaneous integrated boost (a dose of 100 Gy in 25 fractions into the center of the tumor), and integrated protection (GTV dose does not overlap with planning risk volume) technique with hypofractionation [16]. PT has the distinct characteristic of rapid dose off; a lack of exit dose theoretically offers a higher radiation dose without elevating normal liver dose (low rates of grade 3 toxicity and/or worsening hepatic function). Hong et al. reported a 2-year survival rate of 46.5% for iBDC obtained in a prospective multicenter study of proton beam therapy and 7.7% grade ≥3 toxicity [20]. These results imply that PT could have an advantage over photons, especially in iBDC [18][19][20]. Our data of a 47.3% 2-year survival rate for iBDC concurred with their result.
There are differing characteristics between iBDC and eBDC, not only in the anatomical position of the tumor, but also in biological behavior [13]. Kang et al. reported differences in outcomes among BDC by location in the Korean population, where the highest incidence of BDC was reported. The 5-year relative survival rate was highest in the ampulla of Vater (48.5%), followed by the gallbladder (28.5%) and other sites of eBDC (19.9%) and iBDC (10.8%) [27]. Their data included all populations with or without treatment, and the difference was apparent among BDC locations. In general, iBDC showed poorer outcomes than eBDC; however, in dose-escalated radiotherapy series such as PT, iBDC did not show an inferior outcome to eBDC [9][10][11][12]20]. As eBDC is located in close proximity to the bowel, PT dosage was limited, and was difficult to elevate the tumor dose. In our cohort, all patients with iBDC could receive a higher prescribed dose of EQD2 ≥ 67 Gy, whereas 64.6% (53/82) of eBDC received a higher dose (78.5% in hilar, 17.6% in other and 55.5% in gallbladder). From the literature, PT had an MST of 23-24 months [9][10][11][12]20] in iBDC and 12.6-23 months for eBDC [12,28]. Our data concurred with the previous finding that similar MSTs of 20 months in eBDC (25 months for higher radiation dose EQD2 ≥ 67 Gy vs. 15 months with lower radiation dose EQD2 < 67 Gy) and 23 months (with higher radiation dose) in iBDC were found (Figure 2).
Elganainy et al. did not observe improvements in the OS of patients with eBDC using a higher dose of BED > 59.5 Gy10 to segments of tumor distal from the small bowel vs. conventional external beam radiotherapy to a BED ≤ 59.5 Gy10 [29]. These results partly demonstrated that the irradiated dose threshold, BED ≤ 59.5 Gy10, is lower than the BED 80.5 Gy10 used in Tan's study, and may not be sufficient to control the tumor. In SBRT, Brunner et al. also found that OS was significantly improved after higher dose irradiation (BED max 91 Gy inside the tumor) for eBDC [30]; our data concurred with Brunner's findings, and could widen the potential of PT, which is an option to prescribe higher doses to improve outcomes for them.
We identified GTV as a significant predicator for survival, but only in eBDC and not in iBDC. Brunnner et al. reported that significance of tumor diameter 40 mm at diagnosis distinguished two survival profiles (21.4 vs. 8.7 months; p = 0.01) in non-bulky eBDC treated with chemoradiotherapy using conventional 3D-CRT [31]. On the contrary, however, tumor size and PTV were neither predictive nor prognostic for LC and OS for SBRT, treating mix population with eBDC and iBDC by the same author [30]. There is a controversy with pros [9,29] and cons [12] for importance of tumor volume for survival, and therefore this issue should be left for further explorations.
Baseline CEA levels were also identified as significant predicators for survival. This is natural because the baseline CEA level is one of the most universally used blood tumor marker, which impacts survival in several cancers, including BDC [1,5].
This study has several limitations. First, retrospective multicenter data accumulation is prone to selection bias, which may compromise the completeness of data, especially on late toxicity. Second, the lack of histological confirmation. Despite combined brush cytology and forceps biopsy, there were certain difficulties in obtaining histological confirmation [32]. In fact, we could not find a statistical difference in OS between patients who were histopathogically diagnosed (2-year overall survival rate of 46.9%) and patients with imaging and tumor markers (43.9%). Third, although we could not find a role for systemic therapy, several new systemic treatments may influence the outcome. Despite these limitations, this multicenter study is one of the largest analyses of BDC.
Conclusions
In conclusion, this multicenter study showed good efficacy with a low incidence of severe toxicity of PT in patients with BDC, both eBDC and iBDC, who did not undergo surgery.
Supplementary Materials: The following supporting information can be downloaded at: https: //www.mdpi.com/article/10.3390/cancers14235864/s1, Figure S1: (A) Local control rate according to CTV, (B) Local control rate according to EQD2, (C) Progression free survival rate according to CEA level; Table S1, Detailed treatment schedule; Table S2: Comparison of background characteristics in patients treated with carbon and proton.; Table S3. Uni-and Multivariate analysis for local control rate using Cox proportional hazards model.; Table S4. Uni-and Multivariate analysis for progression free survival rate using Cox proportional hazards model.
Institutional Review Board Statement:
This multicenter retrospective data accumulation study was approved by the institutional review board (Kyoto Prefectural University of Medicine; ERB-C-1747-2) and each participating institution.
|
v2
|
2022-12-12T05:20:53.924Z
|
2022-11-28T00:00:00.000Z
|
254534846
|
s2orc/train
|
Locoregional Approaches in Cholangiocarcinoma Treatment
Simple Summary Our current ability to treat cholangiocarcinoma is limited. Surgery to remove the tumor is only possible in a small proportion of cases of the disease due to the tumor’s location or spread to other sites in the body. When surgery is not an option, locoregional therapies that target their treatment to a small region have the potential to slow progression, decrease the size of the tumors, increase overall survival, and in some cases, allow for cure. This review will discuss what locoregional therapies exist, their role is in treatment of cholangiocarcinoma, and their impact on patients. Abstract Cholangiocarcinoma (CCA) is a rare hepatic malignant tumor with poor prognosis due to late detection and anatomic factors limiting the applicability of surgical resection. Without surgical resection, palliation is the most common approach. In non-surgical cases contained within the liver, locoregional therapies provide the best chance for increased survival and disease control. The most common methods, transarterial chemoembolization and transarterial radioembolization, target tumors by embolizing their blood supply and limiting the tumor’s ability to metabolize. Other treatments induce direct damage via thermal ablation to tumor tissue to mediate their anti-tumor efficacy. Recent studies have begun to explore roles for these therapies outside their previous role of palliation. This review will outline the mechanisms of each of these treatments, along with their effects on overall survival, while comparing these to non-locoregional therapies.
Introduction
Cholangiocarcinoma (CCA) is an epithelial cell malignancy typified by features of cholangiocytes that can occur at multiple locations throughout the biliary tree. It is the second most common hepatic malignant tumor in the West, with incidence of approximately 2.1 cases per 100,000, and incidence continues to rise [1]. CCA is much more common in Asia, with incidence as high as 113 per 100,000 [2]. However, CCA only makes up 3% of gastrointestinal malignancies and 15% of primary liver cancers. This is contrasted with the significantly more common hepatocellular carcinoma (HCC), a cancer of hepatocytes, and located in the same region [3]. CCA typically has a poor prognosis, which can be ameliorated with early detection. In terms of anatomic location, CCAs are defined as either intrahepatic, which comprises up to 10% of CCA, or extrahepatic [4,5]. Extrahepatic CCA is divided into distal (30%) or perihilar (60%) categories. The location of a tumor is particularly important because, historically, the primary curative treatment for CCA is surgical resection. In addition to surgical resection, liver transplantation has been used for perihilar CCA that is otherwise unresectable [6,7]. Survival of patients without treatment is poor, with a median overall survival time of 3.9 months, ranging from 0.2-67.1 months [8]. Typically, CCA present as aggressive tumors, with most patients presenting with their disease in an advanced stage [9]. Earlier diagnosis is hampered by the asymptomatic nature of early-stage disease and the fact that CCA's clinical presentation broadly depends on the tumor's location, stage, and growth. This difficulty with early diagnosis directly leads to detection of disease in an unresectable state, which necessitates the use of locoregional methods for treatment. CCA is associated with parasitic infection, cirrhosis, hepatolithiasis, biliary-duct cysts, inflammatory bowel disease, hepatitis B and C viruses, and primary sclerosing cholangitis (PSC), among others [10].
Intrahepatic Cholangiocarcinoma
Using the Liver Cancer Study Group of Japan (LCSGJ) classification, intrahepatic CCA (iCCA) grows in three primary patterns: mass-forming (within the liver parenchyma, most common), periductal-infiltrating (along and within bile duct), and intraductal (contained within the lumen of the bile duct) [11]. The mass-forming and periductal-infiltrating iCCA have a poorer prognosis and higher rates of recurrence [12,13]. The presentation of iCCA is nonspecific, including abdominal pain, weight loss, night sweats, and gastrointestinal disturbances [14]. Jaundice is uncommon, found in approximately 20% of patients. All these non-specific findings lead to difficulty in detecting iCCA, and most that are detected are incidental. Detecting iCCA is performed using CT and MRI. Tumor marker measurements of CA19-9 and CA242 have been utilized in distinguishing iCCA from hepatocellular carcinoma (HCC), but have limited utility in detection compared to monitoring for recurrence [15]. However, no data suggest that definitive diagnosis can be made prior to biopsy [16].
Extrahepatic Cholangiocarcinoma
Extrahepatic cholangiocarcinoma (eCCA) is divided into perihilar CCA (pCCA) and distal CCA (dCCA). pCCA is categorized by the UICC and WHO, who use differing definitions. The Bismuth-Corlette classification of pCCA stratifies by ductal infiltration [17]. In the UICC/AJCC classification, the threshold between iCCA and pCCA is the secondorder bile ducts and between dCCA by the insertion of the cystic duct, whereas the WHO system defines it as arising from the intrahepatic bile duct epithelium [18].
Due to their anatomic location, eCCA presents with biliary symptoms such as painless jaundice in 90% of patients, and cholangitis in 10% of patients [19]. Due to this apparent presentation, eCCA can be diagnosed earlier and in an earlier stage than iCCA, which is associated with a more positive prognosis. Beyond biliary symptoms, eCCA can present with symptoms typically associated with malignant disease, such as anorexia, fatigue, and weight loss, in 56% of patients [20]. Laboratory abnormalities such as elevated liver function tests and alkaline phosphatase can support diagnosis of eCCA vs. iCCA due to the disruption of the biliary tree. This can present on physical exam with a palpable enlargement of a single hepatic lobe [21]. Due to the presence of painless jaundice, diagnostic workup of eCCA often begins with ultrasound, which is neither specific nor sensitive for eCCA. However, cross-sectional imaging, typically contrast CT or MRI/MRCP, is the next diagnostic test and is the most important test for detection [22]. PET/PET-CT is less sensitive for eCCA (approximately 60%) compared to iCCA (greater than 90%) and cannot be relied upon for detection of iCCA, though it has value in the staging of both iCCA and eCCA [23]. Cholangiography also has significant benefit in visualizing the biliary tree and preoperative planning [24,25].
Non-Locoregional Therapies in Cholangiocarcinoma
Collectively, CCA has poor prognosis and poor overall survival. One study found that dCCA had 1-, 3-, and 5-year overall survival of 46%, 18%, and 11% [26]. This study included patients treated with resection and palliative chemotherapy for metastatic disease. Another study compared HCC, gallbladder cancer, and CCA, with the finding that CCA had median survival time of 180 days and 600 days if patients receiving best supportive care were excluded [27]. The study analyzed patients treated between 2009 and 2016 and noted significantly increased (p < 0.011) survival rates over time. In addition to later diagnosis of CCA, overall survival rates in CCA are negatively affected by the high rates of recurrence [28]. More than half of patients with pCCA experienced recurrence, even when microscopic investigation of the margins was negative, called R0 resection [29]. One study, which found an overall survival of 40 months, found a recurrence rate of 76% in patients at eight years, including a 28% recurrence rate in patients who had already experienced a 5-year recurrence-free period [30]. This highlights the difficulty in achieving durable remission in CCA. Adjuvant chemotherapy and radiotherapy were found to be associated with worse 5-year survival (p < 0.001), due largely to their association with node-and margin-positive disease. Poor prognostic factors for CCA include increased age, greater tumor invasion, higher lymph node ratio, poor differentiation, and resection with positive margins [26].
Thus far, surgical resection is the first line choice for curative intent in patients in any type of CCA [31,32]. As surgical resection is the only curative option for CCA with significant efficacy, resection is indicated in any case in which it is possible, given the anatomical and clinical picture. Resectability can depend on anatomic location. Generally, the purpose of surgical resection is to remove the involved bile ducts and the portal lymph nodes draining the involved region, focusing on a surgical outcome with negative margins. Due to location in iCCA and pCCA, lobar removal of the liver is often required. Due to this loss of liver tissue, the volume of functional liver post-surgery needs to be considered to promote the patient's functional status. Generally, resection will require at least 25% of healthy preoperative liver to survive, with higher thresholds for unhealthy livers. Both locoregional and distance metastases can occur. One study showed disease recurrence in 53% of patients with pCCA, even after R0 resection [33]. In that study, the majority (43% of all patients) developed distant metastases, compared to 10% who developed locoregional recurrence, demonstrating the limitations of surgical resection, even in cases of R0 resection. The study also noted the role of adjuvant therapy to prevent this recurrence.
However, resection is limited by the ability to leave sufficient future liver remnant, along with the degree of compromise of the biliary tree and the possibility of biliary reconstruction [34]. Preoperative portal vein embolization should be performed in patients with low FLR to preserve volume of healthy liver post-surgery [35,36]. Portal vein embolization is also performed before hepatectomy for other liver cancers, such as HCC [37][38][39].
Alternatives to resection are not widely accepted for CCA. Liver transplantation has been performed for iCCA and is clearly not an option for most extrahepatic CCA. Studies have shown that in patients with small (<2 cm), "very early" iCCA, transplantation can lead to excellent 5-year survival (100%, 73%, and 73% at 1, 3, and 5 years) [40]. Another study sought to compare liver transplant to surgical resection with hepatectomy in patients with iCCA and hilar CCA. That study showed that liver transplant led to significantly improved survival (33% vs. 5%, p = 0.05) over the resection group [41]. They also included analysis of neoadjuvant and adjuvant therapies versus no additional therapies or simply adjuvant therapy, showing improved patient survival with the neoadjuvant and adjuvant therapies (47% vs. 20% vs. 33%, p = 0.03). Unlike other studies, they did not find that large tumor sizes were an independent predictor of poor outcomes. However, low survival rates in liver transplantation, with the added burden of the transplantation, make transplantation a poor option in many centers, though that has been ameliorated by newer development of guidelines for careful criteria [42,43]. These studies show the utility of transplantation in the surgery-systemic therapy-locoregional therapy paradigm.
In addition to surgical methods, pharmacologic treatments have been explored [44]. Early studies of chemotherapy-based approaches in CCA used gemcitabine and cisplatin, with the combination therapy superior to gemcitabine alone, with higher rates of tumor control and greater overall survival than gemcitabine alone (11.7 months vs. 8.1 months, p < 0.001) [45]. Current chemotherapeutic standard of care for CCA consists of gemcitabine and cisplatin. When used as an adjuvant, gemcitabine plus oxaliplatin has not been shown to improve survival or quality of life [46]. However, current standard of care for adjuvant chemotherapy for CCA is capecitabine [47]. This was based on the BILCAP trial, which compared capecitabine vs. observation following surgery, and showed superior overall survival [48].
Newer chemotherapies using immune checkpoint inhibitors have begun to be developed, but are currently second-or third-line behind gemcitabine and cisplatin [49]. PD-1, PD-L1, and CTLA-4 are immune checkpoints that have been targeted for CCA treatment and are expressed by activated T cells. Fibroblast growth factor antagonists have been introduced for CCA treatment, with clinical trials ongoing to optimize their use in the clinical setting, with several new drugs (derazantinib, infigratinib, erdafitinib, pemigatinib, and fuinatinib) undergoing clinical trials [50]. These treatments work on the finding that 10-15% of iCCAs have FGFR2 fusions, compared to eCCA, which very rarely present with FGFR alterations. Isocitrate dehydrogenase 1 and 2 have also emerged as a target, with clinical trials evaluating its use [51].
The lack of a comprehensive in vitro model of CCA has limited our ability to study and develop new treatments, partly because the in vitro model is limited in its two-dimensional structure, which does not represent the tumor environment [52]. Organoid-based model and in vivo models are also being investigated [44].
Locoregional Therapies in Cholangiocarcinoma
Like HCC, locoregional and interventional therapies have utility in unresectable cases of CCA. The liver receives 80% of its blood supply from the portal vein, compared to approximately 20% of its blood supply coming from the hepatic artery [53]. This division in blood supply has long served as an important anatomical framework for vascularly directed therapy in HCC [54][55][56]. In contrast to HCC, CCA is a less vascular tumor, suggesting a lessened role for these therapies. However, the data from many studies show survival benefit of interventional therapies with a vascular approach in cases of unresectable CCA [57][58][59][60]. These treatments are generally used for palliation in unresectable CCA, though disease control can also be achieved. Difficulties in studying these methods include the relative rarity of CCA, along with the subset of CCA patients who are not eligible for resection, creating a relatively small sample of patients for whom each non-curative treatment method is appropriate. Treatment response in patients receiving these therapies is generally assessed with the RECIST criteria [61,62]. An overview of the most common locoregional treatments in CCA is found in Table 1.
Transarterial Chemoembolization
The key principle behind transarterial chemoembolization (TACE) is that tumors require greater blood supply to support their increased metabolism compared to nonmalignant tissue. To support this metabolic demand, the tumor promotes angiogenesis, creating blood flow from the hepatic artery. This creates a vulnerability, which multiple catheter-directed therapies exploit, to directly target tumor over other, healthy liver tissue. TACE is one such catheter-directed therapy that uses the approach by introducing chemoembolic agents that embolize the arteries supplying the tumor, leading to tumor cell death via cellular membrane disruption due to the induced ischemic state formed by the embolus [63]. Due to the anatomical approach of TACE, it is more commonly, and better, studied in iCCA than eCCA.
There are two primary variants of TACE in treatment use today: conventional TACE (cTACE) and drug-eluting bead TACE (DEB-TACE). In cTACE, chemotherapeutic agents are directly administered via the hepatic artery and its branches. By emulsifying the chemotherapeutic agent in lipiodol oil, the treatment effectiveness is increased with decreased washout, achieving higher concentrations and activity in the target tissue. DEB-TACE utilizes drug-eluting beads to target its agents to the tumor tissue. Both approaches allow superior targeting than systemic chemotherapeutic agents [57]. Broadly speaking, these two methods are similar in patient characteristics, OS, and response [64]. The role of TACE is generally as a replacement for surgical resection in patients with unresectable disease. One study showed that in patients with lymph node-positive disease or a positive resection, surgery has no survival benefit over either TACE method [65].
Outcomes in Transarterial Chemoembolization for Intrahepatic Cholangiocarcinoma
Early studies in TACE were generally retrospective. One such study compared cTACE vs. supportive care for 155 patients enrolled between January 1996 and April 2009 [60]. The findings strongly supported the role of TACE, showing significantly increased survival for patients receiving TACE (12.2 months) over patients receiving supportive treatment (3.3 months). While no patients showed complete response, 23% of patients showed partial response and 66% showed stable disease. There was a significant rate of both hematological toxicities (13%), such as thrombocytopenia and hemoglobinemia, and non-hematological toxicities (24%), such as bilirubinemia and decreased albumin.
TACE has also been evaluated with systemic chemotherapy as an adjuvant. One study, which evaluated cTACE with cisplatin, doxorubicin, and mitomycin-C, evaluated survival, median time to progression, and complications in these patients [66]. The median survival from first treatment was 15 months, with 1-, 3-, and 5-year survival of 61%, 27%, and 8%, respectively. In their group of 62 patients, there were five major complications: pulmonary edema, pulmonary infarct, severe postembolization syndrome (PES), hyperglycemia, and one patient with acute renal failure and dehydration. All five of these patients recovered and were discharged. These results are significantly better than external beam radiation or systemic therapies [4].
There have been multiple meta-analyses including TACE therapies [64,67]. While the specific increase in survival varies amongst studies, there is a consistent result of increased survival of 207 months in patients receiving TACE treatments compared to systemic therapies, along with improvements in complications and disease progression. The variation between studies is possibly due to inclusion criteria and tumor features. The primary outcomes from TACE are based on palliative goals, with improved survival the most likely outcome.
However, some studies have examined TACE as a downstaging tool. One early study, which included 17 patients with unresectable iCCA, successfully downstaged 2 patients to surgical resection, with 1 of those patients disease-free at the time of publication [68]. Another more recent study of 109 patients showed that 4 patients (3.8%) were able to undergo resection following TACE therapy, with the majority showing stable disease following treatment. Most studies of TACE efficacy do not specifically include reports of downstaging, some due to experimental design.
Transarterial Chemoembolization for Extrahepatic Cholangiocarcinoma
The anatomical differences between eCCA and iCCA have limited the number of studies on catheter-directed therapy in eCCA, but there is evidence to support the use of TACE in patients with eCCA. One retrospective study evaluated the use of cTACE using gemcitabine and cisplatin in patients with hilar cholangiocarcinoma (a division of eCCA) when used alongside radiotherapy [69]. They also examined stent patency, with all patients having received biliary drainage tube placement with or without biliary stent implantation. They found survival of the dual treatment (TACE plus radiotherapy) was 20.0 months, compared to 10.5 months in the control group (untreated with TACE or radiotherapy, p < 0.05), along with increases in stent patency. These data suggest efficacy of TACE in eCCA that is potentially similar to cases of iCCA.
Side Effects in Transarterial Chemoembolization
One of the key side effects of TACE is post-embolization syndrome (PES). It is associated with longer hospital stays and recurrent admissions following multiple catheterdirected therapies in the liver for intrinsic and extrinsic liver malignancies [70]. It is found in up to 90% of patients undergoing hepatic chemoembolization and is thought to be due to off-target embolization leading to destruction of arteries supplying the stomach, duodenum, gallbladder, skin, or diaphragm. In PES, embolization leads to cytolysis which can occur in healthy liver tissue [71]. It presents with abnormalities in liver function tests, fever, nausea, malaise, loss of appetite, and abdominal pain [72]. Currently, there is no data to suggest variations in complications or complication rate between cTACE and DEB-TACE.
Transarterial Radioembolization
Transarterial radioembolization (TARE) utilizes similar techniques to TACE: targeted embolization via the hepatic artery leading to local ischemia and death. It is also called selective internal radiotherapy (SIRT) and utilizes a radioisotope of yttrium (Y 90 ), which is bound to microspheres for targeting, in contrast to the TACE approached of chemotherapeutic agents bound to the microspheres [73]. Over a two-week period, the Y 90 radioisotopes undergo beta decay, irradiating the tumor [74]. The precise mechanism for cellular death in this treatment continues to be explored [75]. The general procedure is similar to TACE, being a catheter-directed therapy through the hepatic artery to the specific region containing the tumor. Unlike external beam radiation, Y 90 therapy allows increased radiation dosages to be delivered, which leads to improved anti-tumor activity [76].
One important difference compared to TACE is the latency of the treatment effect, brought about by the necessary two-week period during which the radioisotopes are undergoing decay and radiating the tumor, compared to the various effects of chemotherapeutic agents, which begin functioning over a much shorter time period. Another downside of TARE is that off-target Y 90 radioisotopes pose a greater risk of non-local complications than TACE. This concern can be mitigated through a planning arteriography procedure performed shortly before treatment. This procedure has multiple aims: first, to map the tumor's vascular anatomy to guide the TARE procedure and, second, to identify any extrahepatic vessels that may lead to off-target Y 90 deposition and irradiation. These extrahepatic vessels can be embolized [77]. The lung is of particular concern due to the nature of vascular return from the liver going directly into the right side of the heart, followed by the vascular bed of the lungs. If a significant portion of the radioisotopes are depositing in the lung, the lung may undergo fibrosis. The last benefit of planning arteriography is that it enables careful modulation of treatment dosage to personalize for a specific patient. This is not possible for non-radioembolization [78].
Outcomes in Transarterial Radioembolization
In addition to the use of catheter-directed therapies for palliation, data supports the use of TARE for downstaging otherwise unresectable iCCA for later resection. One study followed 45 patients whose iCCA was judged to be unresectable, and each patient was treated with both chemotherapy (gemcitabine and/or platinum salts) and radioembolization [79]. Every two months, the patients were re-evaluated for tumor response and potential for resection, including any possible complete removal of the tumor, regardless of technique or margin width. Of the 45 patients, many were ruled out of resection for extrahepatic disease, multiple lesions, tumor recurrence, or cirrhotic disease precluding resection, but eight patients ultimately underwent surgical resection with curative intent. Two patients did not survive to discharge due to Clavien-Dindo complications of grade three or greater. Another patient died 6.5 months following surgery without evidence of disease recurrence. The remaining five patients were alive at time of publication, with two of those five experiencing recurrence. Median disease-free survival was 19.1 months, compared to survival in patients with unresectable disease of less than a year, depending on supportive care [80]. While the number of patients for which this treatment course was appropriate was low, with only 8 of the 45 unresectable iCCAs utilizing TARE for downstaging, TARE effectively extended survival and provided disease-free survival. One systematic review of TARE outcomes reviewed 12 studies using Y 90 -based treatments, included 298 patients [81]. Of these, 7 patients from 3 separate studies were successfully downstaged to surgery, supporting the role of TARE in downstaging, albeit for a small minority of patients. A more recent study that examined the response rate of patients with iCCA to TARE alongside systemic chemotherapy showed that 22% of patients were successfully downstaged to surgical resection, with 8 of those 9 patients achieving R0 margins from resection [82]. This study also found that the majority of patients successfully downstaged had tumor limited only 1 hemiliver.
The primary use of TARE in CCA is for palliation. One important study compared TACE and TARE treatments to uncover differences in survival and side effect profiles between these approaches, with the caveat that treatment selection between these two treatments is dependent on numerous factors, such as liver function, stage of disease, previous treatments, and comorbidities [64]. 31 studies were included in their meta-analysis, with 906 patients in their TACE group and 789 patients in the TARE group. Median survival across these groups were not significantly different (14.2 months vs. 13.5 months). These studies reflect the majority of the clinical utilization of TARE, as a palliative method to control local disease and prolong survival.
Safety of Transarterial Radioembolization
The purpose of TARE is to provide higher, more targeted doses of radiation to the tumor than possible with external beam radiation. However, these doses are sufficient to cause significant damage to non-tumor tissues. Clinical toxicities associated with TARE include abdominal pain, nausea, vomiting, anorexia, albumin toxicity, and bilirubin toxicity [83]. Radiologic findings following TARE include ascites, pleural effusion, and pulmonary embolus [84]. Comparisons of rates of adverse events between TACE and TARE therapies for iCCA show lower rates of clinical adverse events in TARE treatments (43%) than TACE (58.5%), particularly in PES syndrome [64]. These findings support the superiority of TARE in patients who cannot tolerate or are less likely to tolerate TACE.
Percutaneous Ablation
In addition to embolization, multiple techniques have been used to ablate iCCA tumors. Like embolization, these techniques are generally limited to unresectable iCCA due to their inferiority to surgical resection and lack of efficacy in extra-hepatic disease [85]. Originally used primarily for palliation, multiple studies have shown the benefits of ablation in slowing tumor progression and improving survival.
The most commonly performed method of ablative therapy for iCCA is radiofrequency ablation (RFA), which uses alternating electrical current at a high frequency to heat tissue via rapid electron vibration. This heat directly causes cell death, leading to anti-tumor efficacy. The objective in RFA is to heat tissues to a50-100 • C for 4-6 min without the vaporization or charring that can occur at higher temperatures [86]. Efficacy of RFA is determined by whether this delivery of thermal energy sufficiently ablates the tumor.
Microwave ablation (MWA) is a technique similar to RFA that also utilizes thermoablative methods to damage tumor tissue. MWA uses an oscillating microwave field to induce cell death, with the advantage of a reduced heat sink effect in comparison to RFA. The heat sink effect occurs when adjacent vascular structures dampen the ablative effect of thermal energy by reducing the thermal differential between the target tissue and the rest of the body, in this case conducting thermal energy away from the target site.
Cryoablation works on a similar, inverse principle of cell death due to decreasing heat in the tumor, leading to cell membrane and organelle damage [87]. Ice crystal formation in the target site leads to osmotic pressure changes and dehydration [88]. There is very limited data, with no studies focusing on cryoablation for CCA, like there have been for HCC, for which cryoablation is a validated treatment method.
Outcomes in Percutaneous Ablation
There have been multiple reviews on the efficacy of thermo-ablative techniques in the context of iCCA [85,89]. These studies have found that the RFA is significantly more commonly performed, with 83.7% of patients undergoing RFA vs. the remaining 16.3% undergoing MWA. Most of these procedures were performed percutaneously, with a small minority (only 4 patients) undergoing open RFA. In the available studies, they found overall survival ranging widely, from 8.7 months to 52.4 months, indicating significant disparity between centers, and survival measures varied in method between studies. The 5-year median survival ranged from 15-83.3%, which represents an improvement over surgical resection. Pooled analysis of 5-year survival was lower, at 16%. This suggests that for patients for which ablation is possible, ablation may be an acceptable primary treatment option, though this study is not appropriate for independently making a broad recommendation overturning surgical resection as the gold standard of iCCA treatment.
Outside of survival measures, percutaneous ablation performs quite well. It has a lower risk of complications and does not independently require inpatient admission, compared to resection. Overall, it reduces hospital admission [90]. However, there are multiple complications reported: hemorrhage, infection, tumor seeding, thermal injury, and incomplete tumor ablation can occur following RFA [91]. Despite the documented advantages of MWA in that it is less susceptible to the heat sink effect and has faster heat generation, there is no evidence that MWA has a lower rate of complications [92]. This represents a potential for further studies to investigate, though running trials directly comparing these relatively rare treatments may make recruitment difficult.
Other Therapies
Histotripsy is another locoregional therapy that utilizes ultrasound as an ablative tool, in contrast to thermoablative methods. It is noninvasive and nonionizing and has been performed in treating multiple liver tumors. Recently, studies have begun to investigate the feasibility of histotripsy to target CCA [93]. In addition to the improvements in complications brought on by the non-invasive nature of histotripsy, there is evidence to suggest that it can be applied to eCCA because it is not limited by the same vascular access as iCCA. Nonetheless, current published studies on histotripsy for CCA are on in vivo mouse models and ex vivo liver tumor specimens, highlighting the gap between current practice and implementation for human treatment.
In addition, several more technologies have been explored for CCA. Proton beam therapy has been used to irradiate tumors, data showing patients being treated with the goals of both cure and improved survival [94,95]. Irreversible electroporation is an ablative technique that uses electrical voltage instead of thermal energy. Data is limited on irreversible electroporation, with some evidence of reducing disease burden [96].
Discussion
Locoregional therapies, in the context of CCA, provide three primary roles: (1) downstaging to surgery, (2) palliation (by achieving local control), and (3) cure. In each of these roles, the first-line treatment for CCA is surgical resection of the tumor, but numerous anatomical and clinical parameters make this impossible in a large number of patients, leading to use of locoregional therapy with these goals. Of these three roles, cure is rare and is generally not the goal of locoregional therapies. Downstaging is most apparent in the case of TARE and TACE, with limited information on its role in ablation-based methods.
TACE, TARE, and ablation are the most commonly performed locoregional therapies for treatment of CCA. As all are locoregional therapies directed at the liver, they have limited use for extrahepatic disease and there is limited data on eCCA, though all three have been studied extensively in iCCA. TACE is the most common, with significant data showing improvements in survival for patients, but TARE is shown to have improvements in side effects, with comparable improvements in survival. However, ablation has the strongest evidence to suggest a role beyond palliation, with effective downstaging bridging patients to surgical resection, the treatment with the best efficacy for cure. Other treatments are being developed, largely based on similar treatments for other liver malignancies, primarily HCC, but the data is extremely limited. One of the most significant obstacles in the development of locoregional treatments for CCA is the relative rarity of CCA combined with the superiority of surgical resection for all appropriate patients, which complicates patient recruitment and limits the power of potential studies.
Conclusions
CCA is a deadly disease with a poor prognosis, due mainly to the lack of curative treatments outside surgical resection. The advent of locoregional therapies allow superior palliative care than previous systemic therapies with improvements in both survival and side effect profile. New data is beginning to show roles for locoregional therapies outside mere palliation. The opportunity for downstaging to surgical resection further broadens the opportunities to utilize locoregional therapies. Further exploration into these therapies is still necessary, particularly in the realm of extrahepatic CCA, but the data suggests that locoregional therapies will continue to play an important role in the treatment of CCA for the foreseeable future.
Conflicts of Interest:
The authors declare no conflict of interest.
|
v2
|
2022-11-29T14:39:53.974Z
|
2022-11-29T00:00:00.000Z
|
254046392
|
s2orc/train
|
Case report: Plasmablastic neoplasm with multinucleated giant cells—Analysis of stemness of the neoplastic multinucleated giant cells
Cancer stem cells have the capability of self-renewal and multipotency and are, therefore, associated with tumor heterogeneity, resistance to chemoradiation therapy, and metastasis. The hypothesis that multinucleated giant cells, which often emerge following chemo- and/or radiotherapy, serve as cancer stem cells has not been fully evaluated. Although a previous study demonstrated that these cells functioned as stem cells, only low levels of Yamanaka factors were expressed, contrasting with the high expression seen from their gestated first-generation mononuclear cells. Herein, we report a case of a plasmablastic neoplasm with multinucleated giant cells that were analyzed for stemness to test the above hypothesis. The patient was a male in his 80s who had a plasmablastic neoplasm that was not easily distinguishable as plasmablastic lymphoma versus plasma cell myeloma of plasmablastic type. Lymph node biopsy showed predominant mononuclear cell proliferation with admixed multinucleated giant cells. Immunohistochemistry and in situ hybridization showed that both multinucleated and mononuclear cells had the same profile: CD138(+), light chain restriction of κ>λ, cyclin D1(+), CD68(-), EBER-ISH (+). These results suggested that both cell types were neoplastic. In accordance with the previous study, the multinucleated giant cells showed low expression of Yamanaka factors, which were highly expressed in some of the mononuclear cells. Furthermore, the multinucleated giant cells showed a much lower proliferative activity (Mib1/Ki67 index) than the mononuclear cells. Based on these results, the multinucleated giant cells were compatible with cancer stem cells. This case is expected to expand the knowledge base regarding biology of cancer stem cells.
Introduction
Plasmablastic lymphoma (PBL) is an aggressive B-cell lymphoma with plasmablastic features that occurs in immunodeficient patients and is usually associated with Epstein-Barr virus (EBV) infection. It was first reported as lymphoma of the oral cavity in a human immunodeficiency virus (HIV)-infected patient (1). However, many cases have since then been reported that involve different localizations while also occurring in patients who are HIV-negative (2).
Plasma cell myeloma (PCM) is a plasma cell neoplasm that commonly produces monoclonal immunoglobulin (M-protein). Some cases of extraosseous PCM showing severe atypia are classified as plasmablastic PCM (PPCM). It is often difficult to differentiate between PBL and PPCM (Supplemental Table 1) (3); thus, in such cases, a diagnosis of plasmablastic neoplasm (PBN) is made (4). There have been several reports of cases of PBL or PBN containing neoplastic multinucleated giant cells (5)(6)(7).
Recent in vitro and in vivo studies mainly conducted in cases of ovarian cancer have proposed the hypothesis that multinucleated giant cells serve as cancer stem cells and are associated with resistance to chemotherapy and the potential for metastasis (8,9). To the best of our knowledge, this hypothesis has not been tested using surgical pathological analysis.
Herein, we present a case of PBN predominantly consisting of mononuclear cells with admixed multinucleated giant cells that were analyzed for stemness to test the above hypothesis.
Case description
A man in his 80s presented to our hospital with a chief complaint of a cervical mass. He had a history of angina and idiopathic interstitial pneumonia but had no overt immune deficiency. Physical examination showed enlarged lymph nodes on the right side of the neck. Computed tomography revealed enlarged cervical lymph nodes and involvement of the mandible and Th1 vertebral body (Supplemental Figure 1). Blood analysis showed increased serum immunoglobulin G ( I g G) l e v e ls ( Su p pl e m e n t a l T ab le 2) , a n d s e r um immunofixation electrophoresis detected IgG-k type Mprotein (Supplemental Figure 2) which demonstrates the results of serum immunofixation electrophoresis). A fineneedle aspiration biopsy of a cervical lymph node was performed, and the cytological findings suggested plasma cell neoplasm ( Figure 1). Excisional lymph node biopsy was also performed, and the chromosome analysis revealed a deletion in chromosome 1 and two marker chromosomes (Supplemental Table 2), while chromosome 8 was not involved. The final pathological diagnosis was PBN, as described below. The tumor was chemotherapy-resistant, and the patient died 4 months after diagnosis.
Cytological and histological analysis
For cytological analysis, the cervical lymph node specimen obtained using fine needle aspiration was sprayed on glass slides, and the excisional biopsy specimen was sliced and placed on glass slides. These glass slides were quickly fixed with ethanol for Papanicolaou staining or air-dried and fixed with methanol for Giemsa staining. For histological analysis, tissues were processed following standard procedures. Formalin-fixed paraffinembedded blocks were cut into 4-mm-thick sections and stained with hematoxylin and eosin.
The analysis showed diffusely proliferating mononuclear cells admixed with multinucleated giant cells. Because of the marked tumor invasion, the original architecture of the lymph node was almost lost. The mononuclear cells had eccentric round nuclei and a basophilic cytoplasm, exhibiting features of plasmablastic or plasma cells. The nuclei had prominent nucleoli and manifested anisokaryosis and irregular chromatin distribution. The multinucleated giant cells had dozens of nuclei, mimicking osteoclasts ( Figure 1).
The results are shown in Table 1. First, we assessed the line of differentiation (Table 1A). Both the mononuclear and multinucleated cells were positive for CD138 ( Figure 2A) and revealed light chain restriction of k>l ( Figure 2B), suggesting monoclonal plasma cell proliferation. Furthermore, both cell types were positive for cyclin D1 ( Figure 2C) and EBER-ISH ( Figure 2D). However, both cell types were negative for CD68, a marker for histiocytes ( Figure 2E). These results suggested that not only the mononuclear cells but also the multinucleated giant cells were neoplastic. The multinucleated giant cells were not considered osteoclasts because they expressed features of plasma cell neoplasms while lacking histiocytic features. The neoplastic cells were positive for EBER-ISH, suggesting PBL, but were also positive for cyclin D1, which suggested PPCM. In addition, they did not express EBNA2, a finding that did not support immune suppression and PBL. Due to this inconsistency, we could not differentiate between PBL and PPCM.
Next, we evaluated the stemness of the mononuclear and multinucleated cells (Table 1B). Some of the mononuclear cells exhibited strong cytoplasmic immunopositivity to OCT4, which was not the case with any of the multinucleated cells ( Figure 2F). As for c-Myc, the mononuclear cells showed stronger nuclear immunopositivity than the multinucleated cells ( Figures 2G, H). Among the multinucleated cells, those with a larger number of nuclei ( Figure 2G) showed weaker positivity than those with a smaller number of nuclei ( Figure 2H). As for KLF4, some of the mononuclear cells showed nuclear positivity, while multinucleated cells were consistently negative ( Figure 2I). Both mononuclear and multinucleated cells were strongly positive for CD44 ( Figure 2J) and negative for SOX2. Furthermore, the mononuclear cells had a high Mib1/Ki67 i n d e x , w h i l e m u l t i n u c l e a t e d c e l l s w e r e s c a r c e l y positive ( Figure 2K).
We have summarized these results in Figure 3 and compared them to the results of previous studies (8,10). This comparison is explained in detail in the discussion.
Fluorescent in situ hybridization
Unstained sections (thickness, 4 µm) were "pretreated" using a Histology Fluorescent in situ hybridization (FISH) kit (GSP Laboratory, Kobe, Japan). Next, they were subjected to hybridization with BAC clone-derived probes for CCND1 and IGH, with a CKS1b dual-color probe set (Agilent) or with a c-Myc dual-color probe set (Abbott). The names of BAC clones used will be provided upon request. Hybridized slides were then stained with DAPI (4,6-diamidino-2-phenylindole, dihydrochloride) and examined using a fluorescence microscope BX51 (Olympus, Tokyo, Japan).
Split of CCND1 and/or IGH is a genetic marker for PPCM. However, neither was detected using FISH. Split of c-Myc is a genetic marker for PBL. However, it was not detected either. Moreover, amplification of CKS1b, a poor prognostic factor for PPCM (11), was also not detected.
Discussion
In the present case, the patient was diagnosed with PBN, comprising predominantly proliferating mononuclear cells with admixed multinucleated giant cells, both of which were confirmed to be neoplastic. The analysis of stemness indicated that the multinucleated giant cells were compatible with cancer stem cells.
Diagnosis, in this case, was challenging owing to the difficulty in differentiating between PBL and PPCM. The EBER-ISH positivity suggested PBL; however, there were no indicators of immune suppression as the patient had no history of HIV infection or organ transplantation, and the tumor cells were negative for EBNA2, an indicator of immune suppression (12). Without immune suppression, a diagnosis of PBL was not strongly suggested. Furthermore, approximately 50% of PBLs harbor a rearrangement of c-Myc on chromosome 8 (13-15), while, in this case, there was no abnormality in chromosome 8. In addition, the expression of cyclin D1 suggested PPCM, but the cytogenetic analyses did not detect translocation or amplification of CCND1. Hence, the final pathological diagnosis was PBN. Adult stem cells are associated with the capacity for selfrenewal and multipotency. In neoplasms, putative cancer stem cells play these roles. Following chemo-and/or radiotherapy, multinucleated giant cells often emerge as cancer stem cells and are associated with tumor heterogeneity, therapy resistance, and metastasis (8,9). Nonetheless, the hypothesis that neoplastic multinucleated giant cells serve as cancer stem cells has not been fully evaluated. We tested this hypothesis using the Yamanaka factors and Mib1/Ki67. First, we evaluated the Yamanaka factors (OCT4, SOX2, KLF4, and c-Myc), which are implicated in cancer cell stemness (16,17). The tumor consisted of mononuclear and multinucleated giant cells, and we assessed the stemness of both cell lineages. In a previous study on post-chemotherapy ovarian cancer, neoplastic multinucleated giant cells, designated as P1 cells, generated and gestated mononuclear daughter cells, designated as Gn cells (G1 cells were the first generation of Gn cells), and these cells were involved in drug resistance (8). Although P1 cells had stem cell functions, stem FIGURE 3 Comparison of our case with previous studies. cell markers such as CD44 and Yamanaka factors were more strongly expressed in G1 than in P1 cells in that study. This unexpected phenomenon has not yet been fully explained. In concordance with the previous study (8), in our case, the stem cell markers OCT4, c-Myc, and KLF4 were more strongly expressed in the mononuclear than in the multinucleated giant cells. Moreover, SOX2 was negative in both cell types. Next, we evaluated the proliferative activity. Stem cells generally grow slowly and have low proliferating activity (10). We used the Mib1/Ki67 index as an indicator of proliferative activity. In our case, mononuclear and multinucleated giant cells had a very high and very low Mib1/Ki67 index, respectively, which was interpreted as supportive evidence for the stemness of the multinucleated giant cells. Based on these results, we concluded that the multinucleated giant cells (P1 cells) were cancer stem cells.
Previous studies on neoplastic multinucleated giant cells have been conducted primarily after chemo-or radiation therapy. According to the study on ovarian cancer, multinucleated giant cells were rarely seen in untreated patients and markedly increased after chemotherapy (8).
In our case, there were several multinucleated giant cells even before chemotherapy, suggesting that the phenomenon of maternal multinucleated giant cells gestating mononuclear cells is not limited to the post-chemotherapy period. Moreover, we used formalin-fixed paraffin-embedded specimens for the analysis, ensuring high accessibility. The same analyses can be conducted on multiple cases at a low cost.
Considering the persisting scarcity of knowledge on cancer stem cells, we believe that the present case will add insight to the biology of cancer stem cells.
Data availability statement
The original contributions presented in the study are included in the article/Supplementary Material. Further inquiries can be directed to the corresponding author.
Ethics statement
The studies involving human participants were reviewed and approved by The Ethics Committee of Toho University. The patients/participants provided their written informed consent to participate in this study. Written informed consent was obtained from the individual(s) for the publication of any potentially identifiable images or data included in this article.
Author contributions
NO-K and YS contributed to conception and design of the study. NO-K and TY conducted the immunohistochemical and molecular biological experiments. NO-K and YS were involved in the data analyses. NO-K wrote the first draft of the manuscript. YS wrote sections of the manuscript. NS and NH reviewed the manuscript. All authors contributed to manuscript revision, read, and approved the submitted version.
|
v2
|
2022-11-29T14:41:50.939Z
|
2022-11-29T00:00:00.000Z
|
254046332
|
s2orc/train
|
In-depth analysis of the expression and functions of signal transducers and activators of transcription in human ovarian cancer
Background Signal transducers and activators of transcription (STAT) transcription factors, a family of genes encoding transcription factors, have been linked to the development of numerous types of tumors. However, there is a relative paucity of a comprehensive investigation of the expression and functional analysis of STATs in ovarian cancer (OV). Method Gene expression profile interaction analysis (GEPI2A), Metascape, The Cancer Genome Atlas (TCGA), Kaplan-Meier Plotter, Linkedomics, and CancerSEA databases were used for expression analysis and functional enrichment of STATs in ovarian cancer patients. We screened potential predictive genes and evaluated their prognostic value by constructing the minor absolute shrinkage and selection operator (LASSO) Cox proportional risk regression model. We explored STAT5A expression and its effects on cell invasion using ovarian cancer cells and a tissue microarray. Results The expression level of STAT1 was higher, but that of STAT2-6 was lower in cancerous ovarian tissues compared to normal tissues, which were closely associated with the clinicopathological features. Low STAT1, high STAT4, and 6 mRNA levels indicated high overall survival. STAT1, 3, 4, and 5A were collectively constructed as prognostic risk models. STAT3, and 5A, up-regulating in the high-risk group, were regarded as risk genes. In subsequent validation, OV patients with a low level of P-STAT5A but not low STAT5A had a longer survival time (P=0.0042). Besides, a negative correlation was found between the expression of STAT5A and invasion of ovarian cancer cells (R= -0.38, p < 0.01), as well as DNA repair function (R= -0.36, p < 0.01). Furthermore, transient overexpression of STAT5A inhibited wound healing (21.8%, P<0.0001) and cell migration to the lower chamber of the Transwell system (29.3%, P<0.0001), which may be achieved by regulating the expression of MMP2. Conclusion It is suggested that STAT1, STAT4, and STAT6 may be potential targets for the proper treatment of ovarian cancer. STAT5A and P-STAT5A, biomarkers identified in ovarian cancer, may offer new perspectives for predicting prognosis and assessing therapeutic effects.
Introduction
Among gynecological tumors, ovarian cancer is the leading cause of death. About 19,880 new cases of ovarian cancer will be diagnosed in the United States in 2022, the equivalent of about 54 new cases each day, and 12,810 deaths from ovarian cancer are projected to occur, approximately 35 deaths per day (1). Because ovarian cancer can be divided into at least five histological subtypes, accompanied by unique risk factors, origin cells, and genomic characteristics, it cannot be detected early in population-based screening and is usually diagnosed late (2). Upfront treatment mainly depends on cytoreductive surgery without residual disease and platinum-based chemotherapy, and anti-angiogenic agents are added in patients with stage IV and recurrence (3). However, recurrent cancer is often resistant to platinum chemotherapy, which leads to a lack of effective treatment. Fortunately, adding poly (ADP-ribose) polymerase (PARP) molecular inhibitors to recurrent patients with BRCA1/ BRCA2 mutations has made significant progress in maintenance therapy (4). The combined treatment of multiple methods can slowly increase the 5-year survival rate of ovarian cancer, but the prognosis is still not significantly improved.
STAT transcription factors (STATs) were discovered in 1994 (5). Seven STATs family members are found in mammals with similar structural and functional characteristics, all encoded by their genes: STAT1 (chromosome position: 2q32.2), STAT2 (12q13.3), STAT3 (17q21.2), STAT4 (2q32.2), STAT5A (17q21.2), STAT5B (17q21.2) and STAT6 (12q13.3) (6). Each of them played unique roles in signal transduction. The Janus kinase (JAK) and STAT pathways are involved in the biological effects of more than 50 cytokines and growth factors (7). Activated JAK phosphorylates the conserved c-terminal tyrosine residue in STATs, facilitating them to form dimerization, which leads to the activation of STATs and then translocation into the nucleus through Ran-GTP-dependent mechanisms. Subsequently, STATs bind to specific target DNA promoter sequences to control corresponding gene transcription (5). In this way, the translocation of STATs from the cytoplasm to the nucleus realizes the transmission of extracellular signals. It then affects the expression of target genes to regulate cell proliferation, differentiation, apoptosis, and angiogenesis (8).
The activation of STATs in normal signal transduction is rapid and transient, and the sustained activation of STATs is closely related to the process of malignant transformation. Tumors of various types exhibit abnormal activation of STAT family members, including ovarian cancer (9), breast cancer (10), prostate cancer, and (11) hematological and head and neck cancer (12), of which have been confirmed to be involved in angiogenesis, invasion, and metastasis of tumor cells, as well as their escape from the immune system. STAT1 played a dual role in ovarian cancer. For instance, a positive effect of STAT1 in ovarian cancer was that it upregulated the expression of inducible nitric oxide synthase (iNOS) (13), resulting in the release of cytotoxic nitric oxide (NO) (14) and accelerating the progression of the disease (15); however, NO could also promote ovarian cell apoptosis by increasing the expression of p53 (16). The contradictory role of STAT1 in promoting and inhibiting cancer also existed in invasion and metastasis (17, 18), angiogenesis (19), immunologic responsiveness (20), and chemotherapeutic drug reactivity of ovarian cancer (21).
The Fibrillin-1/VEGFR2/STAT2 signal axis modulated the process of glycolysis and angiogenesis by activating STAT2, which induced cisplatin resistance in ovarian cancer cells (22). Activated STAT3 facilitated migration and invasion of ovarian cancer by inducing the expression of MMP2 and MMP9 (23, 24), and assisting in the epithelial-to-mesenchymal transition (EMT) process of ovarian cancer (25). STAT3 regulated the expression of HIF-1a (26), contributing to ovarian cancer angiogenesis. In addition, ovarian cancer cells expressing STAT3 showed increased resistance to chemotherapy (27) and with cancer stem cells (CSCs) or CSC-like phenotypes (28). Likewise, STAT4 could induce activation of tumor-associated fibroblasts (CAF) through tumorderived Wnt7a, which promoted peritoneal metastasis of ovarian cancer through the EMT process (29). Overexpression of human epidermal growth factor receptor 4 (HER4) in ovarian CSCs mediated STAT5 activation to enhance the survival and growth of ovarian CSCs (30). Upon oncoproteomic analysis, STAT5B was overexpressed in ovarian cancer that recurred after chemotherapy. Further research confirmed that STAT5B and RELA (NF-kappaB p65) were responsible for carboplatin resistance in ovarian carcinoma (31). Moreover, the decreased STAT5B led to CD8 + effector memory T (T EM ) cell dysfunction in ascites of high-grade serous ovarian cancer patients, thus causing shortened relapse-free survival (RFS) (32). Collagen triple helix repeat containing 1 (CTHRC1), secreted by epithelial ovarian Cancer (EOC) cells, promoted M2-like polarization of tumor-associated macrophages (TAMs) by activating STAT6. As a result, this facilitated EOC cell invasion and migration (33). Additionally, STAT6 was also involved in the stemness maintenance and function of ovarian CSCs (34).
Although there are partial reports on the role of individual STAT in the development and progression of ovarian cancer, the role of the entire STATs family in ovarian cancer has not been explored through bioinformatics. Here, a detailed analysis of STAT transcription factor expression in ovarian cancer was performed, and potential biomarkers were identified. We sought to ascertain the pattern of expression, potential biological function, and unique prognostic significance of STATs in ovarian cancer (Scheme 1).
Results
The main functions of the STAT family At present, researchers have identified seven STAT transcription factors in mammalian cells. A comparison was made between STAT transcription in cancers and normal tissues based on the gene expression profiling interactive analysis (GEPIA2) database (http://gepia2.cancer-pku.cn/#analysis). Selecting "TCGA normal+ GTEx normal" as the matched normal tissue data, Figure 1 shows the expression of STAT family members in 31 different tumors (T) and paired normal tissue (N), plotted using log2(TPM + 1) transformed expression data. Subsequently, the Metascape database was used for enrichment analysis of significant functions of 7 STAT family genes including STAT1, STAT2, STAT3, STAT4, STAT5A, STAT5B, and STAT6 (http://metascape.org/gp/index.html#/ main/step1). Enrichment standards were as follows: an enrichment factor of >1.5, a minimum count of 3, and a pvalue of 0.01. We found that the STAT transcription factors family played crucial roles in biological processes such as signaling, response to stimulus, immune system process, growth, developmental process, regulation of biological processes, positive regulation of biological processes, and cellular processes (Figure 2A). Moreover, Figure 2B and Supplementary Material Table 1 showed the top-level significantly enriched signal pathways, including receptor signaling pathway via JAK-STAT, Interleukin-20 family, Interleukin-21 signaling, Thymic stromal lymphopoietin (TSLP) signaling pathway growth hormone receptor signaling pathway via JAK-STAT, inflammatory bowel disease signaling, and IL-10 anti-inflammatory signaling pathway. The aboveenriched signal pathways were shown in the form of a network in Figure 2C to understand the relationship between these GO terms. Edges were formed between terms with a similarity > 0.3. Each node represents an enriched term and is colored by its cluster ID, where nodes sharing the same cluster-ID are usually close to each other. For clarity, only one term tag was displayed per cluster in the lower right corner, and all node tags can be checked by visualizing the network using Cytoscape or a browser. Therefore, the ligand-dependent activated STAT transcription factors family acted as a signaling hub via modulating downstream target genes' expression and participating in the tumor occurrence and development.
STAT transcription in ovarian cancer patients
Our analysis included 374 OV patients and 32 normal tissues filtered from the available data; an overview of their baseline data is provided in Supplementary Material Table 2. First, we assessed the expression of the STAT transcription factor by comparing ovarian cancer with normal ovarian tissues. According to research, ovarian cancer tissues exhibited higher STAT1 but lowered STAT2-6 expression than normal tissues ( Figure 3A). Moreover, there was a positive correlation between the gene expression of different STAT family members in OV ( Figure S1). Using the GEPIA2 database (http://gepia2.cancer-pku.cn/#analysis), an analysis was also performed of the association between the expression of STATs in ovarian cancer and major tumor stages. The results indicated that, in contrast to STAT6, the expression of other STATs family members varied significantly ( Figure 3B). Based on the above results, STAT members exhibited different expression patterns in ovarian cancer and seemed involved in various phases of ovarian development.
Expression distribution trend of STATs for different clinical characteristics of ovarian cancer patients
To further study the relationship between STAT family and tumor stage and grade, a Sankey diagram was drawn (Figure 4), which showed the distribution trend between different clinical characteristics, including age, tumor stage, grade, and the expression of STAT gene family member, and the survival status of ovarian cancer patients. There were five columns representing age, pTNM_stage, Grade, STAT1-6 expression, and survival Status in each figure, respectively. Different colors represented different ages (<= 60 years and > 60 years), pTNM_stages (I, II, III, IV), Grades (G1, G2, G3), expression levels of STAT1-6 (High exp, Low exp), Status (Alive, Dead). The above variables are connected by connecting lines to obtain the distribution of the same ovarian cancer sample across various characteristics. Through the plotting of these diagrams, we can see that patients with advanced (III, IV) ovarian cancer were more likely to have low expression of STAT family members. Differentially, in high-grade (G3, G4) ovarian cancer, STAT1, 2, 4, and 5A were highly expressed, while STAT3 and STAT5B were mostly lowly expressed. In addition, the low expression group of other STAT members except STAT5B had more deaths. This reflected the complexity of the role of different STAT members in the occurrence and development of ovarian cancer.
Association of the expression of STATs with the prognosis of ovarian cancer patients
Next, an assessment was made of the influence of STATs on ovarian cancer survival. According to openly accessible data (2021 version: http://kmplot.com/analysis/index. Php? p=service&cancer=ovar), using Kaplan-Meier Plotting tools, we investigated whether mRNA levels of STATs correlated with the survival time of ovarian cancer patients by "mean expression of selected genes" in multiple genes option. The desired Affy ID is valid: Besides, the effect of each STAT member on the survival time of ovarian cancer patients was also analyzed using the same Probe Id as above (Table 1). Based on Kaplan-Meier curves and log-rank tests, the results in Figure 5 showed that a significant correlation was observed between increased STAT4 and 6 mRNA levels, decreased STAT1 mRNA levels, and overall survival (OS) in ovarian cancer patients. (P < 0.05). Ovarian cancer patients with a high level of STAT4 and 6 gene expression or a low level of STAT1 gene expression had high OS.
Moreover, in ovarian cancer patients with different pathological types, STAT expression was tested for potential correlation with OS, progression-free survival (PFS) as well as post-progression survival (PPS), respectively (Supplementary Material Tables 3-5 ). Patients with serous ovarian cancer expressed lower levels of STAT1 mRNA, while higher levels of STAT 2, 5A, and 5B mRNA had longer PFS but had no effect on patients with endometrioid carcinoma. Based on these above results, most members of the STAT family, except STAT3, may be promising prognostic indicators for ovarian cancer.
Developing and evaluating a STATs prognosis prediction model
Four STAT members with potential prognostic significance were identified by LASSO (lambda.min=0.0234). A stepwise multivariate Cox regression model was constructed using Relationship between STAT family and clinical characteristics of ovarian cancer patients. Rows represent feature variables, different color represents different age (<=60 years, >60 years) or pTNM_stage (I, II, III, IV) or Grade (G1, G2, G3) or expression level (High exp, Low exp) or survival status (Alive, Dead). Lines show how the same sample is distributed across different feature variables. STAT1, STAT3, STAT4, and STAT5A as filter variables ( Figures 6A, B). The Risk score was calculated as follows: Smooth curve fitting provided the following results, which showed the Risk score from low (blue spot) to high (blue spot), thus based on the Risk score median, a cut-off value was determined (high risk: score > -0.257, low risk: score < -0.257) ( Figure 6C). As shown in scatter plots and also Kaplan-Meier plots Figures 6D, F), patients with a high-Risk score had a short median survival time (median time=3.2 vs. 4.3 years, hazard ratio [HR] =1.914, P = 1.66e-06). The heatmap was the gene expression of STAT1, 3, 4, and 5A from the signature. In the high-risk group, the protective STAT1 and STAT4 genes were low expressed, whereas STAT3 and 5A, the risk genes, were significantly higher expressed ( Figure 6E). In terms of timedependent ROC curves, 1-, 2-, and 5-years of survival were assessed using Area Under Curve (AUC) values of 0.659, 0.645, and 0.627, respectively ( Figure 6G). A prognostic model based on disease-specific survival (DSS) was also constructed through STAT1, 4, 5A. Compared to the low-risk group with STAT1,4, the high-risk group with STAT5A was closely linked with a worse 1-, 2-, 5-years DSS of ovarian cancer patients (median time=3.4 vs. 4.7 years, HR =1.831, P = 3.31e-05 in Figure S2). Finally, as revealed by univariate analysis, Age, Race, and STAT 1, 4, and 5A were significantly related to OS based on the TCGA cohort ( Figure S3A). Using the factors aforementioned above, we performed a multivariate Cox regression analysis. As a result, STAT5A was still an independent predictor of outcome for this cohort of patients (hazard ratio [HR] = 1.3, P < 0.001), which was consistent with LASSO analysis ( Figure S3B). Additionally, Figures 3C, D displayed the cohort's 1-, 2-, and 5-years OS Nomograms. As STAT5A was the gene with the highest risk score in the OV prognostic model, it had become the focus of follow-up research.
STAT5A gene mutation analysis in ovarian cancer
STAT5A was altered (73%) in 272 samples from 374 patients with ovarian serous cystadenocarcinoma. The somatic mutation rate of STAT5A was only 0.37%, which was manifested as a gene missense mutation, leading to abnormal amino acid coding in the SH2 domain ( Figure 7A). The panoramic waterfall mutation type diagram shows that each sample's mutation load was different, and the median value was 82. TP53 had the highest mutation rate (90%), and the top ten mutated genes included TTN (37%), MUC16(12%), CSMD (13%), FAT3 (10%), FLG (10%), RYR2 (10%), PRUNE2 (10%). FLG2 (9%) and APOB (8%). However, STAT5A mutation only occurred in the group with high STAT5A expression, so there should be no mutation in ovarian cancer with relatively low STAT5A expression (Figures 3, 7B S4B). A missense mutation was the main classification of gene mutation in each sample. Single nucleotide polymorphisms (SNPs) were the most common mutation type. Cytosine (C > T, C > A, C > G) and thymine (T > A, T > C, T > G) are the main types of single nucleotide mutation (SNV) mutations ( Figure S4A).
Correlation between STAT5A and the functional states of OV cells
To further study the role of STAT5A in OV, GSEA online database-Linkedomics (http://linkedomics.org) was used to explore the pathways and functions involved in STAT5A. We first analyzed the 50 most positively and negatively affecting genes related to STAT5A expression, as shown in the heat map in Figures S5A, B. Then GO and KEGG analysis of STAT5A in patients with OV was carried out in Figures S5C, D which revealed significant enrichment in mitochondrial gene expression, mitochondrial respiratory complex assembly, adaptive immune response, Oxidative phosphorylation, Chemokine signaling pathway, NF-kappa B signaling pathway, and JAK-STAT signaling pathway. From this, it can be concluded that the transcription factor STAT5A may affect the oxidative phosphorylation process of cells through the negative regulation of the mitochondrial respiratory chain complex and then interfere with the immune regulation and signal molecule transmission process of the body. Next, we conducted a more indepth analysis of the function of STAT5A in OV using the CancerSEA single cell sequencing database (http://biocc.hrbmu. edu.cn/CancerSEA). Single gene analysis of STAT5A from different cell groups, which denoted different OV patientsderived xenograft samples, was performed. There are 7 functional states including Quiescence (R=0.28), Hypoxia (R=0.28), Apoptosis (R=0.24), Angiogenesis (R=0.23), Cell Cycle (R=-0.30), DNA repair (R=-0.36) and Invasion (R=-0.38) that are significantly related to STAT5A (P < 0.05, Figure S6). Specifically, a significant inverse relationship was found between STAT5A expression and invasive behaviors and DNA damage repair (Figure 8, P < 0.01), indicating that lower STAT5A expression could promote ovarian cancer cell invasion as well as improve the ability of cells to repair DNA damage, thus participating in the process of metastasis and recurrence of ovarian cancer.
Analysis of the expression of STAT5A on OV tissues and cell lines
For further validation of the main conclusion in Figure 8, we first verified the expression of STAT5A and P-STAT5A in ovarian cancer from tissue microarray (TMA). In the detection of 45 pairs of ovarian cancer and adjacent normal tissues, the expression levels of both in cancer were significantly lower than those in para-cancerous tissues ( Figure 9A, P<0.0001). The receiver operating characteristics (ROC) curves on independent tests of STAT5A and P-STAT5A are illustrated in Figure 9B. The optimal cut-off value for STAT5A was < 0.04375 (sensitivity 73.33%, specificity 73.33%, AUC=0.744, P<0.0001), while that for P-STAT5A was < 0.0125 (sensitivity 83.37%, specificity 83.72%, AUC =0.920, P<0.0001). Kaplan-Meier survival plots revealed that OV patients with high STAT5A expression had longer survival times than those with low STAT5A levels (P =0.039). However, high expression of P-STAT5A seems to be a better prognostic indicator of ovarian Cancer (P =0.0042, Figure 9C). Consistently, the univariate and multivariate Cox regression analyses of OS in paired ovarian cancer and para-cancerous tissues showed that P-STAT5A rather than STAT5A could be an independent risk factor (P=0.032, Supplementary Material Table 6 in Supporting Information). Next, to address the role of STAT5A in OV cell invasiveness, human ovarian serous cell line HO8910 was used as the research object and normal ovarian epithelial cell IOSE80 as the control. First, we explored the baseline expression of transcription factor STAT5A, the activated form P-STAT5A and matrix metalloproteinases 2 (MMP2) and MMP12. The latter is involved in the degradation of extracellular matrix (ECM), in turn, mediates the epithelial-to-mesenchymal transition (EMT) process, which is known as one of the primary mechanisms for tumor invasion and metastasis. Compared to IOSE80 cells, the levels of STAT5A, P-STAT5A, and MMP12 proteins decreased significantly in HO8910 cells, while MMP2 levels increased ( Figure 9D). After that, STAT5A overexpression plasmids were transiently transfected into HO8910 cells. The transfection efficiency was verified by quantitative real-time PCR (qRT-PCR) ( Figure 9E, P<0.0001) and Western blotting analysis ( Figure 9F). HO8910 cells overexpressing STAT5A exhibited increased MMP12 expression, while MMP2 was significantly suppressed. Compared with the control and the negative vector transfection group, a significant reduction was observed in the migration ability of cells transfected with cDNA-STAT5A. It can be seen by the area of wound-healing (marked by the yellow line in the figures) significantly decreased from the initial scratch time (0 h) to 48 h post-scratching ( Figure 9G, P<0.0001).
Furthermore, HO8910 cells were seeded in the upper compartments of Matrigel-coated transwell chambers to assess cell invasion ability. After 48 h, the number of cells that invaded the lower chamber in the STAT5A-PcDNA transfected group was less than 30% of the control group ( Figure 9H, P<0.0001). These results suggested that low expressed STAT5A may directly or indirectly regulate the expression of MMP2 and promote the invasion and metastasis of ovarian serous cystadenocarcinoma cells.
Discussion
STAT5 consists of two isoforms, STAT5A and STAT5B, each encoded by a different gene, although they share 94% of the same structure (35). STAT5A was cloned from the lactation tissue of sheep in 1994 and was initially called mammary gland factor (MGF) (36), which could initiate milk protein expression and modulate prolactin action (37). As part of the classical JAK2-STAT5A/5B signal pathway, the activated STAT5A/5B dimer in the cytoplasm was required to travel into the nucleus. An eight to ten base pair reverse repetitive DNA sequence known as TTC (C/T) N (G/A) GAA was recognized by the nuclear STAT5A/5B (38). structurally active Mutations of STAT5 caused carcinogenesis in vitro and in vivo (39). So far, STAT5B mutations are rare and tend only to be found in human myeloid leukemia such as CD4 + T-cell prominent granular lymphocytic (T-LGL) leukemia, chronic natural killer lymphoproliferativ e disorders (CLPD-NK), Acute promyelocytic leukemia (APL) (40,41). Most mutations in STAT5B occurred in the SH2 region (42). In this study, the mutation frequency of STAT5A in ovarian cancer was found to be extremely low, mainly missense mutation in the SH2 domain (Figure 7).
In much the same way as other STAT family members, the structural activation of STAT5 contributes to tumor survival, growth, metastasis, and chemotherapy resistance. As mentioned earlier, activated STAT5B is involved in maintaining ovarian CSCs; chemotherapy resistance and tumor immune response are closely related. Nevertheless, little information was available expression in maintaining the ovary's normal structure and functional integrity (44). According to a study on non-coding RNA transcripts involved in the pathogenesis of ovarian endometriosis (OEM), it was found that STAT5A can be used as a diagnostic marker of OME, and its overexpression was associated with a positive outcome for EOC (45), which was inconsistent with our experimental results. As shown in Figure 8, STAT5A expression and ovarian cancer invasion were negatively correlated (R= -0.38). Despite STAT5A/5B being active in most leukemia and some solid tumors, the role of STAT5A/5B in tumor invasion was complicated (46). Data from murine breast cancer studies suggested that STAT5A had dual efficacy in malignant mammary epithelial cells. In the early stage of breast cancer, STAT5A/5B promoted malignant transformation of breast epithelial cells and accelerated tumor growth. In advanced breast cancer, STAT5 was a key molecule regulating and promoting the differentiation of mammary epithelial cells, which can effectively delay the invasion and metastasis of tumors (47). And in the breast cancer clinical sample activated STAT5A/5B was positively correlated with the differentiation status of breast cancer, but it can also prevent the dissemination of confirmed breast cancer, which was a sign of good outcome for breast cancer with negative lymph nodes (48). Phenotypic analysis of TRAM mouse models of prostate cancer and STAT5 knockout mice indicated that STAT5A/5B activation was essential for the growth and survival of prostate cancer. Further studies showed that CyclinD1 and Bcl-xl were the target genes of STAT5 in prostate cancer, which was a potential mechanism of STAT5 regulating prostate cancer (49). Nuclear STAT5A/5B expression predicted early disease recurrence and enhanced the ability of prostate cancer cells to metastasize in vivo and in vitro (50). Prostate cancer distant clinical metastases were overexpressed with nuclear STAT5A/5B in 61% of cases, which consequently made prostate cancer cells migrate and invade more readily with the aid of microtubule network rearrangement. Importantly, in an experimental in vivo metastasis test, activated STAT5 resulted in a ten-fold increase in lung metastasis. In addition, constitutive activation of STAT5 signaling also enhanced cell invasion, migration, and EMT of head and neck squamous cell carcinoma (51). In the subsequent verification, we also confirmed that the expression of STAT5A and P-STAT5A was significantly lower in OV tissues and cell lines, which was closely correlated to the beneficial prognosis in OV patients, especially the low level of P-STAT5A ( Figures 9A-D). Besides, STAT5A was negatively related to tumor-promoting MMP2 expression in human ovarian serous cystadenocarcinoma cell line HO8910 (Figures 9D-F). It is speculated that MMP2 may act as a direct or indirect effect molecule of transcription factor STAT5A to promote the invasion and migration of ovarian cancer, which was in line with previous studies on esophageal cancer (52). Other researchers had suggested that STAT5A activation was related to the regulation of angiogenesis in ovarian cancer, because VEGF secreted by ovarian cancer cells can activate STAT via VEGFR in the cancer cells (53). The dual role of activated STAT5A in ovarian cancer invasion demonstrated the complexity of STAT5A function. Of course, we had to admit that there are individual differences among ovarian cancer cell lines, which will be further checked in various human serous cancer cell lines (e.g., SK-OV-3, Shin-3, OVCA-3). We will expand the sample size appropriately to increase the rigor of this validation. In addition, we will construct an ovarian cancer xenograft tumor model and introduce STAT5A or JAK2 recombinant protein to verify the inhibition of MMP2 by high expression of STAT5A, thus affecting the invasion and migration ability of ovarian cancer. Furthermore, in this study single-cell sequencing data in Figure 8 also demonstrated that in ovarian cancer cells, STAT5A expression was negatively related to DNA repair (R= -0.36). STAT5A-overexpressed ovarian cancer patients can benefit from multiple types of treatment, including chemotherapy, radiotherapy, and immunotherapy because an essential limiting factor in tumor therapeutic efficacy is tumor cells' ability to repair DNA damage. In a study of radiation resistance and glutamine anabolism, STAT5 regulated the transcriptional level of glutamine synthetase (GS), then promoted nucleotide metabolism, accelerated DNA damage repair, and eventually made cancer cells more resistant to radiation. In turn, radiation-resistant cells exhibited high glutamine anabolic, including nasopharyngeal carcinoma cells (CNE2-IRR) and glioma cells (U251-IRR) (54). However, a novel class III RKT inhibitor-AIU2001 reduced DNA damage repair genes expression by downregulating STAT5 mRNA level in lung cancer cells (55). Moreover, STAT5A/5B participated in the regulation of DNA repair using homologous recombination in prostate cancer by inducing the RAD51 mRNA level while blocking of JAK2-STAT5A/5B signal pathway sensitized prostate cancer to radiotherapy (56). To sum up, the relationship between STAT5 expression and DNA damage and repair of tumor cells may vary with tumor types. An integrated prognostic model that includes STAT1, STAT3, STAT4, and STAT5A may be more accurate than one based on a single biomarker. Transcriptional factor families, such as E2F and Forkhead box O (FOXO) transcription factors, have demonstrated outstanding potential as a predictor of cancer outcomes recently. The above studies preliminarily proved that STATs expression had an essential impact on ovarian cancer progression. Mainly, STAT5A affected cell invasion and DNA damage repair, which can be an essential tool to predict ovarian cancer prognosis. However, there are limitations to the current research. Data for this study were derived from the TCGA database and single-cell sequencing, and no independent cohort studies were available. As a next step, we will collect enough clinical samples to validate the effect of STAT family expression on the clinical parameters of ovarian cancer patients.
Conclusion
Here, a comprehensive analysis of STATs expression and its prognostic value has been carried out to construct an ovarian prognosis model. These results provided a basis for realizing personalized and accurate treatment of ovarian cancer and improving predictive biomarkers. Based on our findings, STAT1, STAT4, and STAT6 may be viable therapeutic targets for ovarian cancer. Low P-STAT5A, but not STAT5A, was a favorable prognostic indicator in human OV. Since STAT5A expression was negatively correlated with ovarian cancer cell invasion and DNA repair, STAT5A/P-STAT5A activators or inducers may increase ovarian cancer survivorship and allow more of them to benefit from radiotherapy and chemotherapy, molecular targeted drug therapy, or immunotherapy.
Materials and methods
Source of the data RNA-sequencing profiles and relevant clinical data consisting of 374 OV tissues came from the TCGA dataset (https://portal.gdc.com). 180 normal control samples were accessed from Genome Type tissue expression (GTEx) datasets (V8) (https://www.gtexportal.org/home/datasets). Additionally, various clinical parameters were collected, including survival status, age, race, pTNM stage, and grade collected in Table 1. We used R software v4.0.3 (R Foundation for Statistical Computing, Vienna, Austria) for our statistical analyses. Statistical significance was deemed to be p-value <0.05.
The Sankey diagram was constructed with the R software package ggalluvial. The gene mutation data were downloaded and visualized by the map tools package in R software. Genes with higher mutational frequency detected in an ovarian cancer patient in histogram were shown.
GEPIA2 dataset
A total of 9736 tumors and 8587 normal samples based on the TCGA and GTEx projects were analyzed using the GEPIA2 analyzer. Through the multiple gene comparison columns in the expression analysis plate, the STATs expression level in various tumors was investigated. Besides, we profiled the expression of STATs in the significant stage of ovarian cancer using a box plot in the "pathological stage plot" column.
Metascape database
Metascape database is a highly effective tool for studying functional gene annotations. Genes and proteins can be analyzed in batches to understand better how genes or proteins work. First, the members of the STAT family were input into the "multiple gene list" text box, and the species "H.sapines" was selected for custom analysis. Findings from the gene ontology enrichment analysis were obtained in the analysis report.
Kaplan-Meier Plotter
Based on ovarian cancer gene chip data, Kaplan-Meier Plotter analysis was conducted to determine how STAT's gene expression affects ovarian cancer survival rates. The prognostic value (mainly OS and PFS of ovarian cancer patients) of each member of the STATs family was analyzed, respectively. According to the median values of the expression levels of the samples of the ovarian cancer patients, groups with high and low expression were created. Comparing the two cohorts yielded an HR with 95% confidence intervals (CIs) and a log-rank P-value using the Kaplan-Meier survival plot, indicated at the top right of the main graph (57).
Prognostic value assessment of STATs
The ovarian RNA sequencing data from the TCGA database were converted into transcripts per million (TPM), the data log2 (TPM+1) was normalized, and the clinical information samples were retained for follow-up analysis. An analysis of survival rates among groups by the log-rank test was conducted. The prediction accuracy and risk score of STATs gene were analyzed and compared by time ROC (v0.4).
In this study, the LASSO regression algorithm was employed as a feature selection algorithm, along with 10-fold crossvalidation, and a glmnet package in R was performed for the analysis. Multivariate cox regression analysis was used to construct a prognostic model, and first, the multi-factor Cox regression was used to analyze the data, and then the step function performed the iteration. Finally, the optimal model was selected as the final model. Kaplan-Meier curves plotting standard was the same as that described above.
The analyses and R packages were all developed with R (foundation for statistical computing 2020) version 4.0.3. Statistical significance was deemed to be P-value <0.05.
LinkedOmics database
LinkedOmics is a database based on multiple group association data analysis for TCGA. The ovarian cancer data set (TCGA-OV) was selected, and RNAseq was chosen as the data type in the searching and targeting data sets. The target gene STAT5A was input; then, the Pearson Correlation test statistical method was selected for correlation analysis. Finally, we obtained the heat map of the genes positively and negatively related to STAT5A. Moreover, the above results were analyzed by GSEA enrichment analysis in the LinkInterpreter plate based on WebGestalt. In the Enrichment Analysis column, select the KEGG pathway and GO Analysis (Biological process) for further analysis.
CancerSEA single cell state atlas
The database collects 72 single-cell datasets, totaling 41,900 single cells of 25 human cancers, Mapping the functional states of a single cell of these 14 functional states related to cancer in different cancers. These functional states were also associated with 18,895 protein-coding genes (PCGs) and 15,571 LncRNAs on the single cell level to understand the mechanisms underlying functional differences in cancer cells (58). By inputting the STAT5A gene, the heat map of its correlation with 14 states of ovarian cancer cells was plotted. The status of ovarian cancer cells with a high correlation with the STAT5A gene was filtered by limiting the correlation strength (R > 0.3), and the corresponding scatters plot was generated automatically.
Cell lines and culture
Human ovarian cancer cell line HO8910 was obtained from the American Type Culture Collection (ATCC). Human normal ovarian epithelial cells (IOSE80) were a kind gift from Hanqing Hong (International Peace Maternity and Child Health Hospital, China). The two kinds of cells were incubated in DMEM High Glucose medium and DMEM-F12medium (HyClone, SH30234.01), respectively, with 10% Foetal Bovine Serum (FBS), 1% penicillin, and 1% streptomycin at 37°C in 5% CO2.
HO8910 cells were transiently transfected with pcDNA3.1-STAT5A-C-3Fla or empty vector plasmids using Lipofectamine ™ 3000 Transfection Reagent (Thermo L3000015) according to the manufacturer's instructions. The total RNA and whole-cell lysates were then harvested for Western blots analysis 48 h after transfection.
RT-PCR
Total RNA was extracted from HO8910 cells by the Trizol method. According to TAKARA reverse transcription kit instructions, the reaction solution was prepared in a 0.2 mL Ep tube. The reverse transcription conditions were as follows: 37 ℃ for 15 min. The target gene and internal reference gene expression in the cell sample were detected by qPCR. RT 2 Profiler PCR Array Data Analysis system of QIAGEN Company was used for data analysis. Primer sequence for STAT5A and GAPDH (5'to 3'): STAT5A-human-F: GCAGAGTCCGTGACAGAGG; STAT5A-human-R: CCACAGGTAGGGACAGAGTCT. G A P D H -h u m a n -F : TCAACGACCACTTTGTCAAGCTCA; GAPDH-human-R: GCTGGTGGTCCAGGGGTCTTACT.
Scratch wound assay HO8910 cells, after different treatments, were seeded in 48well plates with 1.5x10 5 cells per well and incubated overnight in DMEM High Glucose medium supplemented with 2%FBS. Then the cell monolayer was scraped horizontally with a 200 mL pipette tip and scratches were immediately generated and washed twice with 1XPBS. 2 ml of fresh DMEM High Glucose medium containing 2% FBS was added, and cells were continued to be cultured for 48 h. Images of cells using an inverted microscope (Leica DMi8) by a 10X objective. Image J software quantified and analyzed the scratch area (freeware http://fiji.sc).
Transwell invasion assay
The Matrigel was placed in the refrigerator at 4°C overnight from -20°C, and the upper chamber surface of the bottom membrane of the Transwell chamber was coated with 50 mg/L Matrigel (1:8 diluent) and air-dried at 4°C. HO8910 cells after different treatments were digested with trypsin and resuspended with serum-free medium. The cell density was adjusted to 5×10 5 cells/mL. 200 mL of cell suspension was added into the upper compartment of the Transwell chamber, and 500 mL of culture medium containing 10% FBS was added into the lower chamber of the 24-well plate. The culture plates were placed in a CO 2 incubator at 37°C for 48 h. The chambers were taken out, and 1 x PBS was washed twice. The cells in the upper layer of the chamber's membrane were removed carefully using a cotton swab. 4% paraformaldehyde-fixed for 20 min. Crystal violet solution stained for 15 min. Images were taken under an inverted microscope (Leica DMi8) by a 4X objective. 10 fields of view were counted randomly for each sample by Image J software (freeware http://fiji.sc) and then analyzed statistically.
IHC assay
Ovarian Cancer and adjacent normal tissue microarray (TMA, n=90) were obtained from Shanghai Outdo Biotechnology Company, Ltd (SHXC2021YF01). IHC was carried out as described previously (59). The TMA was placed in an oven at 68°C for 2 h. Dewaxing was completed in the automatic dyeing machine, and the slides were placed in the antigen retrieval instrument to initiate the repair. Then, they were allowed to cool naturally for more than 10 minutes and washed with PBS buffer. The working solution of primary antibodies, including anti-STAT5A (Proteintech 13179-1-AP), anti-P-STAT5A (Signalway Antibody, 11048), anti-MMP2 (Proteintech, 10373-2-AP) diluted 1:200 was added respectively. The slides were kept at 4°C overnight and then rewarmed at room temperature for 45 min, washed with PBS buffer, and put into DAKO automatic IHC instrument. The blocking, secondary antibody binding, and DAB color development procedures were selected according to the "Autostainer Link 48 Use Guide". The slides were stained with hematoxylin for 1min, immersed in 0.25% alcohol hydrochloric acid (400ml 70% alcohol +1ml concentrated hydrochloric acid) for about 10 s, and rinsed with tap water for 5 min. Then, the slides were dried at room temperature and sealed with neutral resin.
Statistical analysis
All the experiments were performed independently, at least in triplicate. All the data were expressed as mean ± standard deviation (SD). Statistical analyses were carried out with GraphPad Prism software version 8.0. Multiple group comparisons were performed using a one-way ANOA test. Mann-Whitney test was used to analyze the expression of molecules in tissues. The correlation between molecular and clinical indicators was evaluated by the Chi-square test, Kaplan-Meier survival analysis, and Log-rank Statistical test. P < 0.05 was considered statistically significant.
Data availability statement
The original contributions presented in the study are included in the article/Supplementary Material. Further inquiries can be directed to the corresponding authors.
|
v2
|
2022-11-29T14:46:31.600Z
|
2022-11-29T00:00:00.000Z
|
254046325
|
s2orc/train
|
Targeting the chemerin/CMKLR1 axis by small molecule antagonist α-NETA mitigates endometriosis progression
Endometriosis is a common gynecological disease, characterized by the presence of endometrial-like lesions outside the uterus. This debilitating disease causes chronic pelvic pain and infertility with limited therapeutics. Chemerin is a secretory protein that acts on CMKLR1 (Chemokine-Like Receptor 1) to execute functions vital for immunity, adiposity, and metabolism. Abnormal chemerin/CMKLR1 axis underlies the pathological mechanisms of certain diseases including cancer and inflammatory diseases, but its role in endometriosis remains unknown. Herein, our results showed that chemerin and CMKLR1 are up-regulated in endometriotic lesions by analyzing the human endometriosis database and murine model. Knockdown of chemerin or CMKLR1 by shRNA led to mesenchymal-epithelial transition (MET) along with compromised viability, migration, and invasion of hEM15A cells. Most importantly, 2-(α-naphthoyl) ethyltrimethylammonium iodide (α-NETA), a small molecule antagonist for CMKLR1, was evidenced to exhibit profound anti-endometriosis effects (anti-growth, anti-mesenchymal features, anti-angiogenesis, and anti-inflammation) in vitro and in vivo. Mechanistically, α-NETA exhibited a dual inhibition effect on PI3K/Akt and MAPK/ERK signaling pathways in hEM15A cells and murine endometriotic grafts. This study highlights that the chemerin/CMKLR1 signaling axis is critical for endometriosis progression, and targeting this axis by α-NETA may provide new options for therapeutic intervention.
Introduction
Endometriosis is a common gynecological disease estimated to affect 6-10% of women of reproductive age (Zondervan et al., 2020). It is characterized by the presence of endometrial-like lesions outside the uterus, and could be divided into three subtypes based on its histopathology and anatomical locations: superficial peritoneal endometriosis, ovarian endometriosis (also known as endometrioma or chocolate cyst), and deep infiltrating endometriosis (DIE) (nodules >5 mm in depth) (Wang et al., 2020). Notably, this heterogeneous disease is closely associated with chronic pelvic pain and infertility, which severely affect the living quality of women and cause the socioeconomic burden (Taylor et al., 2021). Several theories were proposed to explain the origin and pathophysiology of endometriosis, and at least for peritoneal endometriosis, Sampson's "retrograde menstruation" theory has been widely accepted (Zondervan et al., 2018). It refers that menstrual endometrial debris reaches the abdominal cavity through the fallopian tubes, where they undergo successive biological events (adhesion, survival, proliferation, invasion, angiogenesis, inflammation, etc.) to form the endometriotic lesions (Zondervan et al., 2018). Advances made during the last 2 decades have unveiled that numerous factors (inheritance, genetic mutations, hormone metabolism, chronic inflammation, neoangiogenesis, etc.) account for the disease occurrence, progression, and performance (Saunders and Horne, 2021). Unfortunately, reliable non-invasive biomarkers for early diagnosis are still lacking and first-line treatments (surgery and medication management) for endometriosis are sub-optimal (Chapron et al., 2019). Therefore, identifying novel molecular targets and understanding the mechanism of endometriosis development are urgently needed to improve diagnostics and therapeutic methods.
The chemerin gene, RARRES2 (retinoic acid receptor responder 2) was originally identified as a novel retinoidresponsive gene in skin (Nagpal et al., 1997). In 2003, two independent groups reported that chemerin, the product of RARRES2, was the endogenous ligand for an orphan G-protein coupled receptor (GPCR): chemokine-like receptor 1 (CMKLR1) (Meder et al., 2003;Wittamer et al., 2003). In the beginning, chemerin was mainly treated as a chemokine since it recruits the CMKLR1-expressing leukocytes to the inflammatory site to regulate the immune events (Wittamer et al., 2003), indicating the pro-inflammatory property of chemerin similar to other chemokines. Apart from the well-documented role in immunity, the chemerin/CMKLR1 axis was found to participate in numerous physiological processes including adipogenesis, angiogenesis, thermogenesis, and metabolism (Goralski et al., 2007;Bozaoglu et al., 2010;Takahashi et al., 2011;Lin et al., 2021). So far, studies also demonstrated that chemerin binds G protein-coupled receptor 1 (GPR1) and chemokine (C-C motif) receptor-like 2 (CCRL2) with a high affinity similar to that of CMKLR1. CMKLR1 displays a strong signals response to chemerin (intracellular Ca 2+ release, inhibition of cAMP accumulation, and phosphorylation of ERK1/2). Unlike CMKLR1, the binding of chemerin to GPR1 results in a weak Ca 2+ mobilization and phosphorylation of ERK1/2, and the binding of chemerin to CCRL2 does not signal nor internalize (De Henau et al., 2016). The distinct signaling properties of the chemerin receptors imply that CMKLR1 serves as the main functional receptor.
Results
Chemerin and CMKLR1 are up-regulated in endometriosis To detect the expression of chemerin and CMKLR1 in human endometriosis, we analyzed the transcript data in the Turku endometriosis database (https://endometdb.utu.fi/) (GEO accession: GSE141549), and results showed that transcript levels for chemerin and CMKLR1 in endometriotic tissues from five locations (peritoneal, sacrouterine ligament, rectovaginal, DIE, and ovarian lesions) were consistently enhanced compared to the healthy endometrium ( Figure 1A). Next, we established a murine peritoneal endometriosis model to confirm this finding ( Figure 1B), and ELISA results showed that chemerin was significantly enhanced in peritoneal lavage fluids of EM mice (3131.6 ± 102.7 pg/ml) compared with those of sham-treated mice (2814.9 ± 120.2 pg/ml) ( Figure 1C). IHC was performed to verify the immunolocalization of chemerin and CMKLR1, and as depicted in Figure 1D, chemerin signals were confined to the glandular epithelium of sham-eutopic uterus, while almost invisible in the stroma. Notably, chemerin staining was observed both in the glandular epithelium and the stroma of EM-lesions. Meanwhile, positive signals for CMKLR1 were localized to the glandular epithelial cells, stromal cells and vascular epithelial cells in the murine endometriotic grafts ( Figure 1E; Supplementary Figure S1A). Quantitative data further showed that chemerin and CMKLR1 protein level were significantly elevated in the EM-lesions relative to the sham group ( Figure 1F). These results provided evidence that chemerin and CMKLR1 expression were abnormally upregulated in endometriosis.
Knockdown of chemerin or CMKLR1 impairs the viability and mesenchymal features of hEM15A cells
To evaluate the function of chemerin in cellular biological events, hEM15A cells (an immortalized endometrial stromal cell Chemerin and CMKLR1 are up-regulated in endometriosis. (A) Chemerin and CMKLR1 transcript levels in the endometrium, peritoneum, and endometriotic lesions from Turku endometriosis database (GSE141549). ns, not significant; blue, versus healthy endometrium; red, versus endometriosis endometrium; (B) Schematic of animal experimental-1 to analyze the chemerin expression in a surgically-induced peritoneal EM mouse model. (C) After surgeries for 1 month, chemerin levels in peritoneal lavage fluids from sham-(n = 6) and EM-mice (n = 6) were detected by ELISA. (D,E) Representative IHC images of murine chemerin and CMKLR1 expression in sham-eutopic endometrium and EM-ectopic lesions. Bars, 100 μm. (F) The quantitative data of IHC in (D,E) was shown. Data are shown as mean ± SD; *p < 0.05; **p < 0.01; ***p < 0.001.
Frontiers in Pharmacology
frontiersin.org line derived from eutopic endometrium of ovarian endometriosis (Mai et al., 2021)) were utilized. First, hEM15A and Ishikawa (a human endometrial adenocarcinoma cell line) cells were found to contain detectable chemerin protein as measured by western blot (Supplementary Figure S1B). Next, a single cell-clone line of hEM15A stably expressing shRNA targeting RARRES2 was created. qPCR, Western blot, and ELISA were performed to validate the knockdown efficiency (Figures 2A-C). CCK-8 assay showed that chemerin knockdown (chemerin-KD) markedly suppressed the cell viability when compared with the shControl ( Figure 2D). Additionally, we observed that shControl cells exhibited a typical mesenchymal-like morphology (loss of cell-cell contacts and cell scattering), while chemerin-KD cells displayed an epitheliallike morphology (gain of cell-cell contacts and cobblestone-like appearance) ( Figure 2E). This mesenchymal-epithelial transformation (MET) of cellular morphology implies that chemerin-KD cells might lose the characteristics of mesenchymal cells such as the highly motility and invasiveness. As expected, transwell analysis results showed that the migratory and invasive capacities of chemerin-KD cells were markedly inhibited by~60% and~40%, respectively, when compared with the shControl cells ( Figure 2F). Western blot results further showed that knockdown of endogenous chemerin led to up-regulated expression of E-cadherin (epithelial cell biomarker), in conjunction with down-regulated expression of N-cadherin, vimentin, and MMP9 (mesenchymal cell biomarkers) ( Figure 2G), clearly suggesting the molecular alterations related to MET.
Moving forward, we established a single cell-clone line of hEM15A stably expressing shRNA targeting CMKLR1 ( Figures 3A,B). Consistent with the findings found in chemerin-KD cells, CMKLR1-KD cells also exhibited an epithelial-like morphology ( Figure 3C), compromised cellular viability ( Figure 3D) as well as weakened motility and invasiveness ( Figure 3E). Knockdown of CMKLR1 resulted in enhanced expression of E-cadherin,
FIGURE 2
Knockdown of chemerin impairs the viability and mesenchymal features of hEM15A cells. (A-C) Chemerin mRNA and protein levels in hEM15A cells stably expressed scrambled shRNA (shControl) and shRNA targeting chemerin (chemerin-KD) were measured by qPCR, western blot, and ELISA. (D) CCK-8 assay was used to access the cell viability. (E) Representative images of cellular morphology. Scale Bars, 50 μm. (F) Transwell assay was utilized to evaluate cell migration and invasion ability, and the quantitative data was shown in the diagrams. (G) E-cadherin, N-cadherin, vimentin, and MMP-9 expression was detected by immunoblots. Assays were performed in triplicate and the densitometry of blots was shown. β-Actin served as a loading control. Data are shown as mean ± SD. *p < 0.05; **p < 0.01; ***p < 0.001.
Frontiers in Pharmacology
frontiersin.org 04 together with reduced expression of N-cadherin, vimentin, and MMP9 ( Figure 3F). These data suggest that chemerin derived from endometriotic stromal cells serves as a critical modulator in sustaining the cellular viability and mesenchymal features via CMKLR1 in an autocrine feature.
α-NETA inhibits the viability and mesenchymal features of hEM15A cells Next, a pharmacological approach was performed by utilizing the small molecule α-NETA to antagonize CMKLR1. CCK-8 assay showed that hEM15A cells displayed restrained viability with increasing concentrations of α-NETA exposure, and the IC 50 value (20.16 ± 1.39 μm) was calculated ( Figure 4A). Clone formation assay further observed that the clonogenic ability of hEM15A cells was inhibited by approximately 70% when the culture systems were persistently treated with 25 μM α-NETA ( Figure 4B). Moreover, under the 3D-culture condition, α-NETA (25 and 50 μM) inhibited the growth of hEM15A-spheroids as measured by the diameters ( Figure 4C) as well as stained with the calcein-AM (CaAM, living cell marker) and ethidium homodimer-1 (EthD-1, dead cell marker) ( Figure 4D). Migration and invasion of hEM15A cells exposed to α-NETA were significantly decreased by around 40% and 50% relative to the controls, respectively ( Figure 4E). Western blot results further verified that α-NETA treatment significantly altered the expression of biomarkers (E-cadherin, N-cadherin, vimentin, and MMP9) indicative of MET ( Figure 4F).
Chemerin acts on CMKLR1 to activate the PI3K/Akt and MAPK/ERK signaling pathways in hEM15A cells
In order to explore the signaling transduction mechanisms of chemerin/CMKLR1 in endometrial stromal cells, two critical signaling pathways (PI3K/Akt and MAPK/ERK) known to implicate in endometriosis establishment and development were examined. Total Akt, phospho-Akt (Ser 473 ) (hereby referred to as p-Akt), total ERK1/2, and phospho-ERK1/2 (Thr 202 /Tyr 204 ) (hereby referred to as p-ERK1/2) in hEM15A-shControl and chemerin-KD cells were detected by Western blot. As shown (E) Transwell assay was utilized to evaluate cell migration and invasion ability, and the quantitative data was shown in the diagrams. (F) E-cadherin, N-cadherin, vimentin, and MMP-9 expression was detected by immunoblots. Assays were performed in triplicate and the densitometry of blots was shown. GAPDH served as a loading control. Data are shown as mean ± SD. *p < 0.05; **p < 0.01; ***p < 0.001.
Frontiers in Pharmacology
frontiersin.org in Figure 5A, the quantitative analysis of immunoblots showed that knockdown of endogenous chemerin resulted in a marked inhibition of p-Akt and p-ERK1/2 protein levels (normalized to Akt and ERK1/2, respectively). In addition, exogenous treatment with recombinant human chemerin (rhchemerin) (1 or 10 ng/ml for 5 min) dose-dependently increased the p-Akt and p-ERK1/2 protein amounts in hEM15A cells ( Figure 5B). It is worth noting that several
FIGURE 4
Effects of α-NETA on hEM15A-spheroids and hEM15A cells. (A) hEM15A cells were exposed to increasing concentrations of α-NETA for 24 h, a CCK-8 assay was used to access the cell viability, and the IC 50 was calculated. (B) Clone formation assay of hEM15A cells treated without or with 25 μM α-NETA. (C) Representative images of hEM15A-spheriods treated with α-NETA (25 and 50 μM) for 48 h. The diameter of spheroids was recorded, and the statistical data was shown in the diagram. (D) Representative images of hEM15A-spheriods stained with calcein-AM and EthD-1 after α-NETA treatment. (E) Transwell assay was utilized to evaluate cell migration and invasion ability, and the quantitative data was shown in the diagrams. (F) E-cadherin, N-cadherin, vimentin, and MMP-9 expression were detected by immunoblots. Assays were performed in triplicate and the densitometry of blots was shown. β-Actin served as a loading control. Scale bars, 50 μM (C,D) and 100 μm (E). Data are shown as mean ± SD. *p < 0.05; **p < 0.01; ***p < 0.001.
Frontiers in Pharmacology frontiersin.org studies found that long-term exposure with rh-chemerin increases the PTEN expression in hepatocellular carcinoma, prostatic carcinoma, and sarcoma cell lines, thus suppressing the PI3K/Akt signaling pathway (Li et al., 2018;Rennier et al., 2020). We, therefore, asked whether this phenomenon could occur in hEM15A cells, and our results clearly showed that the PTEN protein expression was not altered after rh-chemerin (10 ng/ml) treatment for 48 h (Supplementary Figure S1C). Alternatively, the quantitative data further showed that knockdown of CMKLR1 robustly perturbed rh-chemerin-induced p-Akt and p-ERK1/2 levels suggesting that chemerin acts via CMKLR1 to stimulate the PI3K/Akt and MAPK/ERK signaling cascades ( Figure 5C). In agreement with these findings, blockage of the chemerin/ CMKLR1 axis by α-NETA significantly repressed the p-Akt and p-ERK1/2 levels in hEM15A cells ( Figure 5D). α-NETA pre-treatment also hindered rh-chemerin-mediated phosphorylation of Akt and ERK1/2, and Wortmannin (inhibitor of PI3K/Akt) or PD98059 (inhibitor of MAPK/ ERK) were leveraged as the positive controls ( Figures 5E,F). Wortamanin combined with PD98059 treatment suppressed the expression mesenchymal markers of hEM15A cells and rh-chemerin treated hEM15A-chemerin-KD cells, and similar results were observed in the α-NETA treatment group (Supplementary Figure S1D,E). These results suggest that chemerin/CMKLR1 axis regulates the mesenchymal characteristics of endometriotic cells at least through the PI3K/Akt and MAPK signaling pathways.
Frontiers in Pharmacology
frontiersin.org α-NETA alleviates the endometriosis progression in vivo Based on the aforementioned results, we reasoned that blockage of the chemerin/CMKLR1 axis by α-NETA could be a potential therapeutic approach for endometriosis treatment. To test this idea, a pre-clinical murine model was established, and vehicle or α-NETA were administered by intraperitoneal injection thrice a week for 4 weeks ( Figure 6A). Results showed that α-NETA treatment significantly inhibited the size of the lesions when compared with the vehicle controls ( Figure 6B (Zabel et al., 2006), these histological results implies that blockage of chemerin/CMKLR1 axis by α-NETA restrains the endometriotic cellular proliferation, angiogenesis and immune cell chemotaxis. Meanwhile, ELISA results showed that peritoneal leverage fluids of the α-NETA group contained significantly lower TNF-α and IL-6 levels than those of vehicle controls ( Figure 6E), indicating an anti-inflammatory potential of α-NETA. Furthermore, western blot results showed that α-NETA administration led to an up-regulated expression trend of E-cadherin, coupled with a significant down-regulation of N-cadherin, vimentin, and MMP9 ( Figure 6F), suggesting an anti-mesenchymal effect of α-NETA. Meanwhile, α-NETA treatment simultaneously inactivated the PI3K/Akt and MAPK/ERK signaling pathways as demonstrated that the lower levels of p-Akt and p-ERK1/2 in ectopic tissues of α-NETA group relative to the vehicle group. Taken together, these data provide strong evidences that α-NETA displays an anti-endometriosis effect in vivo.
Discussion
In this article, we found that chemerin and CMKLR1 were aberrantly upregulated in endometriosis. Combining the data from cellular and animal models, we revealed that chemerin acts via CMKLR1 to activate the PI3K/Akt and MAPK/ERK signaling pathways, thus regulating the viability and mesenchymal features of endometriotic cells. Additionally, we provide evidence that CMKLR1 antagonist α-NETA exhibits profound anti-endometriosis effects (anti-growth, anti-mesenchymal features, anti-angiogenesis, and antiinflammation) in vivo.
Efforts have been made for decades to find non-or minimally invasive biomarkers for the early detection and monitoring of the progression of endometriosis, unfortunately, a single reliable endometriosis biomarker is still underway. In this article, analysis of the human database found that RARRES2 and CMKLR1 were consistently up-regulated in peritoneal, sacrouterine ligment, rectovaginal, DIE, and ovarian lesions when compared with the eutopic controls ( Figure 1A). Our experiments further confirmed that chemerin and CMKLR1 were enhanced in mouse peritoneal endometriosis ( Figures 1B-F). These results are in agreement with one study published in 2015 which reported that the chemerin and CMKLR1 were markedly elevated in the ovarian endometrial lesions relative to the controls. This article also reported that peritoneal fluids of endometriosis contained higher amounts of chemerin when compared with the non-endometriosis controls. However, chemerin concentrations in serum did not differ in patients with and without endometriosis (Jin et al., 2015). Similarly, the current study found that chemerin in peritoneal leverage fluids of EM-mice was greater than those in the shammice ( Figure 1C). Unexpectedly, chemerin in serum was significantly decreased in EM-mice relative to the sham-mice (data not shown). A possible explanation for this might be that endometriosis affects the function of liver or adipose tissue (Taylor et al., 2021), which are primary organs that contribute to the circulating chemerin. Nonetheless, according to the previous and current data, we can infer that local chemerin, but not systemic chemerin, could be considered as a potential biomarker for endometriosis. Further research should be undertaken to collect the body fluids (serum, urine, and Schematic illustrating the current working model. Chemerin acts via CMKLR1 to regulate a series of biological events, thus promoting the endometriotic lesion establishment and development. Disrupting the chemerin/CMKLR1 axis by α-NETA alleviates the endometriosis progression. Frontiers in Pharmacology frontiersin.org seroperitoneum) from healthy individuals and patients to evaluate the clinical diagnostic value of chemerin. EMT/MET is a fundamental cellular event that underlie embryonic development, tissue repair, and cancer metastasis (Kalluri and Weinberg, 2009). EMT is generally characterized by the loss of the epithelial features and gain of traits of mesenchymal cells. The induction of EMT is triggered by a variety of factors/signaling pathways, and these EMT-inducers promote the expression of EMT-transcription factors, which further repress the epithelial-related biomarkers (E-cadherin, etc.) along with activating the mesenchymal-related biomarkers (N-cadherin, vimentin, MMPs, etc.) (Dongre and Weinberg, 2019). EMT is an increasingly recognized phenomenon in endometriotic lesions (Zondervan et al., 2018). The immunohistochemical and bioinformatic analysis found that EMT-related biomarkers are significantly altered in ectopic endometrial tissues relative to the eutopic tissues (Chen et al., 2020;Konrad et al., 2020). More importantly, EMT serves as a critical biological step for endometriosis progression, because EMT results in a more aggressive capacity of the endometriotic cells (increased MMPs), leading to progesterone resistance (down-regulation of progesterone receptor) and triggering the formation of fibrosis (Zhang et al., 2016;Zondervan et al., 2018;Ma et al., 2021). As reviewed by Yan-Meng Yang and Wan-Xi Yang, hypoxia and estrogen initiate the EMT through different pathways (TGF-β/Smad and Wnt/β-catenin, etc.) in endometriosis (Yang and Yang, 2017). Herein, we obtained new evidence that inhibition of the chemerin/CMKLR1 axis by genetical or pharmacologic approaches reverses the mesenchymal features of hEM15A cells ( Figures 2E-G, 3D-F, 4E,F) and murine endometriotic tissues ( Figure 6F). In addition, chemerin was also found to promote EMT, migration, and invasion in oral squamous cell carcinoma (OSCC) cell lines (Lu et al., 2019). However, Hyungkeun Kim et al reported the opposite results in breast cancer cell lines (Kim et al., 2020), suggesting that the role of chemerin in EMT/MET is cell-context specific and cell-type dependent. Further research should be undertaken to investigate the basic mechanism underlying chemerin-induced EMT/MET. In addition, given that EMT/ MET is essential in endometrial regeneration and decidualization (Owusu-Akyaw et al., 2019), it will be of great interest to study the role of the chemerin/CMKLR1 axis in endometrial physiological functions.
Chemerin was initially identified as a chemoattractant, acts through CMKLR1 expressed on certain leucocyte populations, controlling chemotaxis towards the area of inflammation (Wittamer et al., 2003). Mounting evidence suggests that chemerin/CMKLR1-induced immune cell chemotaxis participates in various physiological processes and diseases. For example, during early pregnancy, trophoblasts and decidua stromal cells secrete abundant chemerin to aggregate NK cells into the placenta to further ensure successful pregnancy (Carlino et al., 2012). Apart from its role in immunity, previous studies evidenced that the chemerin/CMKLR1 axis is angiogenic in vitro and in vivo (Bozaoglu et al., 2010;Kaur et al., 2010;Nakamura et al., 2018). In consideration of chronic inflammation and neovascularization are two key processes for endometriosis development, we hypothesized that locally enhanced chemerin might contribute to these two vital pathological events. Through a pharmacological approach, α-NETA administration significantly suppressed the CD31positive and F4/80-positive cells in the murine-endometriosis lesions compared with the vehicle controls ( Figures 6D,E). α-NETA also inhibited the infiltrating CD206-positive M2-like macrophages (Supplementary Figure S1H), which were reported to participate in the angiogenesis (Ono et al., 2021) and fibrogenesis (Duan et al., 2018) of endometriotic lesions in mice. Due to the reasons that CMKLR1 is expressed on vascular endothelial cells in murine endometriotic lesions (Supplementary Figure S1A), and F4/80-positive murine macrophages (Zabel et al., 2006). These results imply that the chemerin/CMKLR1 axis seems to contributes to angiogenesis and inflammations during endometriosis progression, and targeting this axis is plausible for endometriosis treatment.
Currently, three types of CMKLR1 antagonists including polypeptides (C15), nanobodies (CA4910 and CA5183), and small molecule compounds (CCX832 and α-NETA) were developed (Kennedy and Davenport, 2018). CMKLR1 antagonists display a promising therapeutic effect in several animals disease models such as the myocardial infarction model (C15), type 2 diabetes model (CCX832), multiple sclerosis model (α-NETA), neuroblastoma xenograft model (α-NETA), and preeclampsia model (α-NETA) (Cash et al., 2013;Graham et al., 2014;Tümmler et al., 2017;Neves et al., 2018;Ji et al., 2021). In this work, we found that α-NETA inhibited the growth of hEM15A cells and hEM15A-speriods ( Figures 4A-D). α-NETA treatment resulted in MET, weakened motility, and invasion ability of hEM15A cells (Figures 4E,F). Most importantly, our pre-clinical animal model results revealed that α-NETA mitigated the endometriosis progression (anti-growth, antimesenchymal features, anti-angiogenesis, and antiinflammation) without weight loss and obvious organ damage ( Figure 6; Supplementary Figure S1F,G). These data raise the possibility that α-NETA serves as a potential adjuvant drug for endometriosis therapy. α-NETA appears to exhibit reliable security in vitro and in vivo (Kumar et al., 2019). Given that oral administration of a high dosage of α-NETA (300 mg/kg) daily for 14 days did not affect the mouse body weight or gross morphological appearance of vital organs (Kumar et al., 2019), we are interested to evaluate the effects of oral gavage with α-NETA on endometriosis development, pain performance and fertility status of EM-mice in future.
In endometriosis, multiple abnormal signaling cascades were responsible for survival, proliferation, EMT, migration, invasion, and anti-apoptosis of endometriotic cells. Among Frontiers in Pharmacology frontiersin.org these pathways, PI3K/Akt and MAPK/ERK pathways were widely examined, and the application of inhibitors (Sorafenib, Vemurafenib, U0126, MK2206, WIN 55212-2) was shown to have profound therapeutic efficacy in vitro and in vivo, despite they have certain side-effects (Hung et al., 2021). In the endometriotic milieu, estradiol, inflammatory factors (TNFα, IL-6, IL-1β, etc.) or growth factors (EGF, etc.) were enhanced, and these mediators activate the PI3K/Akt and MAPK/ERK pathways in endometriotic cells. In this article, results in Figures 5A,B showed that exogenous or endogenous chemerin impacts the phosphorylation of Akt and ERK1/2 in hEM15A cells. Moreover, results in Figures 5C-F provide strong evidence that genetical and pharmaceutical inhibition of CMKLR1 hindered rh-chemerin-activated p-Akt and p-ERK1/2 in hEM15A cells. Most importantly, α-NETA simultaneously restrained the p-Akt and p-ERK1/ 2 levels in hEM15A cells and murine-endometriosis lesions ( Figure 5D and Figure 6F), which could further impair the biological functions of endometriotic cells (Supplementary Figure S1D,E). Supported by Banu SK and coworker's proposal that dual inhibition of PI3K/Akt and MAPK/ERK is indispensable for the suppression of endometriosis establishment and progression (Arosh and Banu, 2019;Arosh et al., 2021), we provide molecular insights into the therapeutic effects of targeting chemerin/CMKLR1 axis by α-NETA in endometriosis. Taken together, using a combination of bioinformational, genetical, pharmacological, and histological analysis approaches, we show here that the chemerin/CMKLR1 axis is crucial for endometriosis development. We believe that these findings will help in a better understanding of the pathological mechanisms in endometriosis, and may allow for the development of clinical therapeutic drugs.
Animals and experimental design
All animal experimental procedures were performed according to protocols approved by the Institutional Animal Care and Use Committee (IACUC) at SIAT (#SIAT-IACUC-200313-YYS-YM-A1105). All mice used in this study were maintained under controlled conditions with a light/dark cycle of 12/12 h and had access to food and water ad libitum. 7-weekold virgin female C57BL/6J mice were directly purchased from the GemPharmatech (Guangdong, China), and bred in specific pathogen-free facilities at SIAT. A syngeneic surgical model of endometriosis was established according to the protocol published online (Escudero-Lara et al., 2020). Briefly, mice at diestrus were selected as the donors, and their uterine and abdominal fat tissues were excised. One uterine horn was excised and longitudinally opened with scissors. Uterine horn or fat tissues were dissociated into four pieces (2 mm × 2 mm). Next, the uterine fragments were sutured into the abdominal wall (two on each side of the incision with the endometrium facing the abdominal wall) to generate the peritoneal endometriosis-like lesions. Fat tissues were sutured into the abdominal wall (two on each side of the incision) to serve as the sham control. Four weeks after surgeries, euthanize the recipient mice by cervical dislocation, and the samples were collected and analyzed. Two animal experiments with different purposes were performed in this study, and each experiment was carried out three times.
Experimental-1 was designed to examine the chemerin and CMKLR1 expression in a mouse-EM model. A total of 15 mice were used, three in diestrus were selected as donors to provide the fat and uterine tissues. 12 recipients were randomly divided into two groups: six mice received with fat tissues were defined as the "sham", and six mice received with uterine fragments were defined as the "EM". ( Figure 1B).
Experimental-2 was designed to evaluate the effects of α-NETA on endometriosis in vivo. A total of 18 mice were used. Six in diestrus were selected as donors to provide the uterine tissues. 12 surgically induced EM mice were randomly divided into two groups: "vehicle" and "α-NETA". α-NETA was formulated in a 10% SBE-β-CD vehicle for in vivo dosing. α-NETA (3 mg/kg, 100 μl) or vehicle (10% SBE-β-CD in saline, 100 μl) were administered by intraperitoneal injection thrice a week for 4 weeks. The body weight of mice was recorded on the day of dosing ( Figure 6A).
Frontiers in Pharmacology
frontiersin.org Cell culture hEM15A and Ishikawa cell lines were purchased from BeNa Culture Collection. Ishikawa cells were cultured in DMEM/ Basic (1×) supplemented with 10% fetal bovine serum (FBS) and 1% penicillin-streptomycin. hEM15A cells were cultured in DMEM/F-12 supplemented with 10% fetal bovine serum (FBS) and 1% penicillin-streptomycin. All cell lines were characterized as mycoplasma negative using the MycoBlue Mycoplasma Detector (D101-02, Vazyme) according to the manufacturer's instructions. Cells were cultured in a humidified atmosphere containing 5% CO 2 at 37°C. The medium was renewed every 2-3 days. To generate stable genetically modified hEM15A cell lines, empty vector, shRNA targeting RARRES2 (stem sequence: AGC CCT TCC CAG CTG GAA TATT) or CMKLR1 (stem sequence: AGG TGA TGA ATA CCC TGA TTAT) were transiently transfected in hEM15A cells by using Lipofectamine 2000 reagent (Invitrogen). Two days later, 2.5 μg/ml puromycin was added to the culture medium, and single-cell clones were further screened, the knockdown efficiency was validated by qPCR and western blot.
Quantitative real-time PCR
Cells were treated with RNAiso Plus reagent (Takara) for RNA extraction, and the PrimeScript ™ RT Master Mix (RR036A, Takara) was used to synthesize cDNA. TB Green ® Premix Ex Taq ™ (Tli RNaseH Plus) (RR420L, Takara) was used for qPCR.
Protein isolation and western blot
Proteins were extracted by M-PER ™ Mammalian Protein Extraction Reagent (78501, Thermo Fisher), and the concentrations were quantified by Pierce ™ BCA (23227, Thermo Fisher). Equal proteins were loaded onto 12% SDS-PAGE gels and then were transferred onto a nitrocellulose membrane (Merck Millipore). After blocking with 5% non-fat dry milk for 1.5 h, the membranes were incubated at 4°C overnight with the primary antibody; Next, the membranes were incubated with HRP-labeled goat anti-mouse or goat anti-rabbit IgG for 1 h.
An enhanced chemiluminescence (ECL) detection system (Bio-Rad, United States) was used to visualize immunoreactive bands. Except for western blots including multiple tissue samples, each western blot experiment was repeated three times with independent sample sets.
ELISA
The conditional medium of hEM15A and primary human endometrial stromal cells were collected to detect the human chemerin levels. Peritoneal leverage fluids of a sham-or EM-mice were collected to detect the mouse chemerin levels. ELISA kits for human chemerin (DCHM00) and mouse chemerin (MCHM00) were purchased from R&D Systems. Peritoneal leverage fluids of vehicle-or α-NETA administrated mice were collected to detect the mouse TNF-α, IL-6, and IL-1β levels by utilizing the ELISA kits purchased from BioLegend (#430904, #431304 and #432604).
Immunofluorescence and immunohistochemistry
Mouse tissues were collected and fixed in 4% paraformaldehyde. Paraffin-embedded and OCT-embedded tissues were sectioned onto charge slides. For immunohistochemistry, after antigen retrieval, dewaxed hydrated paraffin-embedded tissue sections were immersed in 3% H 2 O 2 and 100% methanol for 30 min at room temperature to quench endogenous peroxidase, and then the sections were blocked with blocking buffer (10% normal serum with 1% BSA in TBS) for 2 h at room temperature, and incubated with the first antibody at 4°C overnight. Next, the sections were incubated with HRP conjugate second antibody for 1h at room temperature followed by detection and counterstain. For immunofluorescence, the sections were blocked and incubated with the first antibody at 4°C overnight. Next, the sections were incubated with Alexa Fluor ® 488-labeled goat anti-rabbit IgG or Alexa Fluor ® 488-labeled goat anti-rat IgG (Abcam) for 1 h followed by counterstaining with DAPI.
Cell viability assay hEM15A cells were seeded at 2000 cells/well in 96-well plates, with five wells used for each group. Cell viability was evaluated over 4 days using Cell Counting Kit-8 (CCK-8) (Beyotime Biotechnology, #C0038). 10 μl CCK-8 plus 90 μl DMEM/ F12 medium without FBS (detection buffer) was added to each well and incubated at 37°C for 1.5 h. The absorbance at 450 nm was measured in each well by using a microplate reader (Thermo Fisher Scientific). For the cytotoxicity assay, hEM15A Frontiers in Pharmacology frontiersin.org cells were seeded at 4000 cells/well in 96-well plates, and α-NETA (0, 1. 25, 2.5, 5, 10, 20, 40, 80, 160, 320 μm) was added to the wells for 24 h followed by replacement with detection buffer, and the absorbance at 450 nm was measured with the microplate reader. IC 50 (half maximal inhibitory concentration) of α-NETA was calculated by GraphPad Prism 9.0 (La Jolla, CA, United States).
Clone formation assay hEM15A cells were seeded at 1000 cells/well in a 6-well plate. Following cell adherence, the culture systems were treated in the presence or absence of 25 μm α-NETA. After 2 weeks, plates were fixed with methanol and stained with crystal violet (0.5% w/v). The colony is defined to consist of at least 50 cells, and the colony numbers were counted.
Transwell assay
Cell migration and invasion were determined using a 24wells Transwell chamber (8 μm pores) coated without or with Matrigel, respectively. 50 μl Matrigel diluted with the precooled serum-free DMEM/F12 (1/10) was added to the upper chamber of the Transwell and incubated at 37°C for 30 min 200 μl serumfree DMEM/F-12 medium containing 1 × 10 5 hEM15A cells were transferred to the top chambers. 1 ml 10% FBS DMEM/F-12 medium was added in the 24-wells as the chemotactic agents. After incubating for 24 h (migration) or 48 h (invasion), cells on the upper side of the inserts were removed by a cotton swab. The cells on the bottom of the inserts were fixed in methanol and stained with crystal violet. The number of migrated or invaded cells was counted under a light microscope in four random fields. Three independent experiments were performed.
hEM15A-spheroids preparation, calcein AM, and EthD-1 staining To generate the hEM15A cell-derived spheroids, hEM15A cells were seeded at 2000 cells/well in 96-well Clear Flat Bottom Ultra-Low Attachment Microplate (3474, Corning). Adding 2.5% Matrigel in the culture system (10%FBS DMEM/F-12 medium) was indispensable to form hEM15A-spheroids. α-NETA (0, 25, 50 μm) was added to the plates for 48 h, and the diameter of spheroids was recorded. Live and Dead ™ Viability/ Cytotoxicity Assay Kit for Animal Cells (Calcein AM, EthD-1) was purchased from Yu Heng Bio (L6023). hEM15A-spheroids were stained with Calcein AM and EthD-1 according to the manufacturer's experimental procedure and observed under an inverted fluorescence microscope. Three independent experiments were performed.
Statistical analysis
All statistical analyses were performed using GraphPad Prism 9.0 (La Jolla, CA, United States). Data are presented as mean ± SD. Statistical analysis between two groups was performed using Student's t-test, and analysis between multiple groups was conducted by one-way analysis of variance (ANOVA).
Data availability statement
The original contributions presented in the study are included in the article/Supplementary Material, further inquiries can be directed to the corresponding authors.
Ethics statement
The animal study was reviewed and approved by the All animal experimental procedures were performed according to protocols approved by the Institutional Animal Care and Use Committee (IACUC) at SIAT (#SIAT-IACUC-200313-YYS-YM-A1105).
|
v2
|
2022-11-30T06:17:04.103Z
|
2022-11-29T00:00:00.000Z
|
254067680
|
s2ag/train
|
CCAR2 functions downstream of the Shieldin complex to promote double-strand break end-joining.
The 53BP1-RIF1 pathway restricts the resection of DNA double-strand breaks (DSBs) and promotes blunt end-ligation by non-homologous end joining (NHEJ) repair. The Shieldin complex is a downstream effector of the 53BP1-RIF1 pathway. Here, we identify a component of this pathway, CCAR2/DBC1, which is also required for restriction of DNA end-resection. CCAR2 co-immunoprecipitates with the Shieldin complex, and knockout of CCAR2 in a BRCA1-deficient cell line results in elevated DSB end-resection, RAD51 loading, and PARP inhibitor (PARPi) resistance. Knockout of CCAR2 is epistatic with knockout of other Shieldin proteins. The S1-like RNA-binding domain of CCAR2 is required for its interaction with the Shieldin complex and for suppression of DSB end-resection. CCAR2 functions downstream of the Shieldin complex, and CCAR2 knockout cells have delayed resolution of Shieldin complex foci. Forkhead-associated (FHA)-dependent targeting of CCAR2 to DSB sites re-sensitized BRCA1-/-SHLD2-/- cells to PARPi. Taken together, CCAR2 is a functional component of the 53BP1-RIF1 pathway, promotes the refill of resected DSBs, and suppresses homologous recombination.
|
v2
|
2022-11-30T06:17:06.209Z
|
2022-11-29T00:00:00.000Z
|
254068429
|
s2ag/train
|
Engagement and outcomes of cancer patients referred to a tobacco cessation program at a National Cancer Institute-designated cancer center.
INTRODUCTION
Tobacco cessation is a critical but challenging intervention for cancer patients. Our National Cancer Institute-designated Comprehensive Cancer Center instituted a tobacco cessation program in 2019. This manuscript reports on the first 2 years of our experience.
METHODS
Patients were referred to the program by their care team, and a certified tobacco treatment specialist contacted patients remotely and provided behavioral therapy and coordinated pharmacotherapy. We retrospectively captured data from patients with a cancer diagnosis referred to the tobacco cessation program. Univariate and multivariable logistic regression analyses with the backward elimination approach were performed to determine factors associated with patient acceptance of referral to the tobacco cessation program. Tobacco cessation rates after referral to the program were also captured.
RESULTS
Between July 2019 and August 2021, 194 patients were referred to the tobacco cessation program. Of the 194 patients referred, 93 agreed to enroll in the tobacco cessation program (47.9%), of which 84 requested pharmacotherapy (90.3%). Twenty-four were able to cease tobacco use (25.8%). Only 7 patients out of the 101 patients (6.9%) who declined cessation services were successful (p < 0.001). On univariate logistic regression, race (p = 0.027) and marital status (p = 0.020) were associated with referral acceptance. On multivariable analysis, single patients (odds ratio [OR] = 0.33) and Caucasian patients (OR = 0.43) were less likely to accept a referral.
CONCLUSIONS
Access to tobacco cessation services is a critical component of comprehensive cancer care. Our experience highlights the need to understand patient-specific factors associated with engagement with a tobacco cessation program during cancer treatment. The use of pharmacotherapy is also a critical component of successful tobacco cessation.
|
v2
|
2022-11-30T06:17:06.312Z
|
2022-11-29T00:00:00.000Z
|
254067623
|
s2ag/train
|
Long Noncoding RNAs in the Prediction of Survival of Patients with Digestive Cancers.
BACKGROUND
Long noncoding RNAs have been known to be involved in various cancers. This study aimed to find a long noncoding RNA signature to predict the prognostic risk of patients with digestive cancers, including esophageal carcinoma, stomach adenocarcinoma, liver hepatocellular carcinoma, and pancreatic adenocarcinoma.
METHODS
After screening differentially expressed long noncoding RNAs in 4 digestive cancers from The Cancer Genome Atlas database, the prognostic significance of the above differentially expressed long noncoding RNAs was evaluated by Kaplan-Meier analysis. Target genes of the corresponding differentially expressed long noncoding RNAs were predicted by StarBase. We performed bioinformatics methods, including gene ontology annotation and Kyoto Encyclopedia of Genes and Genomes pathway enrichment analysis, to explore the role and molecular mechanisms of differentially expressed long noncoding RNAs and predicted target genes in tumor progression.
RESULTS
A total of 4 differentially expressed long noncoding RNAs (AC093895.1, CASC9, LINC01980, and HOXC-AS2) with a significant prognostic value were identified. Moreover, 6 target genes were obtained. Also, functional enrichment analysis showed that these 4 DELs were mainly related to the regulation of mRNA metabolic process, regulation of RNA stability, mRNA binding, RNA localization, and spliceosome.
CONCLUSION
The prognostic differentially expressed long noncoding RNAs and target genes in the digestive cancers were obtained, which may provide a novel direction for treatment and prognosis improvement of digestive cancers.
|
v2
|
2022-11-30T06:17:06.347Z
|
2022-11-29T00:00:00.000Z
|
254067858
|
s2ag/train
|
The spectrum of infections in patients with lung cancer.
Although diagnostic and therapeutic advances in Lung cancer (LC) have increased the survival of patients, infection and its complications are still among the most important causes of mortality. The disruption of tissue caused by tumor mass, management of cancer therapy and alteration in the humoral/cellular immune systems due to both cancer itself and therapy considerably increase susceptibility to infection in cancer patients. Particularly, opportunistic microorganisms should be considered, then applying rapid and sensitive diagnostic methods for them. Thus, cancer patients who are already exposed to difficult, long-term and expensive treatments can be prevented from dying from complications related to infections.
|
v2
|
2022-11-30T06:17:06.379Z
|
2022-11-29T00:00:00.000Z
|
254068401
|
s2orc/train
|
The prospect of genetically engineering natural killer cells for cancer immunotherapy
ABSTRACT The use of natural killer (NK) cells in cancer immunotherapy demonstrates promising potential, yet its efficacy is often limited due to the loss of tumor-killing capacity and lack of specificity in vivo. Here, we review current approaches to confer enhanced tumor-killing capacity and specificity by genetic engineering. Increasing sensitivity to cytokines and protecting NK cells from the immune checkpoint endowed sustainability of NK cells in the tumor microenvironment. Transducing chimeric antigen receptor (CAR) in NK cells successfully targeted both hematologic and solid tumors in preclinical models. The use of human pluripotent stem cells as an expandable and genetically amenable platform offers a stable source of engineered NK cells for cancer immunotherapy. We highlight that CAR-NK cells from human pluripotent stem cells are a promising approach for cancer immunotherapy.
Introduction
Natural killer (NK) cells are potent immune effectors in the innate arm that contribute significantly to eliminating tumors and viralinfected cells. They are classically defined as CD3-CD56+ cells and express an array of germline-encoded activating and inhibitory receptors. Activation and inhibitory signals of NK cells are tightly balanced to avoid unwanted destruction.
Activation receptors of NK cells can recognize stress-induced ligands. For example, human NKG2D on NK cells recognizes MHC I chain-related molecules A and B (MICA and MICB), which are aberrantly expressed in various types of tumors (Dhar and Wu, 2018). Meanwhile, inhibitory receptors on NK cells recognize 'selfligands'. MHC class I molecules (HLA-C/B/A/E) are expressed ubiquitously on healthy cells but are lost under stress or transformation. Many inhibitory receptors of NK cells [i.e. CD94/ NKG2A or killer-immunoglobulin receptors (KIRs)] engage with the MHC class I molecules (Vivier et al., 2008), sending out negative signals from sensing of a 'self-ligand'. NK cells are only activated when the equilibrium between activating and inhibitory receptors is disrupted, ensuring tolerance to a healthy 'self' while effectively targeting transformed cells. The current paradigm believes that the summative strength of signaling determines NK cell reactivity. Simply loss of MHC-I molecules does not always elicit activation (Bern et al., 2019) unless a sufficiently potent activating receptor is engaged (Cerwenka et al., 2001).
Upon activation, NK cells will exert their cytotoxic machinery, which predominately includes (1) expressing death receptor ligands to induce death receptor-mediated apoptosis; and (2) degranulation to secrete perforin and granzymes. Fas ligands (FasLs), a type of death receptor ligand, are upregulated in cytokine-primed human NK cells and induce apoptosis of Fas-expressing tumor cells independent of degranulation-mediated killing (Mori et al., 1997). The binding between Fas-FasL initiates the 'extrinsic pathway' of apoptosis. Subsequently, the intracellular relay of the death signal activates effector caspase-3 to digest numerous proteins (Thorburn, 2004), leading to the apoptosis of target cells. When engaged with target cells, NK cells undergo rapid degranulation, secreting poreforming perforins and pro-apoptotic effectors, such as granzymes (serine proteases), into immunological synapses (Voskoboinik et al., 2006), causing the death of proximal targets.
Aside from exerting their natural cytotoxicity, NK cells bridge innate and adaptive immunity. NK cells can produce proinflammatory cytokines (IFN-γ and TNF) and chemokines (CCL2, CCL3, CCL4, CCL5, CXCL8, and CXCL10) when stimulated with tumor cells expressing activating ligands (Fauriat et al., 2010), tilting their surroundings to a more hostile environment. In addition to the 'missing-self hypothesis' of NK cell activation, NK cells process antibody-dependent cellular cytotoxicity (ADCC). In other words, NK cells recognize antibody-opsonized target cells and become activated to exert their lytic mechanisms.
Immunotherapy emerges as a promising treatment for cancer patients. The essence of it is to reprogram and reactive the immune system in cancer patients to eliminate tumors, with approaches like blocking of the 'brake' on immune cell activation and administration of enhanced cell effectors. Immune effectors like cytotoxic T cells and NK cells are popular targets due to them being indigenously wired to tumor clearance. For example, anti-PD-1 therapy and anti-CTLA4 therapy blocks the deactivation interaction between cytotoxic T cells and tumor targets. However, some patients experienced relapses in response to anti-PD-1 antibody treatment via the loss of IFN-γ response and antigen presentation (Zaretsky et al., 2016). A genetic screening reveals that cancer cells with disrupted MHC-I or IFN-γ related genes are preferably killed by murine NK cells instead of cytotoxic T cells (Freeman et al., 2019). Administration of T cells modified with chimeric antigen receptors (CARs) promotes specific T-cell recognition of tumor antigens. CAR-T cells exhibit impressive clinical efficacy against refractory B cells but accompanied by safety concerns like cytokine release syndrome (CRS) and neurological events (Neelapu et al., 2017). Autologous CAR-T cells are safe with durable effects, but with technical difficulties and null 'off-the-shelf' potential (Locke et al., 2019). Adoptive transfer of NK cells between HLAmismatched donors and recipients is demonstrated to be free of CRS (Bachanova et al., 2018;Miller et al., 2005;Ruggeri et al., 2002;Shaffer et al., 2016). Without need for prior sensitization, NK cells could be effective in targeting cancer cells that evaded T-cell immunity and possess higher 'off-the-shelf' capacity. This Review will discuss the hurdles of NK cell immunotherapy, summarize the current trends in engineered NK cells for cancer therapy, and then discuss the prospects of integrating stem cell technology with engineering techniques.
The status quo of adoptive NK cell therapy Adoptive transfer of NK cells is a type of immunotherapy that follows this regimen: lymphodepletion by chemicals or radiation before the infusion of purified CD3−/CD56+ NK cells, followed by injection of immunostimulatory cytokines, commonly interleukin-2 (IL-2) and interleukin-15 (IL-15). The treatment is used against hematological malignancies (Bachanova et al., 2018) and solid tumors (Geller et al., 2011). Regardless of haploidentical or KIR-HLA mismatch, the treatment is safe with no signs of graft-versushost disease (GvHD), CRS and neurotoxicity in recipients (Bachanova et al., 2018;Miller et al., 2005;Ruggeri et al., 2002;Shaffer et al., 2016) (Table 1).
Poor in vivo persistence of infused NK cells is a bottleneck in adoptive NK cellular therapy (Nguyen et al., 2019;Shaffer et al., 2016). Following the mentioned regimen, allogenic haploidentical NK cells expand transiently post-infusion (between 7 and 14 days post-infusion), then gradually decline (Bachanova et al., 2018;Geller et al., 2011;Miller et al., 2005;Nguyen et al., 2019). Haploidentical NK cells level drops below 1% in peripheral blood (PB) 4 weeks after infusion in 61% of patients with acute myelogenous leukemia (AML) (Nguyen et al., 2019). The gradual drop in infused NK cells is hypothesized to be the action of regulatory T cells (Tregs) and myeloid-derived suppressor cells (MDSCs), hinted at by the negative correlation between NK cell proliferation and circulating Treg and MDSC levels (Bachanova et al., 2018), and the drop in circulating NK cell levels coinciding with the elevation in Tregs (Geller et al., 2011). The low in vivo persistence limits the clinical efficacy of the treatment and potentially accounts for the unaltered relapse incidence, event-free survival and overall survival, compared to those of the patient cohort receiving solely chemotherapy (Nguyen et al., 2019).
Administration of proinflammatory cytokines (either IL-2 or IL-15), which promotes the expansion of NK cells, is commonly employed to address the persistence issue, yet both are associated with toxicities. Infusing low doses of IL-2 in patients elevates the absolute number of CD56 bright NK cells by at least 7-fold (Fehniger et al., 2000). However, IL-2 promotes the in vivo expansion of CD4+CD25+Foxp3+ Tregs (Zorn et al., 2009), limiting the availability of circulating IL-2 for donor NK cells and potentially reducing NK cells persistence via Treg suppression. IL-15 expands and activates NK cells in vivo as well, proven by the 38-fold increase in circulating NK cells, and enhances the cytotoxic capacity of CD56 bright NK cells in patients receiving a continuous intravenous infusion of human recombinant IL-15 (Dubois et al., 2017). Of note, endogenous IL-15 production correlates with better clinical responses (Miller et al., 2005;Shaffer et al., 2016). Despite its effective impact on NK cells in vivo expansion, high doses of IL-2 (Klapper et al., 2008) or IL-15 cause morbidity and severe adverse events (grade 3 or 4), and the circulating NK cell number drops upon withdrawal of cytokine treatment , hence rendering cytokine injection a non-sustainable option.
Oxidative stress is another challenge for immune cells' functionality in the tumor microenvironment (TME). By definition, oxidative stress refers to the imbalance between reactive oxygen species (ROS) production and anti-ROS mechanisms, causing a net increase in ROS (Aboelella et al., 2021). ROS are constantly generated as a by-product of increased metabolic activity of cancer cells and activated immune cells like granulocytes, macrophages and MDSCs. The direct impact of oxidative stress on immune cells varies among cell types and is dependent on the ROS level, which is discussed extensively elsewhere (Aboelella et al., 2021). Here, we focus on evidence arguing the effect of ROS on NK cells to justify the need for therapeutic intervention. NK cells have long been found to be susceptible to oxidative stress. Exposure of NK cells to hydrogen peroxide (H 2 O 2 ), a type of ROS secreted by activated monocytes, downregulates surface CD16 expression and impairs the cytotoxicity of NK cells (Kono et al., 1996). Additionally, a high ROS level reduces NK cell infiltration into solid tumors. Infiltration of NK cells into tumor tissue of 29 non-small cell lung cancer (NSCLC) patients is significantly and negatively correlated with the frequency of NK cells with a high intracellular ROS level (Yang et al., 2020). Similarly, oxidative stress may be reversed by priming NK cells with IL-15. This can scavenge ROS via inducing the intracellular thioredoxin pathway and ectopic thiol expression, improving in vitro infiltration into the lung adenocarcinoma sphere (Yang et al., 2020). However, the resistance effect mediated by IL-15 also disappears once withdrawn. Instead of administrating cytokines systematically, there are more attempts at modifying NK cells themselves to enhance NK cell activity in a more controlled and localized manner. An urge to modify NK cell in vivo persistence and effector function leads to numerous genetic engineering projects. Here, we group some recent projects into two directions: non-specific enhancement of NK cell activity and confer of specificity to NK cells.
Non-specific functional enhancement
We define non-specific functional enhancement as genetic engineering that boosts NK cell function non-specifically, so it is applicable in scenarios against multiple types of cancers ( Fig. 1).
Increasing sensitivity to cytokines
Instead of continuously administering IL-15, an approach is to knock out the negative regulators of proinflammatory cytokine signaling. CISH encodes cytokine-inducible SH2-containing protein (CIS), which is a cytokine-inducible negative regulator of JAK/STAT signaling (Delconte et al., 2016). The JAK/STAT signaling activated by IL-15 in NK cells can induce cytotoxicity (Gotthardt et al., 2014). CIS is rapidly induced in murine NK cells from IL-15 treatment, and the induced CIS, in turn, inhibits JAK1 by targeting it for proteasomal degradation, building a classic negative-feedback loop (Delconte et al., 2016). A recent approach depletes CISH in human induced pluripotent stem cells (hiPSCs) using CRISPR/Cas9 technology and subsequently differentiates the modified iPSCs into CISH-knockout (CISH −/− ) iPSC-derived NK (iNK) cells, followed by expansion with artificial antigen-presenting (aAPC) feeder cells (Zhu et al., 2020a,b).
CISH −/− iNK cells expand and display in vitro short-term and long-term cytotoxicity, IFN-γ production and degranulation capacity against multiple tumor targets (K562, MOLM and SKOV3 cells) at IL-15-or IL-2-limiting conditions. MOLM-13 AML xenograft mouse models treated with CISH −/− iNK cells (n=5) have better tumor control, of which 3/5 achieved complete tumor clearance, with a higher survival rate (vs 0% of iNK; P<0.001) 120 days post-infusion. More importantly, the human NK cell level in PB 2 weeks after CISH −/− iNK treatment is higher than in the iNK group (38.2±4.3 vs 12.0±2.8 cells/µl; P<0.01). The knockout results in an elevated rate of glycolysis and oxidative phosphorylation compared to that in iNK and PB-NK cells, providing the basis for meeting the energy requirements of executing effector functions.
This approach successfully enhances NK cells' in vitro and in vivo anti-tumor activity, persistence and metabolic fitness by increasing the sensitivity to IL-15. Therefore, low-dose treatment of IL-15 can augment NK cell function comparably while avoiding the side effects associated with high-dose treatment . Despite the in vivo efficacy and persistence of CISH −/− iNK cells not being tested in an IL-2-limiting model, perturbation of a single gene provides a promising solution to both persistence and effector limitations.
Protecting NK cells from immune checkpoint regulation CD16 (FCγRIII) is an extracellular receptor that binds to the Fc portion of IgG1 and IgG3 antibodies (Nimmerjahn and Ravetch, 2008), and the isoform, CD16A, is expressed in mature NK cells to induce ADCC activity. It is a potent activating receptor of NK cells, yet stimulating it with antibodies again reduces the amount of released perforin from stimulated NK cells (Srpan et al., 2018). CD16A surface expression is downmodulated when NK cells are activated in vitro by various means (Lajoie et al., 2014) and observed on NK cells isolated from patients with ovarian carcinoma as well (Lai et al., 1996). This phenomenon is caused by the shedding of CD16A ectodomain, mediated by a disintegrin and metalloprotease-17 (ADAM17) (Romee et al., 2013) and membrane-type 6 matrix metalloproteinase (MTP-MMP) (Peruzzi et al., 2013). ADAM17 is expressed constitutively on the NK cell membrane (Lajoie et al., 2014), rapidly cleaving CD16A in a cis manner. Recovery of CD16 requires 1 or 2 weeks (Goodier et al., 2016). Shedding of CD16A on NK cells limits its ADCC capacity, therefore, representing an immune checkpoint to limit the antitumor efficiency.
Engineering hiPSC-derived NK cells to constitutively express a high-affinity and non-cleavable form of CD16A (Zhu et al., 2020a, b), with a similar NK cell generation protocol described earlier, solves the challenge. The modified form of CD16A consists of two mutations: a 158V mutation inspired by a natural allelic variant (Koene et al., 1997) that accounts for higher affinity to IgG; and an S197P mutation accounting for its cleavage resistance against ADAM17 (Jing et al., 2015). These modified NK cells are termed hnCD16-iNK. induced pluripotent stem cell-derived natural killer (iNK) cells knock out CIS, so its intrinsic inhibition of IL-15 signaling is removed. When IL-15 is transpresented by neighboring cells and binds to NK cells' indigenous γc/IL-15Rβ receptors, CISH −/− iNK cells respond with higher sensitivity. hnCD16-iNK introduces an artificial high-affinity and cleavage-resistant CD16A to strengthen the antibody-dependent cellular cytotoxicity (ADCC) capacity of NK cells. iADAPT NK cells inherit the high-affinity, cleavage-resistant CD16A, and include two additional modifications, IL-15-IL-15Rα fusion protein (IL-15RF) and CD38 knockout.
hnCD16-iNK cells alone exhibit minimal NK cell activation and cytotoxicity, but the combination treatment of hnCD16-iNK cells and therapeutic monoclonal antibody (mab) shows higher cytotoxicity against multiple tumors (Raji, SKOV-3, Cal 27) (Zhu et al., 2020b). The in vivo ADCC of hnCD16-iNK is proven in xenograft models against human B-cell lymphoma, systemic lymphoma (Raji cells) and even solid ovarian carcinoma (SKOV3 cells) (Zhu et al., 2020b). Infusing mab with hnCD16-iNK cells declines tumor burden to a larger extent than sole antibody or hnCD16-iNK treatment, and mediates the long-term survival of a SKOV3 xenograft model (150 days post-transplant; vs anti-HER2, P=0.004) (Zhu et al., 2020b). However, the circulating NK cell population with single-dose treatment reduces to baseline 20 days post-infusion. Tumor regression caused by the combination treatment does not persist after 10 days, and the tumor burden at day 25 is indeed comparable with that of other groups (co-administration of iNK/PB-NK with anti-CD20 mab) (Zhu et al., 2020b).
Interestingly, this 'proof-of-principle' test of combining engineered NK cells and therapeutic monoclonal antibodies demonstrates a more holistic reprogramming approach. hnCD16-iNK has superior in vitro and in vivo ADCC than PB-NK or unmodified iNK (Zhu et al., 2020b). Flexibility to target multiple tumors can be achieved via administration of corresponding therapeutic antibodies, hence potentially tackling the more immunosuppressive solid tumors, as suggested by in vitro and in vivo superior ADCC against SKOV-3, ovarian adenocarcinoma (Zhu et al., 2020b). Meanwhile, crude selectivity can be achieved with the corresponding therapeutic mab (Zhu et al., 2020b). The shortcoming is that a single dose of infusion provides transient control. Genetic engineering overcomes an immune checkpoint of NK cells and equips them with more effective anti-tumor capacity, but this is not enough.
Triple-gene modifications mimic adaptive NK cells
Continuing the prior genetic engineering project, three genetic modifications on iNK cells produce a version of enhanced NK cells named iADAPT NK cells (Woan et al., 2021), which harness several attributes resembling adaptive NK cells, including a long half-life and being elite in ADCC and IFN-γ production (Stary and Stary, 2020). These genetic modifications equip iNK cells with a highaffinity, non-cleavable CD16A as a continuation of the previous attempt, a membrane-bound IL-15 fused with IL-15 receptor α subunit (IL-15RF), and CD38 knockout. The membrane-bound IL-15RF creates a cis version of trans-presentation of IL-15, a phenomenon describing the stimulation of IL-15 signaling from a complex constitutive of IL-15 and IL-15 high-affinity binding proteins (i.e. IL-15Rα) formed intracellularly (Anderson et al., 1995;Stonier and Schluns, 2010). IL-15 and IL-2 bind to a shared β/γC subunit in their receptor complex, but it can induce a distinct response due to the trans-presentation effect (Waldmann, 2006). Trans-presentation is more prevalent as IL-15 is rarely produced by NK cells themselves, despite NK cells expressing IL-15Rα transcripts (Rosmaraki et al., 2001). The effect of this complex binding to the β/γC receptor complex expressed on NK cells is more potent than that of soluble IL-15 (Huntington et al., 2009). Knocking in the construct allows NK cells to cis present IL-15Rα/IL-15 to the β/γC receptor complex. Hence, when compared to the systemic administration of IL-15, it enhances NK cells' persistence with more localized and potent regulation of IL-15 signaling.
CD38 knockout is a novel take on modifying stem cell-derived NK cells to be more similar to adaptive NK cells. CD38 is an ectoenzyme that exerts both NADase and ADP-ribosyl cyclase activity, which is an important regulator of NAD+ levels to control various metabolic activities (Malavasi et al., 2008). Recently, CD38 was found to be enriched in a dysfunctional CD8+ T-cell subset, which failed to generate memory or display effector functions like IFN-γ production in two independent scenarios (Katsuyama et al., 2020;Verma et al., 2019), while CD38 knockdown enables dysfunctional T cells to regain their effector capability (Verma et al., 2019). As adaptive NK cells share some common epigenetic and transcriptional features with CD8+ T cells (Lau et al., 2018), the group hypothesized that CD38 knockout augments NK cell resistance to suppressive TME.
With triple-gene modifications, this approach generates iADAPT NK cells with superior in vivo persistence, in vitro and in vivo ADCC, and in vitro resistance to exhaustion in the absence of exogenous cytokines. This is particularly compatible with the combination treatment of daratumumab against leukemia, as the daratumumab can be selective to CD38 expressed on myeloma cells. Although the killing activity is primarily accessed in leukemia, the retained innateness and enhanced persistence can theoretically effectively eliminate tumors of choice in cytokine-limiting conditions. The cytokine autonomy conferred by IL-15RF is genuinely a breakthrough to overcoming the hurdle of hnCD16 iNK, evading the adverse events associated with IL-2 (Klapper et al., 2008) or IL-15 dosing.
Altogether, the three applications we dichromatically classified as non-specific functional enhancements -CISH −/− iNK cells, hnCD16-iNK cells and iADAPT NK cellsprove how genetic modifications equip NK cells with versatile anti-tumor capability against multiple tumors. These genetic modifications either enhance persistence, enhance effector functions or achieve both through different paths. More considerations have been taken in complying adoptive transfer of modified NK cells with existing treatment, i.e. with therapeutic antibodies, to represent a more holistic immunotherapeutic approach against cancers.
Conferring specificity
Another major area of interest to genetically modified NK cells is to confer specificity towards a single target, mainly through the addition of a CAR construct (Fig. 2). Despite the proven safety to transfer HLA-mismatched NK cells (Bachanova et al., 2018;Miller et al., 2005;Ruggeri et al., 2002;Shaffer et al., 2016), theoretically, off-target killing is possible due to their innate cytotoxicity. In addition, NK cell effector functions are hindered in the immunosuppressive TME. To kill two birds with one stone, the endowment of a CAR confers specificity and activates NK cells continuously in the presence of an assigned target.
The general design of a CAR consists of three modules: an extracellular antigen-recognition receptor, a transmembrane linker and an intracellular activation domain. The extracellular construct usually comprises a single-chain variable fragment (scFv) that binds to a specific epitope, recognizing a predefined target. The transmembrane domain connects the two modules spatially. The intracellular part of this artificial construct includes signaling domains and co-stimulatory domains to initiate activation pathways.
The generation of an NK cell-specific CAR construct is described in the trial of mesothelin-specific CAR-NK cells from iPSCs . The extracellular domain part remains to be an scFv, but the transmembrane domain and co-stimulatory domains are adapted from NK cell-activating receptors, including NKG2D, CD16, DAP10 (co-stimulatory domain of NKG2D), 4-1BB and 2B4 [both are co-stimulatory receptors with intra-cytoplasmic immunoreceptor tyrosine-based activation motifs (ITAMs)] (Yoon et al., 2015), and a CD3ζ domain shared by T cells' CD3 and NK cells' CD16.
Improving CAR-NK with cytokine transgenes
To overcome the persistence limitation of adoptively transferred NK cells, one approach is to combine a CAR with the IL-15 transgene. As mentioned before, injection of IL-15 promotes in vivo expansion of NK cells, but it poses an immense financial burden to patients. If we require the cytokine anyway, why not just fuse the transgene with the CAR construct, allowing NK cells to persist without exogenous cytokines?
The fusing of the IL-15 transgene downstream of the CAR construct is proven to be effective against various types of tumors. Recent work on fusing CD123-specific CAR-NK with the IL-15 transgene against hematological malignancies activates NK cells, yet is associated with systemic toxicities (Christodoulou et al., 2021). Human primary NK cells from three independent donors are expanded with feeder cells, then transduced with a retroviral vector of CD123-CAR/2B4/CD3ζ and a downstream internal ribosome entry site (IRES) fused with human IL-15 transgene, allowing coexpression of IL-15 and CAR construct under the constitutive promoter.
The 2B4/CD3ζ/soluble interleukin-15 (sIL-15) CAR-NK cells show comparable tumor control against CD123+ MV-4-11 cells in vivo to 2B4/CD3ζ CAR-NK while displaying an exponential increase in the circulating cell count (35 days; n=5-7). However, the expansion advantage of 2B4/CD3ζ/sIL-15 CAR-NK cells does not translate into enhanced survival. The cohorts receiving either sIL-15-NK cells (complete death around day 23 post-infusion) or 2B4/ CD3ζ/sIL-15 CAR-NK cells (complete death around day 35 postinfusion) have a shorter survival time. Although constitutive IL-15 expression in CAR-NK can enhance effector phenotypes, as would have been expected from clinical benefits observed from the injection of IL-15 (Dubois et al., 2017), the lethality observed in mice urges for more stringent control of transgene expression.
In this regard, here we present some examples of how to control cytokine expression temporally in CAR-NK cells. Liu et al. (2018) reported the transduction of an inducible caspase 9-based (iC9) suicide gene into CD19-CAR/IL-15-expressing NK cells isolated from cord blood (iC9/CAR.19/IL-15 CB-NK). IL-15 production increaseds significantly when challenged with CD19+ chronic lymphocytic leukemia (CLL) targets with minimal secretion in the absence of CD19+ targets. Administration of dimerizer (AP1903) in vivo successfully triggers the suicide response to reduce CAR-expressing NK cells in PB (98%→11%) and tissues within 3 days. This druginducible regulation avoids the adverse outcomes associated with cytokine expression, but the premature termination of transferred NK cell activity limits the persistence advantages.
A more optimal control strategy is the use of an inducible promoter to regulate cytokine expression. A recent 'proof-of-principle' work focused on transducing NK-92 and primary NK cells with a vector containing constitutively expressed disialoganglioside GD2-specific CAR and inducible human IL-12 (hIL-12) regulated by NFκB (iIL-12/ GD2.CAR-NK cells) (Rudek et al., 2021). NFκB is a signaling molecule expressed in activated NK cells (Goodier et al., 2016). With this design, CAR-mediated antigen recognition and activation trigger the endogenous activation signaling cascades, subsequently upregulating NFκB, leading to hIL-12 transgene expression. In other words, hIL-12 is only produced when CAR-specific antigens are presented. Coherent with the theory, no hIL-12 is produced when iIL-12/GD2.CAR-NK cells are at rest or co-cultured with GD2-lacking target (HT1080), but significantly secreted when co-cultured with GD2+ targets, GD2+ HT1080, SH-SY5Y and patient-derived glioblastoma. Upon target stimulation, IFN-γ and IL-2 production are significantly enhanced in iIL-12/GD2.CAR-NK cells, which is in line with the function of IL-12 (Zhang et al., 2008). The iIL-12/ GD2.CAR-NK cells are not tested in vivo, so we cannot conclude whether this design improves the in vivo persistence of CAR-NK cells. Yet, with the modular nature of this design, we can foresee the replacement of hIL-12 transgenes with other cytokines like IL-15 to produce CAR-NK cells with inducible cytokine production.
Spatial regulation may be achieved via membrane-bound cytokine expression. NK cells express the high-affinity IL-15-binding protein IL-15Rα (Rosmaraki et al., 2001). Theoretically, the engineered membrane-bound IL-15 can trans-or cis-present to itself or surrounding CAR-NK cells, achieving a localized enhancement of persistence of infused products. CD19-CAR-NK cells with ectopic IL-15 expression and iC9 suicide gene have gained clinical success against CD19+ lymphoma, with 7/11 recipients demonstrating complete remission, and proven safety, whereby none of the recipients developed symptoms of CRS, GvHD and neurotoxicity. CAR-NK cells are also detectable 12 months after infusion (Liu et al., 2020). Another ongoing phase 1 clinical trial using NKX019, a CD19-targeting CAR-NK with membrane-bound IL-15 (NCT05020678), which is expected to end in July 2023, further informs about the persistence and safety of this approach.
The fusing of a cytokine transgene downstream of the CAR construct represents a feasible strategy to overcome the bottleneck observed in previous CAR-NK trials. Constitutive expression of cytokines causes lethality, despite its evident benefits. Thus, extra control mechanisms are anticipated, such as the incorporation of a suicide gene, utilization of an inducible promoter, or fusion with a membrane-bound form to spatially and temporally regulate the balance between anti-tumor effects and safety.
CAR-NK cells with resistance against oxidative stress
Another bottleneck that hinders the in vivo anti-tumor efficacy of infused NK products is the high oxidative stress in the TME. To combat the oxidative stress in the breast cancer microenvironment, primary NK cells and NK92 cells are genetically modified into PD-L1-CAR-NK cells overexpressing PRDX1 via a lentiviral transduction system (Klopotowska et al., 2021). As mentioned before, priming NK cells with IL-15 mediates transient resistance to oxidative stress in the TME (Yang et al., 2020). PRDX1 encodes an antioxidant peroxidase that reduces H 2 O 2 to water and alcohol and is significantly upregulated in IL-15-primed NK cells transcriptionally and translationally (Klopotowska et al., 2021). Under H 2 O 2 -mediated oxidative stress, the PD-L1-CAR-NK cells demonstrate impaired killing activity against triple-negative breast cancer MDA-MB-231 cells, which was rescued with PRDX1 overexpression in PD-L1-CAR-NK cells, equipping CAR-NK cells with resistance against H 2 O 2 -mediated oxidative stress in IL-15independent settings.
Recent genetic engineering projects enhance NK cells' functionality by enhancing them non-specifically, with or without conferring capability to target a specific antigen. Non-specific effector enhancement further manifests the 'off-the-shelf' capacity. Following this direction, not only NK cell immunotherapy is applicable in HLA-mismatched donors and recipients, but also applicable in multiple types of tumors. In some trials, specific activation of NK cells can be conferred with exogenous aid, i.e. monoclonal antibodies, but itself will not show specificity. Therefore, off-target killing may be a concern in clinical settings.
Regarding conferring specificity to NK cells by the endowment of CAR construct, precision is emphasized, so NK cells are often only effective against tumors bearing predefined antigens. The modular nature of CAR does permit flexibility to target multiple tumors, but it remains technically troublesome to tailor-make CAR-NK cells and identify antigens with the best clinical outcomes. No matter which approaches, the major goal of genetic engineering is resolving bottlenecks encountered in clinical trials of adoptive NK cell therapy. One prominent direction is to exploit the benefits of IL-15 administration to resolve the persistence and oxidative stress limitations while stressing cytokine independence. Thus, clinical application of these genetically modified NK cells can evade the adverse events associated with high-dose IL-15 administration and improve recipients' burden on continuous cytokine injections.
The prospect of integrating stem cell technology
The ideal source of NK cells for genetic engineering projects is vital to optimizing clinical practices, yet each source has its pros and cons (Fig. 3). Human NK cells isolated from donated PB or cord blood, commercial human NK cell lines (NK-92 cells or their derivatives) and pluripotent stem-cell-derived NK cells are satisfactorily effective allogenic sources. Here, we compare and contrast the three sources to discuss how stem cell-derived NK cells outcompete others to produce clinically graded genetically engineered NK cells.
Human NK cells can be isolated from donated PB and cord blood with a rapid large-scale automated method, mostly by two-step magnetic-activated cell sorting (MACS) of CD3-CD56+ cells from the mononuclear cell product by leukapheresis (Iyengar et al., 2003). The obtained NK cells can be further expanded with feeder cells (Christodoulou et al., 2021). The infusion of human primary NK cells is safe and a very popular source for the adoptive transfer of NK cells in clinical trials (Bachanova et al., 2018;Miller et al., 2005;Ruggeri et al., 2002;Shaffer et al., 2016). Yet, the use of PB competes with other medical usages of blood.
NK92 cells are commercially available permanent human NK cell lines isolated from large granular lymphocytes (LGLs) with the phenotype of CD56 bright , CD45+ and CD3− (Gong et al., 1994). Culturing of this cell line is dependent on IL-2, so there are some engineered IL-2-dependent NK92 cell lines, such as NK92mi cell lines (ATCC). It is very effective against K562 cells and Daudi cells (Gong et al., 1994) and was proven to be free from grade III or IV toxicities in clinical trials (Tang et al., 2018;Williams et al., 2017). The winning edge of this source is how readily available it is. NK92 cells are commercially available 'off-the-shelf' products to meet multi-dosing needs. Their unlimited replicative potential renders them more compatible with the retroviral transduction system (Xu et al., 2019). However, the NK-92 cells are irradiated before infusion to limit their replicative potential, so they can only persist at most for 1 week in vivo (Tang et al., 2018).
Pluripotent stem cells are characterized by the ability to selfrenew and differentiate to all types of cells, apart from cells in extraembryonic lineages. To use stem cell-derived genetically engineered NK cells, pluripotent stem cells are engineered via the method of choice, including, but not limited to, lentivirus transduction and CRISPR/Cas9 technology, to incorporate the transgene and selectable markers. Again, their unlimited replicative potential permits the use of the retroviral transduction system. The stem cells bearing the transgene are selected out with the addition of selective agents in medium or sequencing. Then, the stem cells dissociated to a single-cell level will differentiate into NK cells, following an established protocol (Zhu and Kaufman, 2019), and expand with feeder cells (Denman et al., 2012;Zhu et al., 2020a,b).
The ability to produce highly homogenous NK cell products from engineered pluripotent stem cells is a major advantage over terminally differentiated sources of NK cells. The resulting products are highly homogeneous in terms of surface receptor expression (Zhu and Kaufman, 2019) and the introduced genetic modifications, as they are derived from the same stem cell clone. Meanwhile, blood-derived NK cells have their intra-and inter-individual diverse arrays of germlineencoded activating and inhibitory receptors. Although genetically modified cells can be selected, the variance among different batches will be considerably large (Christodoulou et al., 2021), rendering repeat dosing unreproducible. NK92 cells are deficient in some key activating receptors, so they are less effective than stem cell-derived NK cells. For instance, NK92 cells lack CD16 expression (Gong et al., 1994;Srpan et al., 2018), which affects the ADCC mechanism of NK cells. On the other hand, stem cell-derived NK cells express many activating receptors, such as NKG2D, NKp46, NKp44, FasL and CD16 (Zhu et al., 2020a,b). The homogeneous presence of NK cell receptors allows stem cell-derived NK cells to be ideal for clinical usage.
A limitation of stem cell-derived NK cells is their timeconsuming production, which is detrimental in patients in need of an immediate cure. Following the production protocol, making NK cells from pluripotent stem cells takes 4 weeks, with an additional 2 weeks for expansion (Zhu and Kaufman, 2019). The dosage of cells/kg body weight recorded in some human trials of adoptive transfer of non-genetically manipulated primary NK cells ranges from 0.5×10 6 to 2×10 7 , which can be collected within 1 day (Bachanova et al., 2018;Geller et al., 2011;Miller et al., 2005;Nguyen et al., 2019;Ruggeri et al., 2002;Shaffer et al., 2016). Following this differentiation protocol (Zhu and Kaufman, 2019), they can generate 2-20×10 6 NK cells from one six-well plate. The ex vivo expansion by stimulating differentiated NK cells with membrane-bound IL-21-experessing irradiated K562 cells under the continuous supply of IL-2 sustains NK cell viability without telomere shortening for over 3 months (Denman et al., 2012;Zhu and Kaufman, 2019). Alternatives to feeder cells are irradiated K562 cells that express membrane-bound IL-21 and 4-1BBL (Zhu et al., 2020a,b), or membrane-bound IL-15 and 4-1BBL (Lapteva et al., 2012), and the latter have been proven to produce primary NK cells from PB mononuclear cells with good manufacturing practice (Lapteva et al., 2012). Additionally, the stem cell-derived NK cells retain their anti-tumor capability after cryopreservation (Woan et al., 2021;Zhu et al., 2020a,b). The expansion is thus highly desired for reducing the cost and enabling multi-dosing strategy, although fails to meet urgent needs like using primary NK cells.
NK cells collected from blood, pluripotent stem cell differentiation or NK92 cells undergo different degrees of genetic manipulation to enhance tumor response. The ideal gene delivery method has to be safe and efficient. Retroviral transduction is often used to introduce CAR constructs into expanding primary NK cells (Christodoulou et al., 2021;Liu et al., 2018;Rudek et al., 2021) and NK-92 cells (Klopotowska et al., 2021;Rudek et al., 2021). Being capable to infect both non-dividing and dividing cells (Naldini et al., 1996), lentivirus can also be employed to deliver PD-L1 CAR constructs into NK92 cells (Klopotowska et al., 2021), and highaffinity, cleavage-resistant CD16 sequences into iPSC-derived NK cells and primary NK cells (Zhu et al., 2020a,b). The feature of lentiviral and retroviral transduction is that they can integrate transgenes into the genome, achieving stable expression of exogenous constructs. However, the efficiency to transduce primary NK cells is generally low with retroviruses (Xie et al., 2020), i.e. the transduction efficiency with alpharetroviral vector into primary NK cells is around 30% (Rudek et al., 2021), and the random insertion of transgene potentiates harmful mutations (Xie Fig. 3. Comparison between common sources of NK cells. '√' represents advantage for genetic engineering; '×' represents limitation. The steps to prepare the NK cells for genetic engineering and infusion are listed. Biology Open (2022) 11, bio059396. doi:10.1242/bio.059396 et al., 2020. Therefore, non-viral alternatives are appealing to deliver the foreign construct. Electroporation is preferable to transduction due to its high efficiency and compatibility with most cell types (Potter, 2003). Despite the expression being transient, stable expression of the exogenous construct is viable by integrating the sequence into a specific location of the genome via homologous repair. For example, the CRISPR/Cas9 construct is delivered into iPSC-derived cells by electroporation-based nucleofection to perform a triple-genetic modification (Woan et al., 2021). The sequence of the donor plasmid for membranebound IL-15RF and hnCD16 was inserted into the genome with CRISPR/Cas9-mediated target insertion.
Conclusion
Adoptive transfer of NK cells is a safe immunotherapeutic treatment against cancer, yet its effectiveness is limited by poor in vivo persistence and oxidative stress in the TME. Genetic engineering of NK cells enhances their persistence and lytic activity. We identified two major areas for genetic engineering, the non-specific enhancement of NK cell functionality and the endowment of specificity to NK cells. The prior is applicable against multiple types of tumors, while the latter allows NK cells to be extremely 'ontarget'. Both areas aim to exploit the benefits observed from the systemic administration of IL-15, making cytokine-autonomous cellular products to evade the adverse events associated with highdose IL-15 treatment. The source of NK cells is diverse, but stem cell-derived NK cells are highly compatible with genetic engineering projects, due to their high homogeneity. Many of the reviewed trials are 'proof-of-principle' tests that demonstrate effective anti-tumor activity in mouse models. Future phase I clinical trials can investigate the safety of the genetically modified NK cells.
|
v2
|
2022-11-30T06:17:06.785Z
|
2022-11-29T00:00:00.000Z
|
254067867
|
s2orc/train
|
Health-related quality of life and estimation of the minimally important difference in the Functional Assessment of Cancer Therapy-Endocrine Symptom score in postmenopausal ER+/HER2- metastatic breast cancer with low sensitivity to endocrine therapy
Background The HORSE-BC study previously demonstrated that second-line endocrine therapy (ET) for patients with acquired endocrine-resistant metastatic breast cancer (MBC) still provided a clinically meaningful benefit. Herein, we investigated the health-related quality of life (HRQOL) in the HORSE-BC study. Methods Patients with acquired endocrine-resistant MBC who were scheduled for second-line ET were recruited. The HRQOL was assessed at baseline, and 1 and 3 months after second-line ET initiation. To investigate the minimally important difference (MID) in the Functional Assessment of Cancer Therapy-Endocrine Symptoms (FACT-ES), we evaluated the means and standard deviations for the distribution-based method, and differences in the change in HRQOL for the anchor-based method. We also investigated the association between FACT-ES total scores and clinical benefit. Results Overall, 56 patients were enrolled. Of these, 47 were analyzed. When defined as 1/3 standard deviation estimates based on the distribution method, the calculated MID was 5.9. The MIDs of the FACT-ES total scores based on the anchor method were 7.7 for decline and 4.1 for improvement. The MID decline proportions were 6.1% and 14.7% lower in patients who experienced clinical benefits than in those who did not at 1 and 3 months, respectively. The ratios of MID improvement in patients who experienced clinical benefits were 18.3% and 3.2% higher, respectively; the mean change in the FACT-ES total score from baseline improved in patients who experienced clinical benefits. Conclusions Maintaining the HRQOL as determined by FACT-ES may be associated with clinical benefits in patients with acquired endocrine-resistant MBC treated with ET.
(1) A clinical benefit rate of at least 30% can be expected for the latest endocrine therapeutic medicines for breast cancer with low sensitivity to the primary endocrine therapy.
(2) The effect of the secondary endocrine therapy can be predicted, because responsiveness to previous treatment and the biological characteristics of a given tumor influence the therapeutic effect of the secondary endocrine therapy on breast cancer with low sensitivity to the primary endocrine therapy. 2 Implementation structure of the study This study will be conducted as a research support project of the General Incorporated Association of Comprehensive Support Project for Oncological Research of Breast Cancer (hereinafter referred to as "CSPOR-BC").
An executive committee has been established to implement this study. In addition, a steering committee, study review committee, independent data monitoring committee, and data management committee have been organized by the General Incorporated Association of CSPOR-BC to conduct review of the study protocol, examination and decision of study policies, and management and supervision of the study operation of this research organization. • Reporting of the implementation status of the study to the Steering Committee.
• Matters required for the management and assurance of the quality of the study.
• Evaluation of the quality of facilities participating in the study.
• Support of the Data Center for data management.
• Support of the statisticians for statistical analyses.
• Preparation of reports.
• Other matters important for the smooth and effective implementation of the study. • Development of the budget to implement the program and report of the account settlement to the Foundation.
• Establishment, improvement, and elimination of subcommittees to implement the program, and appointment of subcommittee members.
• Supervision of the activities of the subcommittees.
• Other matters required to implement the objectives of this program. • Appointment of executive committee members of each clinical trial and accompanying study.
CSPOR-BC Study Review Committee
• Supervision of the implementation of clinical trials and accompanying studies.
• Approval of oral presentations and publications related to clinical trials and accompanying studies.
• Matters required for the smooth implementation of clinical trials and accompanying studies of other programs, and coordination among studies. Note 1: The envisioned size of T is the maximum diameter of infiltration of the primary tumor and is holistically determined by visual inspection, palpation, and imaging. When the tumor contains high levels of intraductal components and there is a large difference between the diameter of infiltration obtained by palpation and that obtained by imaging, the result obtained by imaging will be prioritized. When many tumors are present in the mammary gland, the size will be evaluated using the largest T.
Note 2: The chest wall means the rib, intercostal muscle, and serratus anterior muscle, and does not include the pectoral muscle.
Note 3: The location of the primary tumor cannot be confirmed by visual inspection, palpation, and imaging.
Note 4: Cases with abnormal nipple discharge and cases with calcification observed by mammography are not classified as T0, and the determination of these cases will be suspended. These cases will be definitively classified into Tis, T1mic, or others by final pathological diagnosis.
Note 6: Usually the term inflammatory breast cancer is used to describe a condition that shows no mass but diffuse redness, edema, and induration of the skin. Local redness and edema occurring together with detectable growth(s) and progress of mass is not included in this category. T0 T1 T2 T3 T4 M0 N0 I IIA IIB IIIB N1 IIA IIA IIB IIIA IIIB N2 IIIA IIIA IIIA IIIA IIIB N3 IIIC IIIC IIIC IIIC IIIC M1 IV IV IV IV Expression of estrogen receptor α (ERα) is evaluated by an immunohistochemical (IHC) method.
Evaluation will be conducted at each facility, and ER positivity will be determined based on the following criteria in this study.
J-score classification: A tissue area of ER-staining-positive cells of 1% or higher is determined as positive. The Allred score classification is calculated by conversion of the proportion score.
(2) Expression of progesterone receptor (PgR) Expression of progesterone receptor (PgR) is evaluated by an IHC method. Evaluation will be conducted at each facility, and PgR positivity will be determined based on the following criteria in this study.
J-score classification: A tissue area of PgR-staining-positive cells of 1% or higher is determined as positive. The Allred score classification is calculated by conversion of the proportion score.
Response evaluation
The tumor reduction effect will be evaluated in cases that have lesions measurable by RECIST guidelines (version 1.1) to calculate the response rate. The rate of subjects for whom the best overall response is complete response (CR) or partial response (PR), is defined as the response rate 3) .
(1) Definition of measurable lesion Lesions that correspond to at least 1 of the following terms are referred to as "measurable lesions".
1) Lesions other than lymph node lesion (non lymph node lesions) that satisfy at least one of the following criteria: ① The maximum diameter observed by CT using a slice thickness of ≤ 5 mm is ≥ 10 mm.
② The maximum diameter observed by CT using a slice thickness of > 5 mm is at least 2 times thicker than the slice thickness.
④ Cystic metastasis lesions satisfying ① or ② when there are no other measurable non-cystic lesions.
2) Lymph node lesions with a short diameter of ≥ 15 mm observed by CT using a slice thickness of ≤ 5 mm. Lymph node lesions with a short diameter of ≥ 10 mm and < 15 mm are non-measurable lesions, and lymph node lesions with a short diameter of < 10 mm are not lesions.
3) The maximum diameter observed by chest simple radiographic imaging is ≥ 20 mm, and the lesion is surrounded by lung tissue (i.e., the lesion has no contact with the mediastinum or chest wall). 4) Superficial lesions with a maximum diameter of ≥ 10 mm or more that can be photographed in color with a measuring ruler (cutaneous metastasis, etc.).
All lesions that do not satisfy the above terms will be referred to as "non-measurable lesions".
The following lesions, etc. are referred to "non-measurable lesions" regardless of the test methods used and the size of the lesions: • Bone lesions (except for osteolytic lesions with a measurable soft tissue component).
• Lesions with a history of local treatment such as radiotherapy.
• Palpable abdominal tumors and abdominal organ enlargement that cannot be confirmed by imaging.
(2) Selection of target lesion and baseline evaluation Of the measurable lesions observed at the registration of this study (baseline), the top 5 largest lesions in diameter (the long diameter for non-lymph node lesions and the short diameter for lymph node lesions) will be selected as target lesions, with at most 2 lesions selected from each organ. The lesions will be selected with the consideration that the selected lesions should be present in organs with measurable lesions spread evenly as much as possible and should show good reproducibility of measurement on repeated examination (i.e., ease of measurement). The site, testing method, date of test, long diameter of non-lymph node lesions, short diameter of lymph node lesions, and sum of the long and short diameters of the selected target lesions will be recorded in the order of cranial to caudal localization. (
3) Selection of non-target lesions and baseline evaluation
For all lesions that are not selected as target lesions, the site, testing method, and date of test will be recorded as "non-target lesions" regardless of whether the lesions are measurable or not. When a number of similar lesions are observed in the same region of the same organ, such lesions may be recorded as a single non-target lesion.
(4) Determination of tumor reduction effect
Therapeutic response evaluation will be conducted at the discretions of primary physicians because this study is observational in nature. However, exacerbation of the condition may be observed in the early period after the initiation of the treatment because the study is on breast cancer with low sensitivity to endocrine therapy. Response evaluations will be conducted at about 3 and 6 months to ensure the safety of research subjects and avoid missing the optimum timing for determining treatment policy.
Evaluation of target and non-target lesions will be conducted using the same test methods as those used before registration, including the same photographing conditions such as contrast agent and slice thickness to measure the major axis of the target lesion (the short diameter for lymph node) and to record the disappearance of non-target lesions, the presence or absence of progression, and the presence or absence of new lesions. When a sum of diameters of a target lesion becomes at least 20% larger than the smallest sum of diameters measured previously and the absolute value of the sum of diameters increases by at least 5 mm (including the incidence of new lesions).
NE (Not evaluable)
When tests cannot be done for any reason or when a lesion cannot be determined to be any of CR, PR, PD, or SD.
Reduction rate of the longest sum of diameters = (sum of diameters before treatment -sum of diameters at evaluation) / (sum of diameters before treatment) × 100% Increase rate of the longest sum of diameters = (sum of diameters at evaluation -the smallest sum of diameters) / (the smallest sum of diameters) × 100% • Actual measurement values of the diameters of target lesions will be recorded as long as they are measurable (for example, even < 5 mm). However, when the diameter of a target lesion is determined as "non-measurable because it is too small", the diameter of the lesion will be recorded as 0 mm if it is determined that none of the tumor lesion remains, or as 5 mm if it is determined that some tumor lesion remains regardless of the slice thickness used for CT.
• When the reduction rate satisfies the condition for PR and the increase rate satisfies the condition for PD at the same time, the lesion will be considered to be PD.
• When lesions separate from a single lesion during treatment, these lesions will be added to each sum of diameters.
• When > 1 lesion fuses together and their boundaries become identifiable during treatment, the diameter of the fused lesion will be added to the sum of diameters. If the boundaries of the lesions are identifiable, the diameter of each lesion will be added to the sum of diameters even if the lesions share a margin.
Obvious progression
• Cases with non-measurable lesions will be considered to show "obvious progression" when it is determined that the benefits of discontinuing the treatment are greater than those of continuing the treatment because of a notable exacerbation of non-target lesions, even if the target lesions are PR or SD.
• In cases with only non-measurable lesions, for example, when lesion volume is used as a guide, an increase in the volume of non-measurable lesions of 73% will be considered to be "obvious progression".
Incidence of new lesion(s)
• When a lesion that did not exist at baseline is observed after the initiation of treatment, this will be considered a "new lesion". However, it is also necessary to confirm that the "new lesion" is not observed due to a difference in the scan method or imaging modality compared with that used for baseline evaluation or a clinical condition other than a tumor. For example, a cystic lesion occurring in a focus caused by necrosis of liver metastasis will not be considered to be a "new lesion". Lesions that are newly found on examination of regions that were not regarded to be essential for examination at baseline will be considered to be new lesions.When a lesion that existed at baseline disappears and then appears again, such a lesion will be considered to be "PD" if this reappearance occurred after the overall response became CR; however, if other lesions are remaining, the lesion will not be considered to be a "new lesion" or "PD" because of the reappearance alone, but its tumor diameter will be added to the sum of diameters if the lesion is a target lesion. If the lesion is a non-target lesion, it will be considered to be "non-CR/non-PD" unless the lesion corresponds to "obvious progression".
• When a lesion may a new lesion but this cannot be confirmed, the lesion will not immediately be recorded as a new lesion, but imaging examination will be conducted after a clinically appropriate When there are no non-target lesions at baseline, the overall response will be determined based on the response of the target lesion and incidence of new lesions, and when there are no target lesions at baseline, the overall response will be determined based on the response of non-target lesions and incidence of new lesions in accordance with the criteria specified in the table below.
Determination criteria for time point response (when target lesions are present).
Response of target The best overall response will be considered in the order of CR > PR > SD > PD > NE. The overall evaluation at the best time point from the initiation of treatment through to the initiation of posttreatment will be considered to be the best overall response.
Meanwhile, determination of CR or PR in 4-week periods is not necessary in this study. When an overall response corresponds to the definition given for multiple categories, it will be categorized into the best-fitted category in the order of CR > PR > SD > PD > NE.
SD determination shall satisfy the SD standards after 6 weeks from the start of treatment. When an obvious deleterious change (exacerbation) of the disease is observed before the first effect determination, it will be considered to be PD when no imaging determination is implemented and NE when the determination was not conducted because of discontinuation of treatment due to adverse events or rejection by a subject.
(7) Clinical progression
Progression will be determined in accordance with the following criteria when using a method other than those defined in {3.8 (4) Determination of tumor reduction effect} or when progression in unmeasurable lesions is determined. However, progression will not immediately be determined even when a case corresponds to the following criteria but the judgment of a clinical investigator is prioritized. When image assessment is available, the image assessment will be prioritized. The clinical benefit rate is defined as the rate of patients who are not determined to have experienced disease "progression" for 6 months from the initiation of treatment.
"Patients who are not determined as 'progression' for 6 months" means patients whose time point When the progression is determined based on diagnostic imaging, the date for which progression is recorded will be the day of the examination. In the case of clinical progression, the date of clinical determination will be recorded as the date of progression.
② In survival cases that are not determined to have experienced progression, the most recent day on which no progression is confirmed will be the recorded date for PFS.
③ When the diagnosis of progression is based on diagnostic imaging, the date recorded will be the "examination day" of the diagnostic imaging that provided "certain diagnosis" but not the day of examination where the progression was suspected as "suspicious on image". When the progression is determined clinically but is not based on diagnostic imaging, the date recorded for progression will be the day when the progression was determined.
④ The development of secondary cancer(s), e.g. heterochronic double cancer or heterochronic multiple cancer, will not be considered an event and will not be recorded as such, but will be considered to be PFS until another event is observed.
⑤ When treatment is discontinued due to the characteristics of or rejection by the patient and other treatment is implemented as an after-treatment, such cases will be handled in the same manner as the above for recording events and the endpoint, and will not be recorded at the time of discontinuation of treatment or the date of the initiation of after-treatment.
(3) Overall survival (OS) The period of time from the registration day to the day of death from all causes. The final confirmation day of survival in survival cases will be the recorded date. For cases that are lost to follow-up, the last date when survival of the patient was confirmed before becoming lost to follow-up will be the recorded date.
(4) Time to treatment failure (TTF) A period of time from the registration day to either of the day when progress was determined, the day of death from all causes, or the day of discontinuation of the protocol treatment (whichever is earlier).
① The day of discontinuation of the protocol treatment is the day when the discontinuation will be determined. When the progression is determined based on diagnostic imaging, the date recorded for progression will be the day of the examination. In the case of clinical progression, the date recorded for progression will be the day of clinical determination.
③ When the diagnosis of progression is based on diagnostic imaging, the date recorded for the event will be the examination day when the diagnostic imaging was performed that provided certain diagnosis, but not the day of examination where progression was suspected as "suspicious on image". When the progression is determined clinically but not based on diagnostic imaging, the date recorded for progression will be the day when the progression was determined.
④ When the protocol treatment is continuously implemented and there is no progression, the treatment will be discontinued on the final confirmed day of survival (the final confirmed day of PFS).
(5) Time to chemotherapy (TTC)
The period of time from the registration day to the day of first administration of chemotherapeutic drug ① For cases where mortality occurred before the initiation of chemotherapy, the date of death will be the recorded date.
② For cases that are lost to follow-up and in which implementation of chemotherapy is not confirmable, the last date when survival of the patient was confirmed before becoming lost to follow-up will be the recorded date.
The response rate is the rate of patients whose best overall response {3.8(6) Best overall response} in a target population with measurable lesions is CR or PR as a proportion of all the cases that underwent treatment. Adverse events that are observed from registration to the discontinuation of the protocol treatment will be evaluated in all treated cases (see "19 Evaluation and reporting of adverse events").
HORSE-BC protocol ver. 1.0 August 12, 2015 4 Objectives and significance of the study 4
.1 Objectives of the study
The objectives of this study are: (1) To evaluate the efficacy and safety of secondary endocrine therapy in general as well as that of specific drugs in estrogen receptor-positive, HER2-negative postmenopausal metastatic breast cancer for which primary endocrine therapy had no favorable clinical effect (low sensitivity to primary endocrine therapy).
(2) To clarify the effect of reactivity to the previous endocrine therapy (the period from the start of postoperative endocrine therapy to recurrence) and the biological characteristics of any given tumor (expression intensity of ER and presence or absence of PgR expression) on the results of the secondary endocrine therapy, and to obtain information to complement Hortobagyi's therapeutic algorithm.
Background inspiring this study
(1) Target disease According to the National Cancer Center, Center for Cancer Control and Information Services, the estimated annual number of Japanese females affected with breast cancer in 2011 was about 72,500, and the rate per 100,000 population was 110.5, showing that the breast was the organ most frequently affected with malignancy in females. The annual number of deaths due to breast cancer in Japan was 13,148 in 2013, which is the 5 th leading cause of mortality following stomach, colorectal, lung, and pancreatic cancers.
The incidence of breast cancer in Japanese females is constantly increasing and ranks closely with colorectal cancer and lung cancer 4) .
About 90% of patients who are diagnosed with breast cancer receive surgical excision of the primary focus; however, the remaining 10% of patients have obvious distant metastasis at the first visit.
The survival rate of breast cancer is good if the tumor is detected early and removed surgically.
It is considered that the presence or absence of micrometastasis, which is clinically undetectable at the initial visit, has a decisive influence on the patient's prognosis. About 60% of patients who received surgery were cured, on the other hand, about 40% experienced a relapse 5) .
The median prognosis for the life expectancy of patients whose breast cancer has developed metastasis and recurrence is 28 months, and achieving a cure of metastatic or recurrent breast cancer is difficult even with current treatment techniques.
(2) Treatment of target population ① Goal of treatment for metastatic breast cancer It is very rare to achieve a complete cure for breast cancer that is already associated with inoperable distant metastasis at the first visit (Stage IV) and recurrent breast cancer caused by distant metastasis; therefore, the major purposes of treatment are alleviation of symptoms, life extension, and maintenance and improvement of quality of life (QoL) in such cases 6,7) .
Metastatic breast cancer is mainly treated by drug therapy. Radiotherapy, surgical therapy, etc. are also used in combination as needed. These treatments are intended to provide alleviation of symptoms and maintenance of daily life. ③ Recent outlooks regarding sensitivity and tolerance to endocrine therapy Recently, several classification models regarding sensitivity and tolerance to endocrine therapies have been proposed as the basis of the clinical course associated with initial endocrine therapy.
The 2nd International Consensus Guidelines for Advanced Breast Cancer (ABC2), which was held as an international consensus conference for recurrent breast cancer, proposed classifications of resistance to endocrine therapies for ER-positive metastatic breast cancer according to the period from the start of initial endocrine therapy to recurrence or progression as below 9) : [Primary endocrine therapy resistant breast cancer] • Cases that showed recurrence within 2 years after the initiation of postoperative adjunct endocrine therapy.
• Cases that showed progression of the disease condition within 6 months after the start of initial endocrine therapy for metastatic breast cancer. • Cases that showed recurrence within 2 years after the initiation of postoperative adjunct endocrine therapy or within 12 months after the completion of the endocrine therapy.
• Cases that showed progression of the disease condition within 6 months after the start of initial endocrine therapy for metastatic breast cancer.
In addition, a classification scheme based on drug sensitivity that categorizes cases that show recurrence within 2 years after the initiation of postoperative adjunct endocrine therapy and cases that show progression within 3 months after the start of initial endocrine therapy as "very low" drug sensitivity, and cases that show recurrence after 2 years from the initiation of postoperative adjunct endocrine therapy as "low" drug sensitivity has also been proposed Recently, drug treatments for breast cancer that have a mechanism of action different from that of existing drugs became available.
Fulvestrant has no partial agonistic effect on ER such as that observed for tamoxifen, but instead down regulates ER expression in breast cancer cells; therefore, it is classified as a selective estrogen receptor down regulator (SERD) [10][11][12] .
Based on the results of a Phase II comparative study that compared anastrozole and In addition, everolimus is a mammalian target of rapamycin (mTOR) inhibitor. Inhibition of mTOR, which is situated downstream of the PI3K/AKT pathway, a key signaling pathway controlling cell proliferation, reveals a cancer cell proliferation effect, and it was shown that PFS was extended by the combined administration of other endocrine therapies in breast cancer that became endocrine therapy resistant [14][15][16] .
It is expected that a clinically significant treatment effect can be obtained by secondary endocrine therapy, even for cases that have poor responsiveness to primary endocrine therapy, by the use of these drugs. (
3) Study plan
Validation of a randomized controlled study implemented in cases that showed poor responsiveness to the primary endocrine therapy is required to establish the standard treatment for such cases in the future. However, no previous clinical trials have evaluated the efficacy and safety of secondary endocrine therapies in cases that showed poor responsiveness to the primary endocrine therapy. Furthermore, currently there is a wide range of medicines available for use as secondary endocrine therapeutic medicines for breast cancer.
Fundamental information, such as the selection of the target population indicated for treatment with secondary endocrine therapy and the basis underlying the selection of the target population, and the treatment effect expected for the overall secondary endocrine therapy and for each individual medicine are required to plan a comparative clinical trial involving these medicines in the future.
Based on the above background, this observational study was planned.
This study aims to clarify the efficacy and safety of secondary endocrine therapy using endocrine therapeutic medicines in estrogen receptor-positive, HER2-negative postmenopausal metastatic breast cancer for which the primary endocrine therapy had no favorable clinical effect through prospective observation using outcome indices including the clinical benefit rate, progression free survival, overall survival, time to treatment failure, time to chemotherapy, response rate, healthrelated quality of life, and adverse events.
Secondary aims include to categorize the wide variety of endocrine therapeutic medicines that are currently usable in Japan based on their action mechanisms and to evaluate their efficacy and safety.
Cases that showed low sensitivity to previous endocrine therapy are the target population in this study, and it is expected that the response of these cases to secondary endocrine therapy will not
Study hypotheses
To achieve the objectives, the following study hypotheses will be tested in this study.
(1) A clinical benefit rate of at least 30% can be expected for the latest endocrine therapeutic medicines for breast cancer with low sensitivity to the primary endocrine therapy.
(2) The effect of the secondary endocrine therapy can be predicted because responsiveness to previous treatment and the biological characteristics of tumor influence the therapeutic effect of the secondary endocrine therapy on breast cancer with low sensitivity to the primary endocrine therapy. According to our interpretations of the terms "intervention" and "invasion" described in those guidelines, this study corresponds to "non-intervention study involving mild invasiveness", and the study design is regarded as an observational study.
(1) Invasiveness Invasiveness is defined as "To cause injuries or distress to a research subject's body and/or mind by conducting a procedure for investigational purpose, such as puncture, incision, administration of drugs, irradiation and questions related to the subject's mental trauma, etc. Of various types of invasiveness, one causing minor injury and/or distress on the research subject's body and/or mind is called 'minor invasiveness'." in Chapter 1, Part 2 "Glossary" (2) of the guidelines.
The treatment implemented in this study will be conducted as regular clinical practice based on the preferences of medical staff and patients using drugs covered by insurance. Therefore, this study does not correspond to the treatment defined in the "Objectives of the study".
According to the survey plan implemented in this study, evaluation of Quality of life (QoL) by questionnaire will be conducted. Investigation of QoL in medical studies is implemented using scales validated for relevance and reliability, and is generalized as an evaluation approach for medical research. Considerations of the mental or physical burdens to patients are included in the process of the validation of the scales (content validity). Therefore, it is considered that the evaluation of QoL produces no mental damage to the subjects. The amount of time required to complete a QoL evaluation is about 15 minutes each time, and a mild burden is produced due to implementing the evaluation a total of 3 times (at the time of registration and at 1 and 3 months).
Based on the above, it is considered that the burden for the subjects participating in the study is small; therefore, the level of invasion produced for the subjects participating in this study corresponds to "minor invasiveness".
(2) Intervention Intervention is defined as "A practice for investigational purpose to control the presence or absence of factors that can affect a variety of events related to human health (including activities to maintain and promote good health and medical practices such as medication and examinations for prevention, diagnosis, and treatment of the patients), or the degree of such factors. The abovedefined intervention also includes medical techniques beyond usual medical practice that are conducted for investigational purposes." in Chapter 1, Part 2 "Glossary" (3) of the guidelines.
The treatment implemented in this study will be conducted as regular clinical practice based on HORSE-BC protocol ver. 1.0 August 12, 2015 the preferences of medical staff and patients using drugs covered by insurance. Therefore, this study does not correspond to the treatment defined in the "Objectives of the study". A total of 3 imaging evaluations conducted at the time of registration and at 3 and 6 months are specified as investigations in this study. However, these evaluations do not correspond to medical practice exceeding the range of regular medical examination as an evaluation approach of drug therapy for metastatic breast cancer. In addition, evaluation of QoL does not correspond to medical practice.
As mentioned above, this study is a medical research study involving no intervention and is therefore categorized as an observational study.
Case registration
(1) Completion of "Case registration card" Clinical investigators will confirm that study subjects satisfy the inclusion criteria (6.2) and complete all question items of the Case registration card (Appendix B). Then, the cards will be sent to the data center by fax. (2) Confirmation of registration The data center will confirm the eligibility of the study subjects based on the received Case registration cards and will then register the subjects.
① When the description given on the Case registration cards is inadequate, the subject will not be registered.
② The date when a sequence of registration procedures is completed will be used as the registration date, and described in "Confirmation note for case registration" (Appendix C).
The case will not be "registered" at the time of submission of the Case registration card to the data center by fax.
③ Registration of study subjects will not be canceled (i.e., deleted from the database) except when utilization of their data for research is denied. In cases of duplicated registration, the first registration information (earliest registry number) is adopted.
④ When a registration error or duplicated registration is found, a clinical investigator must immediately contact the datacenter.
(3) Sending of "Confirmation note for case registration" The data center sends a "Confirmation note for case registration" via fax to the clinical investigators described in the Case registration card. Treatment will be selected based on discussion between medical staff and patients in this study (treatment of physician's choice: TPC). In addition, prohibition of concomitant therapy is not specified in this study because this study is an observational study. However, it is recommended to use medical agents with an antitumor effect (chemotherapeutic agent, concomitant use of molecular target drug, and other endocrine therapy) and to combine drug treatment with other treatment (surgery, radiotherapy) as appropriate in accordance with published guidelines 8) .
Furthermore, when these therapies are implemented in combination with the endocrine therapy, the details will be described in the patient's Progress report. Planned treatment shall be clearly indicated on the Case registration card when a subject participates in this study.
Hereinafter, preventive treatments used and evaluated for their efficacy and safety in the study populations are referred to as "protocol treatment". Protocol treatment shall be started within 2 weeks after registration. If treatment cannot be started within 2 weeks, the reasons for the delay are recorded in the "Progress report" (Appendix D In addition, extensions of the time to significant progression and overall survival were observed in the everolimus + tamoxifen group as compared with the tamoxifen group in a Phase II randomized trial conducted in aromatase inhibitors resistant, locally advanced, or metastatic, postmenopausal breast cancer patients 17) .
Administration of everolimus in combination with an endocrine therapeutic medicine for inoperable or recurrent breast cancer is allowed in Japan. Accordingly, combination use of the endocrine therapeutic medicines listed in 5.3 (2) with everolimus is considered as a therapeutic option in this study. Combination use of everolimus and endocrine therapeutic medicines is considered as a factor that may affect efficacy and adverse events; therefore, this is described as a HORSE-BC protocol ver. 1.0 August 12, 2015 concomitant drug in the Progress report.
(4) Categorization of drug types used for the analysis Currently, the first-line drugs used for postoperative endocrine therapy and primary endocrine therapy for metastatic breast cancer are aromatase inhibitors. It is predicted that most of the cases registered in this study received administration of aromatase inhibitor as a pretreatment. There are a number of aromatase inhibitors that are available for use as secondary therapies. These therapies can be categorized based on their principal mechanism of action as below. Their efficacy and safety will be evaluated using the following categories including the general secondary endocrine therapy in this study. In addition, the subject group categorized into "Others" below will not be subjected to the analysis because the interpretation of the analysis results would be too difficult.
• Cohort with mTORi When the combined use of an endocrine therapeutic medicine and everolimus, which is an mTOR inhibitor, is selected. Cases that used everolimus concomitantly are categorized into this cohort regardless of the type of endocrine therapeutic medicine concomitantly used.
• Others
When the selected therapy cannot be categorized into any of the above cohorts.
(5) Concomitant treatments and medicines, and terms to be described in the Progress report ① Treatment in accordance with guidelines Prohibition of concomitant treatments and medicines associated with participation in this study is not specified, but it is recommended to implement standard treatment in accordance with the published guidelines 8) .
When the following treatments or medicines are concomitantly used with the protocol treatment, which was preliminarily reported after the registration, the reasons for the implementation (the presence or absence of withdrawal due to exacerbation of the disease or adverse events caused by the protocol treatment) must be described in the Progress report.
Survey
(1) Survey items The following survey and examination will be implemented to evaluate the efficacy and safety of the protocol treatment for subjects in this study. Surveys at 6 months after the initiation of protocol treatment and later will not be implemented except for the surveys of aftertreatment and prognosis.
(2) Survey schedule The surveys will be implemented on the schedule shown in the Note 1: Measurement of body weight will be performed only at the time of registration.
Note 2: In principle, image assessment should be implemented by the same technique as that implemented before registration.
Note 3: Evaluation will be implemented within 28 days (within 4 weeks) before registration Note 4: Evaluation within 2 weeks before or after the specified day is recommended.
Note 5: Every year after the end of the protocol treatment.
(3) Survey required before the registration Clinical investigators implement the following survey before registration of the case. The following terms will be evaluated within 28 days (within 4 weeks) before registration.
A) Chest CT, MRI, or chest X-ray (essential) B) Abdominal CT, MRI, or abdominal ultrasound (essential) C) Bone scintigraphy when bone metastasis is clinically suspected * When bone metastasis is suspected by bone scintigraphy, bone radiography, CT or MRI, etc. is conducted to evaluate the lesion. D) Brain CT or MRI when clinically brain metastasis is clinically suspected.
E) Evaluation and recording of lymph node and local skin recurrent focus * Inspection: It is favorable to observe progress using photos with indicators attached.
* Palpation: The size of foci such as superficial lymph nodes and cutaneous metastases are directly measured from outside the body if the size is measurable. It is desirable to evaluate with CT and/or ultrasound when the measurement method is applicable.
④ Survey of adverse events
Adverse events of Grade 3 or higher will be confirmed in accordance with the Common Terminology Criteria for Adverse Events v4.0 Japanese translation JCOG edition, and recorded.
Especially, the presence or absence of the following adverse events, which are common symptoms in breast cancer patients and associated with endocrine therapy, will be confirmed and recorded.
When adverse events of Grade 3 or higher are confirmed for symptoms other than the followings, the symptoms as recorded as "Other adverse events".
• Constipation
• Diarrhea The following questionnaire (scale) will be used to evaluate HRQoL.
It is desirable that evaluation of HRQoL is completed by the date of registration. However, if it is not completed because of a lack of time or other reasons, the questionnaire should be completed by the patient the day before the initiation of the protocol treatment.
(4) Survey plan at 1 month after the initiation of protocol treatment
The following survey will be implemented at 1 month after the initiation day of protocol treatment: ① HRQoL survey (See details for 5.5 Survey of health related quality of life) The following survey will be implemented at 1 month after the initiation of protocol treatment: * It is acceptable to implement the survey within 2 weeks before or after the specified day.
A) FACT (ES and B)
B) Questions about changes to identify minimally important differences
(5) Survey planned at 3 months after the initiation of protocol treatment
The following survey will be implemented at 3 months after the initiation date of protocol treatment: ① Physical findings * It is acceptable to implement the survey within 2 weeks before or after the specified day. * Palpation: The size of foci such as superficial lymph nodes and cutaneous metastases will be directly measured from outside the body if their sizes are measurable. It is desirable to use CT and/or ultrasound for evaluations where applicable.
③ Survey of adverse events
The presence or absence of adverse events of Grade 3 or higher occurring within the past 3 months will be confirmed and recorded.
* It is acceptable to implement the survey within 2 weeks before or after the specified day.
The contents of survey are the same as specified in ④ of 5.4 (3). The survey must be completed before registration. The following survey will be implemented at 6 months after the initiation day of protocol treatment: * However, the survey at 6 months after the initiation is not required when discontinuation of the protocol treatment or progression is reported in the survey at 3 months after the initiation. Move to the survey detailed in (7) for such cases.
① Physical findings * It is acceptable to implement the survey within 2 weeks before or after the specified day. * Palpation: The size of foci such as superficial lymph nodes and cutaneous metastases will be directly measured from outside the body if their sizes are measurable. It is desirable to use CT and/or ultrasound for evaluations where applicable.
③ Survey of adverse events
The presence or absence of adverse events of Grade 3 or higher occurring between the previous survey and the day of the current survey is confirmed and recorded.
* It is acceptable to implement the survey within 2 weeks before or after the specified day.
The contents of survey are the same as specified in ④ of 5.4 (3). The survey must be completed before registration. (3) HRQoL scales The following scales are used (Appendix F).
In addition, a questionnaire survey related to the social background and expectancy of QoL of patients, which may have an impact on subsequent HRQoL scores, will be conducted at the time When there is insufficient time, the survey should be completed before the initiation of the protocol treatment.
Note 2: It is acceptable to implement the survey within 2 weeks before or after the specified day.
HORSE-BC protocol ver. 1.0 August 12, 2015 (5) HRQoL survey for patients who discontinued the protocol treatment Evaluation of HRQoL will be discontinued when the protocol treatment is discontinued due to disease progress, development or exacerbation of complications, or adverse events.
(6) Survey method • ECOG PS will be determined by a clinical investigator at the same time as the QoL survey is conducted using specified survey terms and the results will be described in the Progress report.
• When the patient cannot complete the questionnaire due to an exacerbation of the disease condition of the patient, it is acceptable to implement the survey by reading the questionnaire by the Clinical Research Coordinator (CRC).
(7) Survey of reasons for missing data
When the questionnaire is not sent back for a patient after the scheduled survey period (5.5 (4) ), the data center surveys the reasons for the missing data, including the situation of questionnaire distribution and the health condition of the subject by asking the responsible clinical investigator.
The reasons for missing data are classified as below, and described as profiles of the study subject in the statistical analysis report and publications of the study results (conference presentations and paper publications). All of the subjects registered into this study are subjects of the survey.
Submission of data
The Case registration card for each subject will be submitted by fax, while other case report forms are submitted to the CSPOR data center via an electronic data capture (EDC) system in this study. The analysis set is defined as below: Total eligible cases: "Total eligible cases" is defined as a group of patients that overlapped and error registrations are removed from patients who registered in accordance with "5.2 Registration of cases".
Total treated cases: "Total treated cases" is defined as a subgroup of patients among the total eligible cases who received scheduled treatment at least once daily. Whether CBR, the primary outcome measures, exceeds 30% will be examined using accurate tests based on binomial distribution and the corresponding 90% confidence interval by cohorts with the entire secondary endocrine therapy. Meanwhile, the analysis set includes all treated cases, and a significance level of 5% is set for 1-sided tests.
② Other analyses
Analysis of the interaction effect of CBR is conducted for responsiveness to the primary endocrine therapy, expression intensity of ER, and presence or absence of PgR expression for all registered cases to examine the significance of effect predictors of the secondary endocrine therapy. The following classification will be used for each factor: A) Responsiveness to the primary endocrine therapy • ER high group: ER positive (J-score classification is 10% or higher)
C) Presence or absence of PgR expression
• PgR negative group: PgR negative (J-score classification is negative) • PgR positive group: PgR positive (J-score classification is 1% or higher) Analyses of secondary outcomes will also conducted on a by-cohort basis. For RR defined by a 2-value endpoint response, an accurate 90% confidence interval based on point estimation and the binomial distribution is calculated. Furthermore, for PFS, OS, TTF, and TTC, which are time-to-event outcomes, a survival curve will be estimated using a Kaplan-Meier method, and 90% confidence intervals of the survival rate at each event will be calculated using Greenwood's formula. The interaction effect will be analyzed for effect predictors in the same manner as that used for the primary outcomes.
Analysis of adverse events will be performed in all treated cases. Incidence rate by types and grade will be calculated for reported adverse events.
③ Analysis of HRQoL FACT-G, Breast, and ES, which are calculated as total scores, will be calculated for the aggregate score and subdomain scores in accordance with a scoring manual to calculate the fundamental statistics at the time of each survey for all subjects.
Furthermore, cases with decreases in scores exceeding the threshold values as compared with scores at the registration will be individually identified and the maintenance rate of QoL will be calculated using MIDs identified by scales as a meaningful threshold value of decrease of QoL score at each measurement point.
Information obtained from questions about changes will be used as subjective anchoring information required for the identification of MID during the endocrine therapy, and differences from the previously established MID will be examined.
Since it is considered that the evaluation and analysis of HRQoL have no influence on the clinical benefit rate, which is the primary outcome measures of this study, analysis will be implemented immediately after the data collection (after the collection of QoL questionnaires at 3 months for the last registered case). The results of the analysis will be published as conference presentations and papers. 6 Subject selection policy 6
.1 Definition of the subject of this study
Although there is no existing consensus about how to define "ER-positive, HER2-negative postmenopausal metastatic breast cancer with low sensitivity to the primary endocrine therapy", a definition is established as below in this study: • Cases that are continuing postoperative adjunct endocrine therapy and experienced recurrence within 5 years after the initiation of the therapy.
• Cases that experienced disease progression within 9 months after the initiation of the primary endocrine therapy for metastatic breast cancer.
These correspond to the "very low" and "low" groups described in Figure 1 in 4.2 (2).
Cases that fit the definition of the above-mentioned clinical course are called "breast cancer with low sensitivity to the primary endocrine therapy" in this study.
Inclusion criteria
Cases that satisfy all of the following conditions are included in this study as subjects.
(1) A patient with estrogen receptor (ER) positive Note 2 postmenopausal Note 3 breast cancer who is histologically diagnosed as breast cancer Note 1 . When the presence or absence of menopause of the subject is unclear, FSH and plasma estradiol levels will be measured to confirm whether these are at the after menopausal level as defined by the criteria of each facility.
(2) Diagnosis of breast cancer corresponds to either of the following. No distinction is made according to the presence or absence of measurable lesions. ② Breast cancer associated with progression or recurrence caused by distant metastasis after initial treatment (after surgery and treatment before or after the surgery) for breast cancer aiming at curing. However, local recurrence for which radical excision is applicable (this represents the chest wall surrounded by the lower edge of the clavicle as the upper limit of surgical site, the costal arch as the lower limit, the midline of the sternum as interior limit, and the anterior edge of the latissimus dorsi muscle as the outer limit) is excluded.
(3) Endocrine therapy for metastatic breast cancer is planned.
(See 3.5 Evaluation of Performance Status (PS))
Note 4: A case determined as PS 2 because of decreased activity due to bone metastasis will be considered as eligible.
(5) Previous endocrine therapy for breast cancer corresponds to either of the following. No distinction is made according to the type of endocrine therapeutic medicines used.
① A case that has continuously received endocrine therapeutic medicines as a postoperative adjunct therapy and in which recurrence occurred within 5 years after the initiation of the endocrine therapy.
② A case that received endocrine therapy as the primary treatment for metastatic breast cancer Note 5 and in which progression of the disease occurred within 9 months after the initiation of the endocrine therapy.
Note 5: A case that received postoperative endocrine therapy for at least 5 years and had metastasis 5 or more years after the initiation of the endocrine therapy will not be included.
In addition, a case that discontinued postoperative endocrine therapy within 5 years for any reason and then had metastasis and recurrence will also not be included.
(6) Previous chemotherapy for breast cancer corresponds to either of the following: ① No previous chemotherapy was administered.
② When chemotherapy was administered as a preoperative or postoperative adjunct therapy, it has been at least 6 months (168 days, 24 weeks) since the final day of administration.
(7) Previous radiotherapy for breast cancer corresponds to the following: ① It has been at least 14 days after the final day of radiotherapy administration. (8) Agreement about the participation in the study will be obtained from the subject him/herself using the consent form (Appendix G).
Exclusion criteria
A case that corresponds to any of the following is excluded from participating in this study as a subject.
(1) HER2-positive breast cancer (See 3.7 Determination of HER2 expression status) (2) A case not indicated for endocrine therapy (3) Any other case that a physician determines to be unsuitable for participation in this study
Scientific rationale and grounds for research hypothesis
The usual current first-line drugs for postmenopausal breast cancer are aromatase inhibitors as a postoperative endocrine therapeutic medicine or as a primary endocrine therapy for metastatic breast cancer. Hence, it is presumed that most of cases registered in this study will have been administered an aromatase inhibitor in their previous treatment. The following reports detail the results of clinical trials related to the use of secondary endocrine therapy after previous treatment with an aromatase inhibitor. [Tamoxifen] • In the TARGET trial, which compared tamoxifen with anastrozole as primary endocrine therapies for metastatic breast cancer, 137 cases received administration of tamoxifen as the secondary endocrine therapy of the anastrozole group, and a CBR of 48.7% was obtained 25) .
• A CBR of 50% was obtained for the use of tamoxifen after anastrozole in a subtrial of the TARGET trial implemented in Switzerland (SAKK 21/95 subtrial).
[Other aromatase inhibitors]
• Nine previous reports examined the therapeutic effect of steroidal exemestane as the secondary treatment after primary treatment with a nonsteroidal aromatase inhibitor (anastrozole or letrozole), and the CBR was 12-55% 27) .
[Fulvestrant]
• In the EFECT trial, which compared steroidal exemestane with a fulvestrant loading dose regimen as secondary treatments after primary treatment with a nonsteroidal aromatase inhibitor (anastrozole or letrozole), the therapeutic effect was equivalent in each group, and the CBRs of fulvestrant and exemestane were 32.2% and 31.5%, respectively 28) . with cancer recurrence under postoperative endocrine therapy, the CBRs of the 250 mg/month and 500 mg/month groups were high (39.6% and 45.6%, respectively) and the 500 mg/month group also showed better overall survival 29,30) .
[mTOR inhibitors: combination use of everolimus and endocrine therapy]
• In the BOLERO-2 trial, which compared exemestane with an mTOR inhibitor (everolimus) + exemestane as secondary treatments after primary treatment with a nonsteroidal aromatase inhibitor (anastrozole or letrozole), superiority of the combination of exemestane + everolimus was indicated, and the CBRs of the exemestane group and the everolimus + exemestane group were 59% and 79.6%, respectively 15,16) .
•
In the TAMRAD trial, which compared tamoxifen with everolimus + tamoxifen, the CBRs of the tamoxifen group and the everolimus + tamoxifen group were 42.1% and 61.1%, respectively; indicating the superiority of the combined use of everolimus + tamoxifen 17) .
As described above, CBRs of about 50% were obtained for several trial therapies tested as secondary treatments used after primary treatment with aromatase inhibitors, although there have been variations between different studies and medicines. Especially, a strong trend towards higher CBR was observed for the combined use of fulvestrant 500 mg and an mTOR inhibitor in a recent clinical study 31) .
This study targets breast cancer with low sensitivity to the primary endocrine therapy, and previous trial results may not always be applicable; therefore, the therapeutic effect of secondary endocrine treatment in this clinical population needs to be evaluated. On the other hand, a clinically acceptable minimum therapeutic effect must be guaranteed.
As a hypothesis to validate one of the study objectives {4.
Procedures to obtain informed consent etc.
Clinical investigators provide information documents approved by the ethical review committee of their host facility to each potential study subject before registration, together with an adequate explanation of what the study will involve for the subjects. After the explanation, sufficient time will be given so that the subjects can raise questions and make a judgment about whether or not to participate. It will be confirmed whether the subjects understood the contents of the study well, then participation in the study will be requested and voluntary agreement will be obtained as a completed and signed consent form.
When agreement to participate in the study is obtained from a subject, the subject will enter the date of the agreement and his/her name and provide their seal or signature on the consent form. In addition, the clinical investigators and research collaborators (when the research collaborators provided supplementary explanation) will enter the date of the explanation and his/her name and seal or signature. Two photocopies of the consent form are created for each subject. One copy of the consent form is provided for the patient and the other copy is filed at the facility. The original copy is filed with the subject's medical records.
The following terms are explained to study subjects when informed consent is obtained: (1) Title of the study and the procedures involved in implementation of the study information. Data of the study subjects obtained in this study will not be used for any other purpose than meeting the objectives of this study. In addition, information that can specify the study subjects will not be used when the study results are published.
(2) Linkable anonymization Identification and inquiry of registered patients is conducted using registry numbers issued at the time of registration (linkable anonymization). Information from which bystanders can directly identify a patient, such as the name, initials, and date of birth of patients, will not be registered into the database of the CSPOR data center. (
3) Timing and method of anonymization
Anonymization is conducted at the CSPOR data center at the registration of cases.
The CSPOR datacenter issues registry numbers for patient identification numbers described in the "Case registration card" and registered facilities. The data center will book the registry numbers issued on a "Confirmation note for case registration", which is sent to the clinical investigators.
Registry numbers will be used for the identification of subjects required for data collection (including QoL questionnaires) and subsequent inquiries. A correspondence table will be securely managed and stored by the CSPOR data center.
Burden and expected risks and benefits for study subjects
Treatment implemented in this study does not exceed the range of regular clinical practice, and the treatment will be conducted based on the preferences of medical staff and patients. Furthermore, the techniques used and the frequency of image assessment implemented to evaluate the therapeutic effect and side effects do not exceed the range of regular clinical practice. Therefore, it is considered that there are no increased risks or benefits for study subjects associated with participation in this study.
QoL evaluation using survey sheets will be conducted in this study. The investigation time for a single survey is ≤ 15 minutes, and the survey will be performed 3 times (at the time of enrollment and at 1 and 3 month after the initiation of the protocol treatment). Therefore, no excessive burden is borne by study subjects, and it is considered that the level of invasion associated with participation in this study is minor.
Storage
Records of the consent given by subjects, test data etc. for the preparation of reports, certificates of approval by the ethical committee, and records prepared in medical institutes are securely stored under the supervision of the principal investigator. However, when the storage methods used for these materials (storage site and person in charge of storage) are specified to be at a collaborating research facility, storage will be conducted in accordance with the same rules as those used for central storage.
Adequate care will be exercised for storage to avoid leakage of personal information.
The duration of information storage is up to 5 years from the discontinuation or completion of the study.
Disposal
When information are disposed of, adequate care will be exercised to avoid leakage of personal information by deleting electronic data and shredding printed documents containing personal information.
13 Contents and methods of report to Chief Executive of research implementing entity 13.1 Contents of report to Chief Executive of research implementing entity Principal investigators in collaborating research institutes will report the following items to the Chief Executive of the research implementing entity.
Meanwhile, when the contents of the report to the Chief Executive of the research implementing entity are specified by the research institute, the report is conducted in accordance with the provision.
Timing and methods of reporting
When the timing and methods of reporting to the Chief Executive of the research implementing entity are specified by the research institute, the report will be conducted in accordance with the provision.
When provision is not provided by the research institute, principal investigators will prepare a "Status report on the study implementation" containing the contents of 13.1 and report to the chief executive of the research implementing entity.
The timing of reporting is as follows: All responsibilities for the planning of the study, implementing institutes/facilities, and approval of the Ethical Review Board, implementation of the study, analysis, interpretation, and publication of the study results, and ensuring transparency of the study are assumed by researchers, and AstraZeneca K.K.
is not involved in such decision-making.
The above will be clearly described at conference presentations and paper publications of the study results.
14. information. Furthermore, the information will be renewed on a timely basis in response to changes in the protocol and development of the study. When the study is completed, the study results will be registered without delay.
Publication of study results
When the study is completed, the study results will be published after taking measures required for the protection of the human rights of study subjects and involved persons or the rights and benefits of researchers etc. and their involved parties without delay. Publication of the study results will be determined by the steering committee based on a proposal by the executive committee of this study.
Publication related to this study will be appropriately conducted based on a preliminary publication plan, which is specified separately. Planned presentation styles are conference presentations and submission of papers to medical journals.
Response to consultation etc. from study subjects and involved persons
The followings are described in a briefing paper as contacts for consultation etc. from study subjects and interested persons.
• Name, affiliation, and contact information of the research representative of this study.
• Name, affiliation, and contact information of principal investigators of research institutes.
• Contact information of consultation services designated by collaborating research institutes, if there are any available.
Informed consent by legally acceptable representative
This study has no legally acceptable representative.
Economic burden and rewards for study subjects
Medical examination of this study will be conducted within the normal range of regular clinical practice.
Accordingly, all medical expenses including medication and examination during participation in the study will be paid as healthcare services provided by health insurance or by the patients participating in the study.
No reward is provided to the study subjects who participate in this study. When adverse events occur, clinical investigators must immediately take the required measures (examinations, treatment of the adverse events, and discontinuation of the treatment etc.) to ensure the safety of the study subjects.
Evaluation of adverse events
The naming of adverse events and their grades is determined based on the Common Terminology Criteria for Adverse Events v4.0 Japanese translation JCOG edition. Adverse events described as side effects in the package insert of each drug are considered to be known adverse events, and those not described are considered to be unknown adverse events.
(1) Evaluation duration of adverse events The evaluation duration of adverse events in this study is from the registration to 30 days after the completion of the protocol treatment specified as the object of evaluation.
Reporting of adverse events
When adverse events carrying an obligation to report corresponding to the below categories occur, a principal investigator reports to the secretariat. In addition, if serious adverse events ("serious" specified in ICH E2A) for which a causal correlation with the study treatment cannot be negated are observed, a report as stipulated by the reporting system of safety information on drugs etc. (1) Adverse events carrying an urgent obligation to report Adverse events corresponding to any of the following must be urgently reported via an "Emergency adverse event report" (Appendix X). These adverse events are defined as "Major adverse events".
① All deaths occurring during the study endocrine therapy.
② Deaths within 30 after the final administration of the study endocrine therapy and all deaths before the initiation of the next treatment.
"30 days" means 30 days counted from the day following a treatment day (the treatment day is defined as Day 0). All deaths occurred during this period are urgently reported regardless of the suspected causation.
However, even deaths occurring in a period other than the above (i.e., more than 30 days after the final administration of the study endocrine therapy and after the initiation of subsequent treatment) must be urgently reported when a correlation with the study endocrine therapy is suspected.
③ Unknown non-hematotoxicity observed before the initiation of the next treatment (2) Adverse events carrying a regular obligation to report Adverse events carrying a regular obligation to report are defined as any adverse events corresponding to Grade 3 or Grade 4 that are not adverse events carrying an urgent obligation to report {19.2 (1)}.
(3) Principal investigators' obligation to report and reporting procedures ① Urgent report When adverse events occur that carry an urgent obligation to report {19.2 (1)}, a clinical investigator must immediately inform the relevant principal investigator. When the principal investigator is not available, the clinical investigator must cover the responsibility of the principal investigator.
When an adverse event subjected to urgent reporting is observed, the event must be orally reported to the secretariat within 24 hours and the principal investigator must complete an "Emergency adverse event report" (Appendix X) (It is also acceptable to use a form provided by the hospital) and submits a fax (03-5298-8536) or E-mail ([email protected]) to the CSPOR data center within 72 hours after knowing the incidence of the adverse event.
In addition, the principal investigator must prepare a case report (A4 size, free format) describing further information as a separate document and submit a fax to the CSPOR data center within 15 hours after knowing the incidence of the adverse event. ② Regular report Principal investigators should record predefined terms in the "Progress report" (Appendix X) corresponding to the timing of the incidence of the adverse events and submit it to the CSPOR data center at the stipulated normal submission time of the Progress report.
Responsibility of the secretariat
(1) Determination of the necessity of discontinuance of registration and urgent notification to a facility When the secretariat receives a report from a principal investigator, the secretariat must seek the decision of a research representative or his/her proxy regarding the urgency, importance, and degree of impact of the reported contents. The secretariat must then take measures as needed including discontinuation of registration (communication to CSPOR data center and all participating facilities) and urgent communication about terms that must be recognized to participating facilities. Furthermore, the principal investigator is strongly prompted to implement reporting as stipulated by the reporting system of safety information on drugs etc. based on the Pharmaceutical and Medical Device Act.
(2) Report to independent data monitoring committee When the research representative determines that an adverse event reported as an urgent or regular report from a facility corresponds to an "adverse event carrying an obligation to report", the research representative must report it to the independent data monitoring committee in writing within 15 days after knowing the incidence of the adverse event and request review of the accuracy of the opinion of the research representative about the adverse event and any measures taken against the adverse event.
Examination by the independent data monitoring committee
The independent data monitoring committee will review the reported contents and make a recommendation in written form about future responses including handling of cases and the advisability of continuing registration to the research representative. 21 Response to queries regarding the delivery of medical care after the completion of the study Medical care after the completion of the treatment specified in the protocol of this study is not stipulated.
In addition, medical practice implemented in this study will be conducted within the normal range of regular clinical practice; therefore, no response related to the delivery of medical care after the completion of the study will be offered. Clinical investigators provide the best medical treatment aiming at prolonged survival, alleviation of symptoms, and maintenance and improvement of QoL, which are the goals for the treatment of metastatic breast cancer.
Handling of information related to health conditions of study subjects and study results
When information or research results that may influence the will of study subjects to continue participating in the study is obtained during the intervention period, the clinical investigator must immediately provide information documents describing the corresponding information and offer explanations of the following to the study subjects based on these documents:
Corresponding information
Continuation of the participation in the study is left to their discretion.
The clinical investigator offering the explanation will enter the date of the explanation and his/her name and seal or signature on the information documents and consent form, and the study subject will enter the date they received the information and his/her name and seal or signature. In addition, when a research collaborator offers a complementary explanation, the research collaborator will also enter the date of the explanation and his/her name and seal or signature. A copy of the materials will be provided to the study subjects.
The clinical investigator will confirm with the study subject whether he/she wishes to continue participating in the study, and will enter the date and the subject's answer on the original copy of the information documents and consent form and then file them. The clinical investigator will revise the information documents and consent form and obtain approval from the ethical review board of the facility, as needed.
They must then explain the results to the study subject again using the revised information documents and consent form, and obtain voluntary consent for continuing participation in the study from the study subject in writing. The clinical investigator will enter the date when they gave the explanation and his/her name and seal or signature on the consent form and the study subject will also enter the date of consent and his/her name and seal or signature. A copy of the consent form will be provided to the study subject and the original copy will be filed.
Future utilization of samples and information
When the information obtained from subjects of this study are used for a study conducted for objectives different from this study or when the information are provided for other research institutes in the future, a new protocol will be developed and the study will be implemented under the approval of the ethical review board.
Monitoring
Monitoring will be implemented to confirm whether the study is implemented safely and in accordance with the protocol of the study, and will evaluate whether data are accurately collected.
Monitoring will be conducted as in-house monitoring with case report forms collected by the CSPOR data center using computerized data processing results as reference in cooperation with the executive committee and CSPOR data center. Monitoring through facility visits is not planned.
Audit
Audit is not planned for this study because this study does not correspond to an "intervention study involving high degree of invasiveness" as described in the "Ethical Guidelines for Medical and Health Research Involving Human Subjects" (issued on December 22, 2014).
Approval by Ethical Review Boards
26.1 Approval at the start of participation in the study When facilities start to participate in this study, each facility must submit necessary documents and receive approval from the ethical review board of the facility. When approval is obtained, the facility sends a copy of the certificate of approval to the secretariat. The facility will file the original copy of the certificate of approval, and the secretariat will file a copy of the certificate.
Annual renewal of the approval by the ethical review board
Review and annual renewal of approval for the study protocol and information documents for patients by the ethical review board of each facility will be conducted in accordance with the stipulations of each facility.
Completion, withdrawal, and interruption of the study (1) Completion of the study
The completion of the study is defined as the point when all follow-ups until the completion of the study duration are completed in all facilities. When the study is completed at each facility, principal investigators will submit a study completion report to the Chief Executive of the relevant research implementing entity and the research representative immediately.
(2) Withdrawal and interruption of the study ① The independent data monitoring committee examines the relevancy of continuation of the study, as needed. If at any point the committee determines that the continuation of the study is not appropriate, the committee will make a recommendation of withdrawal or interruption of the study to the research representative.
If the research representative decides to execute withdrawal of the study in accordance with the recommendation, the withdrawal, the reason of the withdrawal, and measures for participants will be communicated to principal investigators as soon as possible.
The principal investigators will report the situation in writing to the Chief Executives of research implementing entities and to the ethical review board of the facility at the same time.
Suitable measures will then be taken for each study participant in accordance with the directions given by the research representative and the ethical review board of the facility.
HORSE-BC protocol ver. 1.0 August 12, 2015 ② When a recommendation or direction of withdrawal is issued by the ethical review board, the research representative and principal investigators must take appropriate measures in accordance with the following: A) When a recommendation or direction to withdraw the study is issued to the research representative by the ethical review board, the research representative must consider the withdrawal of the study. When withdrawal is decided, the withdrawal, the reasons for withdrawal, and measures for participating in the study will be communicated to principal investigators as soon as possible.
The principal investigators must report the situation in writing to the Chief Executives representative who received the report will relay it to the independent data monitoring committee, which will examine the relevancy of the continuation of the study. When withdrawal or interruption of the study is decided based on the recommendation or direction from the ethical review board of the facility, the principal investigators will immediately report it together with the reasons to the Chief Executive of the relevant research implementing entity in writing.
③ Principal investigators must examine the advisability of continuation of the study when the following terms apply: A) When it is determined that recruitment of the planned number of study subjects is difficult because of difficulty in recruiting study subjects.
B) When the objective of the study is achieved before the number of planned study subjects is recruited or before the end of the planned study duration.
C) When the independent data monitoring committee or ethical review board directed a change in the protocol and it is determined that it is difficult to accept this direction.
Note: "The independent data monitoring committee" refers to the independent data monitoring committee of the General Incorporated Association of CSPOR-BC organized by the General Incorporated Association of CSPOR-BC.
Compliance with the protocol
Researchers who conduct this study shall comply with the protocol of the study as long as the safety
|
v2
|
2022-11-30T14:39:58.158Z
|
2022-11-29T00:00:00.000Z
|
254071428
|
s2orc/train
|
Recent advances of nanomaterial-based anti-angiogenic therapy in tumor vascular normalization and immunotherapy
Anti-angiogenesis therapy and immunotherapy are the first-line therapeutic strategies for various tumor treatments in the clinic, bringing significant advantages for tumor patients. Recent studies have shown that anti-angiogenic therapy can potentiate immunotherapy, with many clinical trials conducted based on the combination of anti-angiogenic agents and immune checkpoint inhibitors (ICIs). However, currently available clinical dosing strategies and tools are limited, emphasizing the need for more improvements. Although significant progress has been achieved, several big questions remained, such as how to achieve cell-specific targeting in the tumor microenvironment? How to improve drug delivery efficiency in tumors? Can nanotechnology be used to potentiate existing clinical drugs and achieve synergistic sensitization effects? Over the recent few years, nanomedicines have shown unique advantages in antitumor research, including cell-specific targeting, improved delivery potentiation, and photothermal effects. Given that the applications of nanomaterials in tumor immunotherapy have been widely reported, this review provides a comprehensive overview of research advances on nanomaterials in anti-angiogenesis therapy, mainly focusing on the immunosuppressive effects of abnormal tumor vessels in the tumor immune microenvironment, the targets and strategies of anti-angiogenesis nanomedicines, and the potential synergistic effects and molecular mechanisms of anti-angiogenic nanomedicines in combination with immunotherapy, ultimately providing new perspectives on the nanomedicine-based synergy between anti-angiogenic and immunotherapy.
Introduction
Angiogenesis is the process of neovascularization from existing peripheral blood vessels, providing essential nutrients for solid tumor growth and a pathway for malignant metastasis, considered one of the hallmarks of cancers (1). This process involves the joint participation of endothelial cells, other stromal cells and the extracellular matrix (ECM) (2)(3)(4). Unlike normal tissue vasculature, the tumor vasculature exhibits abnormal structure and function, including a disordered vascular network, narrowed lumen, increased permeability and other defects, which leads to internal tumor hypoxia and low PH, inefficient drug delivery and reduced sensitivity to radiotherapy in the clinic (5)(6)(7).
Inhibition of angiogenesis is widely acknowledged as a promising antitumor strategy, exhibiting antitumor effects in various solid cancers. However, excessive inhibition of tumor angiogenesis tends to cause vascular degeneration, reduce drug delivery, and induce drug resistance (8,9). In addition, treatment with single anti-angiogenic drugs tends to cause compensatory expression of other pro-angiogenic factors or pathway activation, leading to drug resistance (10)(11)(12)(13). An increasing body of evidence from recently published studies suggests that short-term inhibition of tumor growth can induce normalization of tumor vascular structure and function, increase tumor vascular perfusion capacity while alleviating intratumor hypoxia levels, and improve the tumor suppressive immune microenvironment, which has the potential to potentiate the efficacy of radiotherapy and immunotherapy (14)(15)(16).
In recent years, nanomedicine has achieved significant progress, especially for targeted drug delivery and precision interventions (17,18). Nanomedicines have unique advantages in terms of precision and multi-targeted interventions while showing enhanced effects when combined with other antitumor treatment strategies (19)(20)(21). This review provides a comprehensive overview of the characteristics and molecular basis of tumor vascular structure and function and describes the impact of tumor vascular abnormalities on the tumor immune microenvironment. Furthermore, we summarize the latest research advances of current anti-angiogenic nanomedicines and their effects on the immune microenvironment and immunotherapy.
Regulation and characteristics of tumor vascularization
The main processes and the molecular basis of tumor angiogenesis Tumor angiogenesis is the biological process by which tumor cells and tumor microenvironment (TME) induce microvascular growth and establish blood circulation for tumor tissue (22). Tumor vasculature provides oxygen and nutrients for tumor tissues while carrying away metabolic wastes and carbon dioxide, promoting tumor growth and providing a pathway for tumor metastasis (23). It has been established that almost all solid tumors cannot grow beyond the size of 1-2 mm 3 without the support of the vascular system, which indicates that neovascularization is a prerequisite for the sustained growth of tumors (24). Sprouting angiogenesis is the main and classical way of tumor angiogenesis and is predominantly discussed in this paper. This process refers to the generation of microvessels by endothelial cells in a "budding" manner based on the original blood vessels. The main steps include: ① degradation of vascular basement membrane and activation of endothelial cells; ② endothelial cell migration and proliferation; ③ endothelial cell formation of luminal structures and capillaries; ④ generation of new basement membrane and recruitment of pericytes to build vessel wall, formation of mature vessels and extension into solid tumors (25,26).
Tumor angiogenesis is a complex process involving multiple mediators, mainly composed of tumor cells, tumor stromal cells (including endothelial cells, inflammatory cells, pericytes, fibroblasts, smooth muscle cells, etc.), extracellular matrix (ECM), and a variety of cytokines (27)(28)(29). All these effectors constitute the regulatory network of tumor angiogenesis. Current evidence suggests that the imbalance between proand anti-angiogenic factors is the key to initiating angiogenesis (30). Under physiological conditions, pro-and anti-angiogenic factors are in balance, and blood vessels remain quiescent and rarely form new branches. During tumor angiogenesis, the proangiogenic signals is hyperactivating, disrupting the balance and inducing angiogenesis (24, 31). Many factors contribute to the disruption of homeostasis, such as carcinogenic mutations, hypoxia, low pH, tumor-associated inflammation, recruitment of immune cells, and nutritional deficiencies. Targeted intervention of these factors is the key strategy for nanotargeted anti-vascular therapy.
Angiogenesis-stimulating factors represent a group of mediators, including growth factors, bioactive lipids, ECM degrading enzymes, cytokines, adhesion molecules and a variety of small molecule nucleic acids (Table 1). In recent years, the role of adhesion molecules in tumor angiogenesis has received increasing attention (32). Among the five major classes of adhesion molecules identified so far, it has been thought that the integrin family are the most important molecules for the process of angiogenesis by mediate cell-ECM adhesion (33).However, several other adhesion proteins, including vascular endothelial cell calcium adhesion protein (VE-cadherin), endothelial cell adhesion molecule 1 (PECAM1), and intercellular adhesion molecule 1 (ICAM1), vascular cell adhesion molecule-1 (VCAM-1), have been reported to mediating the adhesion of immune cells in tumor blood vessels, which is the key process for tumor immune cells to enter the stroma of tumor tissue and performing immunocidal functions (34-36). Understanding the mutual relationship among these regulatory molecules and their role in promoting angiogenesis is crucial for elucidating the mechanism of tumor angiogenesis and developing effective anti-angiogenic therapies.
Structural and functional abnormalities of tumor vasculature
Unlike physiological angiogenesis, tumor angiogenesis is a rapid and aberrant process, resulting in newly formed vessels that are often immature and have abnormal structures and functions (5). Tumor vessels are often hyperplastic, tortuous, dilated, overlapping, and exhibit disordered branching. The newly formed tumor microvessels lack normal structures, and are sinusoidal, striped, and thin-walled, composed of only one layer of endothelial cells. In addition, tumor vessels often exhibit high heterogeneity and distribution ( Figure 1) (6,14,37).
It is widely thought that pericytes overlying endothelial cells play a regulatory role in the developmental stability and maturation of blood vessels. In tumor vessels, pericytes are detached from ECs, resulting in dysregulated flow characteristics and increased permeability. An incomplete vascular basement membrane (BM) is a feature of tumor vasculature. The BM of tumor vessels exhibits heterogeneity in thickness, fracture or absence and is loosely connected to endothelial cells and pericytes (15). In addition, TME leads to abnormal EC morphology and function. Compared with normal ECs, tumor-associated ECs change from a quiescent state to an activated state, showing high proliferation and migration, overlapping growth, loss of polarity, loose connections, and enlarged cell space (38). Meanwhile, the absence of a smooth muscle layer is also an abnormal indication of tumor vasculature (39). These structural and cellular abnormalities lead to abnormal vascular function; the neoplastic vessels exhibit lower blood flow, susceptibility to leakage, impaired vessel perfusion and increased vascular permeability, which lead to an abnormal TME: higher interstitial fluid pressure, hypoxia, acidosis and necrosis (40).In addition, restricted blood flow and high tumor interstitial pressure result in impaired drug delivery and reduced infiltration of immune effector cells (14). Meanwhile, hypoxia and acidic microenvironments impair the antitumor function of infiltrating immune cells (41). The The effects of abnormal structure and function of the tumor vasculature on the tumor immune microenvironment Immunotherapies such as immune checkpoint blockade are nowadays increasingly used for tumor treatment.
The key to efficient immunotherapy is alleviating tumor immunosuppression and restoring the immune response (42). Tumor vascular abnormality is a major reason for the immunosuppressive TEM. As mentioned above, the abnormal structure and function of tumor blood vessels lead to interstitial hypertension and hypertonia and form a physical barrier, resulting in a reduced recruitment of immune effector cells (43). Besides, tumor-associated ECs express lower levels of adhesion molecules, such as intercellular adhesion molecule 1 (ICAM1), which prevents immune cells from adhering to endothelial cells, interferes with the trafficking of immune cells, and leads to a decrease in immune cell infiltration (especially T cell) (44, 45). Besides, upregulation of immune checkpoints such as PD-L1/2 in tumor-associated ECs leads to decreased recruitment and activation of cytotoxic T lymphocytes (CTLs) (46). It has been shown that Fas ligand (FasL), highly expressed in tumor-associated ECs, selectively mediates CTL but not Treg apoptosis (47).
Hypoxia is also a major driver that favors an immuno suppressive TME. Hypoxia causes immunosuppression via five mechanisms: (1) promoting t he a ccu mu lation of immunosuppressive cells in tumor tissues, such as Treg, myeloid-derived suppressor cells (MDSCs), tumor-associated macrophages (TAMs), etc.; (2) promoting the production and release of immunosuppressive factors such as TGFb, IL-10, Arg1, VEGFA (3) upregulating the expression of immunosuppressive molecules, such as PD-L1 on tumor cells, macrophages; PD-1 on CD8 + T cells; TIM and CTLA4 on MDSCs, Tregs, DCS and TAMs (4) inducing TAM to immunosuppressive M2 polarization phenotype which inhibits the maturation of DC cells and leads to the accumulation of immunosuppressive metabolites such as adenosine and lactate by changing the metabolism of tumor cells. (5) Attenuating survival, cytotoxicity and migratory activity of immune effector cells such as CD8 + cytotoxic T cells, CD4 + T cells and natural killer NK cells (48,49). In addition, acidosis is a trigger for immunosuppression, as it reduces IFN-g secretion by M1 macrophages and increases IL-1b secretion, inhibits T cell proliferation, promotes NK and T cell apoptosis, and inhibits CD8+ T cell and NK cell production of effector molecules (granzyme B, perforin, etc.). It also stimulates neovascularization by delaying the apoptosis of neutrophils and promoting infection (50, 51). Abnormal tumor vessels are characterized as hyperplastic, tortuous, dilated, overlapping, and exhibit disordered branching, which leads to local tissue hypoxia. Besides, Defects in vascular branching, pericyte coverage, and basement membrane coverage were also observed in disordered tumor vasculature. The abnormal vessel structure and components increase vessel permeability, leading to increased tumor metastasis, and the tumor endothelial cells showed decreased adhesion molecules expression (ICAM1, VCAM1), resulting in reduced adhesion of immune cells on the surface of tumor vessels and infiltration in the tumor microenvironment. Hypoxia and low PH conditions also severely reduce the normal immune function of tumor immune cells.
Excessive amounts of pro-angiogenic factors also contribute to the immunosuppressive TEM. For example, high-level VEGF promotes CTL depletion by upregulating the expression of immune checkpoint molecules (PD-1/PD-L1, CTLA4, LAG3, TIM3) (52). VEGF has also been associated with immune escape by inhibiting the differentiation and function of NK cells. In addition, VEGF triggers tumor evasion from the immune system by inducing Tregs and MDSCs proliferation (53). Growing evidence suggests that VEGF can promote M2 polarization of TAMs, inhibit the differentiation and maturation of DC cells as well as the antigen-presenting ability of mature DCs and reduce T cell infiltration (54, 55). As mentioned above, there is a complex interaction between the tumor vasculature and the tumor immune microenvironment. Normalizing the tumor vascular system increases immune cell infiltration and restores the antitumor capacity of immune cells, suggesting it is a potentially effective anti-cancer strategy (56).
Targets of nanomaterial-based anti-angiogenic therapy
Angiogenesis represents an attractive target for cancer therapies because of the vital effects of tumor vessels in tumor progression. Due to the lack of specific biomarkers and resistance associated with a combination of the traditional approach with anti-angiogenic drugs, the efficacy during clinical practice remains unclear. Nanotechnology provides a new approach whereby nanomaterials bind to the potential target and release anti-angiogenic drugs at specific sites (57, 58). The nano drug delivery systems can reduce adverse effects on non-target healthy tissue, provide accumulation into the target tissue and protect nucleic acids, including small interfering RNA (siRNA) and micro RNA (miRNA), from rapid degradation in the body (59). Mechanisms and targets of nanomaterial-based anti-angiogenic therapy are as follows (Table 2).
Pro-angiogenic and anti-angiogenic factors secreted by tumor and immune cell
Vascular endothelial growth factor A (VEGFA) is a crucial regulator of angiogenesis progression. It binds to VEGFR2 in vascular endothelial cells to stimulate the proliferation and trigger endothelial cell migration through the RAS-RAF-MAPK (mitogen-activated protein kinase)-ERK (extracellular signal-regulated protein kinase) signaling pathway (27). Accordingly, VEGF gene expression regulation has attracted significant interest in anti-angiogenic cancer therapy. In vitro and in vivo experiments showed that plasmid DNA containing a small hairpin RNA (shRNA) expression cassette with epidermal growth factor receptor (EGFR)-specific binding ligand GE11 and pH-sensitive fusogenic peptide GALA could target tumor cells and induce endocytosis, whereby nanoparticles (GE11&GALA-pshVEGF@SNPs) entered tumor cells to inhibit VEGF expression, reduce tumor angiogenesis, and inhibit tumor growth (60). The RNA interference (RNAi) system based on gene silencing mechanisms is a powerful tool in antitumor angiogenic therapy. SiRNA has also been applied for the regulation of VEGF expression. Asialoglycoprotein receptor (ASGPR) is a mammalian lectin specifically expressed on the hepatocytes. N-acetyl-galactosamine (GalNAc) residues can mediate the specific cellular uptake of the nanoparticle by targeting ASGPR-expressing liver cells as one of the specific ligands for ASGPR. Due to the nanoparticles' high compatibility and low cytotoxicity, they were modified with GalNAc to enter hepatocellular carcinoma, and siRNA was used to regulate VEGF transcription (61). However, the limitations of nonspecific absorption and low efficiency of cellular uptake reportedly hamper their clinical applications. Fortunately, a method was proposed to tackle this problem by generating siRNA in situ through enzyme-free DNA amplification (62). Moreover, a new system containing superparamagnetic iron oxide nanoparticles, calcium phosphate (CaP) and PEGpolyanion block copolymers could improve the efficiency of siRNA transportation and promote its aggregation (63). In addition, blocking VEGF rather than influencing gene expression in vivo can be an anti-angiogenic approach. VEGFA165 is thought to be the most frequently expressed isoform in tumors and is the most physiologically relevant VEGFA isoform (27). Synthetic copolymer nanoparticles (NPs) were synthesized as the protein affinity reagents (PARs) that bind with vascular endothelial growth factor (VEGF165) to inhibit angiogenesis in vivo (64) However, anti-angiogenic therapy through inhibition of the VEGF pathway has its limitations. In this respect, no Phase III clinical trial has shown anti-angiogenic benefits during glioblastoma therapy. Clavreul et al. considered it might be attributed to VEGF-independent angiogenesis, induction of tumor invasion and inefficient antiangiogenic factor delivery to the tumor (65). CD11b+Gr1+ cells, including neutrophils, macrophages, and myeloid-derived suppressor cells, promote growth factor granulocyte colony-stimulating factor (G-CSF) and promote myeloid cell-dependent angiogenesis via secreting protein Bv8. This angiogenic pathway bypassing VEGF represents the response mechanism to anti-VEGF therapy (65). Besides, cancer stem cells (CSCs) can drive tumor drug resistance. Interestingly, CSCs are a small subpopulation of cells with stem cell-like characteristics that can self-renew, divide asymmetrically to give rise to daughter cells and modulate the vascularization of the tumor by promoting the expression of HIF-1, VEGF and SDF-1/CXCL12 (66). Antivascular therapies are known to drive CSCs propagation and lead to the appearance of resistance mechanisms (67). Therefore, reducing CSCs in antivascular therapy can be applied in nanomaterial-based antiangiogenic therapy. In triple-negative breast cancer (TNBC), encapsulation of paclitaxel, verteporfin, and combretastatin (CA4) significantly reduces CSCs and gene expression of VEGFA as well as the VEGF receptor (68). In ovarian cancer, tumor-associated macrophages can be selected by binding G5-MTX nanoparticles with folate receptor-2(FOLR2) which is highly expressed in TAMs. These nanoparticles can overcome resistance to anti-VEGF-A therapy inhibition of VEGF-C and BRCA1 gene expression for depletion of TAMs and the reduction of CSCs. Also, through coculture of TAMs and tumor cells, a mild increase in sphere number of tumor cells suggested that TAMs promoted stemness. In other words, depleting TAMs could reduce stemness (69). Besides the VEGF pathway, multiple signaling pathways are related to nanomaterial-based anti-angiogenic therapy. It has been reported that the EGFR-PI3K-Akt pathway can be regulated at the gene level through CRISPR/Cas9 systems with a chitosan nanodelivery system to recognize the HepG2 cell adhesion molecules (CAMs) during the treatment of hepatocellular carcinoma. Tube formation of HUVEC cells was significantly inhibited after NPs treatment in vivo (70). In addition, it has been reported that Tyrosine kinase with immunoglobulin and epidermal growth factor homology-2 (Tie-2) is expressed in endothelial cells, and tie-2 positive macrophages (TPM) promote tumor vascular reconstruction and chemoresistance through the angiopoietin (ANG)/Tie2 signaling pathway. Researchers designed dual-responsive amphiphilic peptide (mPEG1000-K(DEAP)-AAN-NLLMAAS) to modify the small peptide T4 (NLLMAAS) to protect T4 and target the acidic tumor microenvironment. T4 released by the ultimate nanoformulation (P-T4) could interact with tie-2 to inhibit the phosphorylation of downstream molecule focal adhesion kinase, which is relevant to migration and tubule formation (71).
Pro-angiogenic and anti-angiogenic signaling pathways in vascular endothelial cells
As mentioned above, tumor endothelial cells (TEC) have characteristics that lead to leakiness and chaotic blood flow of tumor vessels. There are different markers, including EGFR, Pax2 and CXCR7 in TEC, which can bind with numerous ligands, such as peptides, nucleic acids aptamers, sugars and cationic charged materials. These markers can be harnessed to distinguish from normal endothelial cells and target TEC (72,73). Nanomaterials can be loaded with antiangiogenic drugs with different effects. Accordingly, target tumor vessel therapies can be classified into two categories: anti-angiogenic agents (AAs) and vascular disrupting agents (VDAs) (74).
As for the target of vascular endothelial cells, the VEGF signaling pathway has drawn much attention. Tumor endothelial marker 7(TEM7), referred to as PLXDC1, has a plexin-semaphorin-integrin (PSI) domain. The PSI domain exists in semaphorin, and its receptor acts as a vascular endothelial growth factor (VEGF) receptor in endothelial cells (75). In a recent study, tumor endothelial cell CD44 receptor was specifically targeted by hyaluronic acid (HA), and angiogenic gene PLXDC1 was silenced by siRNA by combining with chitosan (CH) for endocytosis. Thus HA-chitosannanoparticle/siRNA system provides a new approach for antiangiogenesis tumor therapy at the transcriptional level (76).
Besides, interleukin-8 (IL-8) is another pro-angiogenic factor activated by the VEGF pathway. It plays a role in the tube formation of endothelial cells. Poly (ethylene glycol)conjugated epigallocatechin-3-O-gallate (PEG-EGCG) loaded with sunitinib has been reported to gather in tumor tissue. Moreover, Sunitinib-loaded micellar nanocomplex (SU-MNC) inhibits the mRNA and protein expression of IL-8 in endothelial cells to inhibit proliferation and migration (77).
Multimodal antivascular nanodevice of AAs and VDAs for cancer therapy has been reported to maximize the therapeutic potential of antivascular therapeutics. Some nanodevices have additional anti-angiogenic capabilities, such as photothermal therapy (PTT), which create local high-temperature conditions via gold nanorod and photodynamic therapy (PDT), producing toxic reactive oxygen species via photosensitizers under near-Infrared light conditions (78, 79). Moreover, the precise localization characteristics of nanoparticles promote the efficiency of PTT and PDT. The ferritin nanocage (Fn) targeting CGKRK peptides in the tumor loaded with "556-Ph", a new type of metalla-aromatics complex of NIR-absorbing organic agent, yielded a better performance with PTT and PDT (80). Furthermore, combining PTT, PDT and VDA to destroy blood vessels can achieve better results. Nanotechnology can be used to develop a vascular disrupting agent that can be released before anti-angiogenic agents. VDAs can decrease the number of vessels by destroying the tumor's neo-formed vasculature and ensure nanoparticles can more efficiently target specific regions (67).
Other targets of nanomaterial-based anti-angiogenic therapy
Matrix metalloproteinases (MMPs), abundant in the tumor extracellular matrix (ECM), can decompose the extracellular matrix and disrupt the tumor microenvironment to promote the metastasis of cancer cells and induce angiogenesis. Moreover, they can biologically activate VEGF and induce endothelial cell motility (81). Therefore, MMPs are also regarded as another potential therapeutic target. Paclitaxel (PTX) nanocrystals were prepared with MMP-sensitive b-casein/marimastat (MATT) and PTX to treat breast cancer metastasis. These complexes could target tumor cells and the local tumor microenvironment and suppress the activities of MMP-2 and MMP-9 in vivo (82). In lung cancer, integrating chemotherapy drug carriers with Versatile polypeptide-LinTT1-Pvgli-Tat (LPT) increased tumorpenetrating capacity, reduced MMPs, inhibited tumor growth and decreased blood vessel density (83). A new nanomaterial called carvacrol nanoemulsion (CN) yielded anti-angiogenesis effects at multiple stages. CN influenced COX-2 to decrease MMPs and VEGF levels and could bind with the glycine residue of VEGF and the allosteric area of CD31 to disrupt adhesion between endothelial cells. In addition, CN could block MAPK and NF-kb pathways to interfere with the effect of VEGF and suppress inflammation to reduce angiogenesis, respectively (84).
Platelet aggregation is induced by tumor cells, tumorinfiltrating macrophages, and tumor endothelial cells by activating the coagulation pathway. Tumor-derived ADP, cathepsin B, and matrix metalloproteinases also play a crucial role. Furthermore, planets promote angiogenesis through microRNA, lipids, platelet-derived microparticles, and surface receptors (85). Recent reports suggest that platelets act as a membrane in nanoparticles and prevent tumor-specific immunological recognition (86). On the other hand, nanoparticles loaded with platelet inhibitors have been designed for tumor therapy. For example, a new nanoparticle coated with MMP2-cleavable peptides for targeted aggregation of MMP2 in tumor tissue contains R300 that can bind to platelet receptors and deplete platelets (87). Moreover, it can be used to increase drug permeability. However, more emphasis should be placed on bleeding complications in blocking specific tumorplatelet interaction sites (88).
Pericytes, perivascular cells associated with resistance to anti-VEGF therapeutics, play a critical role in tumor angiogenesis. Guan et al. developed new nanoparticles (TH10-DTX-NP) conjugated with TH10 peptide (TAASGVRSMH) and loaded with docetaxel. TH10 peptide could bind with NG2 receptors, highly expressed on the pericytes, and DTX could induce pericyte apoptosis. Consequently, it was shown that TH10-DTX-NP-induced pericyte apoptosis could decrease microvessel density and inhibit metastases in melanoma therapy (89).
Over recent years, it has been found that vasculogenic mimicry (VM) of tumor cells, an alternative circulatory system, plays a crucial role in tumor angiogenesis. Highly aggressive tumor cells can form vessel-like structures by mimicking endothelial cells. These structures can also provide sufficient blood supply and nutrients to tumors (90), providing an effective nanomaterialbased anti-angiogenic strategy. Moreover, CRGD was conjugated with heparin and folic acid to form two nanoparticles (CRGD-NPS1 and CRGD-NPS2). CRGD-NPS2 could regulate the MMP2/ Laminin 5c2 signal pathway to inhibit endothelium-dependent vessels (EDV) and tumor cell-mediated VM in selected ovarian cancer cells capable of forming VM channels (91).
Nanomaterials with tumor vasculartargeting properties promote the normalization of tumor vasculature
Tumor vasculature-targeting nanomaterials induced normalization of tumor vasculature Normalization of tumor vasculature reportedly improves the effect of antitumor therapy by correcting structural abnormalities of tumor vessels and restoring normal function to a certain extent. This finding suggests that sustaining the balance between proangiogenic and anti-angiogenic factors is essential to decreasing micro-vessel density, improving pericyte coverage and regulating vascular permeability and perfusion. As a result, normal vessels relieve hypoxia to inhibit tumor invasion and recurrence ( Figure 2). Moreover, vascular normalization is conducive to subsequent treatment, including chemotherapy (92), radiotherapy (93) and immunotherapy (94). Importantly, nanotechnology offers an excellent platform to improve the The normalization of tumor vasculature restores normal vessel function like decreasing micro-vessel density, improving pericyte coverage, increasing endothelium tight junctions and promoting immune cell infiltration. Various nanoparticle carriers including polymer micelle nanoparticles, lipid nanoparticles (LNPs), gold nanoparticles and silica nanoparticles have been applied to target various cell types, such as tumor cells, macrophages, endothelial cells, pericytes and fibroblast cells. The main targeted signaling are VEGF/VEGFR, TGFb-Smads, DLL4/Notch, Hippo/YAP, EGFR-PI3K-AKT and HIF1a. bioavailability and stability of drugs, reduce side effects and achieve combination therapy. Hence, various nanomedicines have been applied to target abnormal tumor vessels for more efficient therapy (95).
Epithelial-mesenchymal transition (EMT) is a process by which epithelial cells lose their adhesiveness and gain increased motility, contributing to VM formation and tumor cell metastasis. It can be stimulated by many factors, including cmyc, MMP-2 and HIF-a (96). Over the years, gold nanoparticles (AuNPs) have been applied in nanomaterial-based vascular normalization therapy of breast cancer (97), melanoma (96,98), liver cancer (99) and metastatic colorectal cancer (100). Intriguingly, AuNPs could inhibit MMP-2 and c-Myc to suppress EMT and the migration of HUVECs (96). Fan Pan et al. conjugated gold nanoparticles and recombinant human endostatin to modulate vascular normalization in metastatic colorectal cancer. They found that NPs inhibited EMT via interruption of anterior gradient 2 (AGR2)-mediated angiogenesis, a latent tumor angiogenesis factor regulated by hypoxia-induced factor-1 (HIF-1) (100). Changes in tumor vessels after AuNPs vascular normalization therapy include a decrease in vascular density, permeability and hypoxic area vascular density and increased vascular perfusion, pericyte coverage of tumor and a -smooth muscle actin (a -SMA), an index of vessel maturation (96)(97)(98)(99)(100).
It is well-established that TAMs play a pivotal role in tumor angiogenesis through VEGF and other pathways, which leads to abnormal tumor vasculatures (101). TAMs are generally classified into immunosuppressive M2-type and immunosupportive M1type. M2-type macrophages represent the dominant type of TAMs related to tumor growth, progress and metastasis. Furthermore, myeloid cell infiltration and differentiation are triggered by a hypoxic microenvironment; thus, more TAMs are recruited to the tumor site, which leads to poor therapeutic outcomes (102). Tian et al. designed calcium bisphosphonates (CaBP-PEG) nanoparticles that gather in tumor tissue through enhanced permeability and retention (EPR). In breast cancer treatment, NPs reduced macrophages from M2-type to M1-type and blocked the TAMs-stimulated angiogenesis signaling pathway. The dilation of tumor blood vessels and saturated oxygen indicated normalization of tumor vasculature and relief from hypoxia (103).
Other targeted nanomaterials induce normalization of tumor vasculature
Current evidence suggests that tortuous and highly permeable tumor vessels cause accumulation of vascular macromolecules in tumor tissues and high interstitial fluid pressure (IFP), which prevents drug penetration (104). Furthermore, high IFP can aggravate the abnormal vascular network and hypoxia environment (105). Sirin Yonucu et al. demonstrated that tumor vascular normalization could restore intravascular pressure gradients and prune non-functional vessels by building a mathematical model and analyzing it with cases. Peripheral aggregation of drugs as micelles, nanoprobes and liposomes was changed into aggregation in the tumor center (104). Hence, vascular normalization and regulation of IFP decrease tumor repopulation caused by heterogeneous drug accumulation and increase the probability of treatment success. Hyaluronic acid (HA), a key component in ECM, is highly expressed in tumor tissue. Hyaluronidase (HAase) has been used to decompose HA and decrease IFP to enhance chemotherapy drug penetration for many years (106). Jingjing Jiao et al. designed the nanoparticle (PM@HAase-mPEG), combining a porphyrin-based metallacage, HAase and DSPE-mPEG2000 to normalize blood vessels, relieve hypoxia and promote the cellular accumulation of drugs. The results indicated that PM@ HAase-mPEG treatment could increase the density of blood vessels, blood perfusion and oxygen content. In addition, normalizing tumor vasculature via HAase could enhance the efficacy of PDT therapy for breast cancer (105).
Tumor-associated fibroblasts (TAFs), derived from the "activation" of tumor stromal cells such as fibroblasts, can create tension in matrix components such as collagen. Mechanical vascular compression contributes to the abnormal structure of tumor vessels and hindrance of drug penetration (107). Moreover, depletion of TAFs has been shown to decompress vessels and improve perfusion (108).
Interestingly, nanotechnology can be harnessed to promote long-term blood circulation and high accumulation of drugs in tumor tissue. Mark J. Ernsting et al. designed Cellax-DTX polymer, a conjugate of docetaxel (DTX), polyethylene glycol (PEG), and acetylated carboxymethylcellulose. Cellax-DTX reduced CAF content and increased duct luminal area and blood perfusion during the treatment of pancreatic ductal adenocarcinomas (109). Furthermore, TAF-targeted normalization of tumor vasculature could improve nanomaterial-based tumor drug delivery. Celecoxib, a selective COX-2 inhibitor, was designed with PTX-loaded micelles to reduce TAFs and normalize tumor vessels. The mechanism of TAF depletion involved suppression of fibroblast proliferation and activation stimulated by FGF-2 and transforming growth factor beta-1 (TGF-beta1) by inhibiting ERK1/2 phosphorylation, inhibition of the CXCL12/CXCR4 axis, induction of G1-S cell cycle arrest and apoptosis of TAF and reprogramming of TAF into normal fibroblasts. Consequently, microvessel density and increased pericyte coverage on endothelial cells was reduced after lung cancer treatment. Furthermore, it increased the in vivo delivery of micelles and improved the therapeutic benefits of PTX-loaded micelles (110). The interaction of nanomaterials and vascular normalization demonstrates that their combination may have great potential to improve tumor treatment.
The synergistic effects of nanomedicine induced vascular normalization in tumor immunotherapy
The abnormal structure and function of tumor vessels disrupt the tumor immune microenvironment. On the one hand, abnormal tumor vessels decrease antitumor infiltrating lymphocytes via high IFP, downregulation of adhesion molecules and hypoxia, which activates inhibitory signaling pathways for antitumor immune response. On the other hand, the hypoxic tumor microenvironment can recruit Treg and promote TAM polarization to immunosuppressive M2-like phenotype to participate in immune evasion (94). Moreover, normalization of tumor vasculature is beneficial in rescuing these immunosuppressive outcomes. Changes in immune cell infiltration in nanomaterial-induced tumor vascular normalization include increased levels of tumor-infiltrating CD4+ and CD8+ T lymphocytes, natural killer cells and dendritic cells, decrease in myeloid-derived suppressor cells and polarization of TAMs from M2-to-M1 type (97,(111)(112)(113)(114). Immune regulatory changes may be attributed to the direct effects on immune cells, including depletion of M2-type macrophages, indirect effects when they induce changes in protein expression on endothelial cells or tumor cells and rescue hypoxia and physical effects through the morphology of vascular normalization or the reduction of ECM (115). Lenvatinib, an inhibitor of VEGFRs, was loaded in Bi/Se nanoparticles to promote tumor vascular remodeling. The anti-angiogenic drug Lenvatinib was reported to enhance memory T-cell recruitment and CD8+ T lymphocyte, which can be potentiated by Bi/Se nanoparticles (111). Furthermore, the expression of TGF-b genes involved in the ECM components synthesis was inhibited by tranilast combined with Doxil nanomedicine to induce tumor vessel normalization. The distances between cancer-associated fibroblasts and CD3+ T cells were measured to reflect collagen barrier size. This finding represents another way to shape the tumor microenvironment and restrict T cell infiltration (114).
The interactions between anti-angiogenic therapies and immunotherapies could be considered a 'two-way street'. A series of preclinical and clinical studies indicated the mutually improved effect of anti-angiogenic and immune-checkpoint inhibitors (94,115). Of course, only if the action of antiangiogenic drugs are limited directly to the tumor with little influence on normal tissues will disrupting tumor vasculature be beneficial for immunotherapy. Therefore, nanotechnology is needed to prevent negative effects on healthy non-target tissue while providing accumulation into the target tissue (116). In addition, the nanomedicine-mediated PDT and PTT can promote dendritic cell maturation and immune cell activation. It is reported that PDT and PTT synergetic with immune therapy for cancer treatment (117,118). Furthermore, nanoparticles can be created to enhance cooperative and coordinated therapeutic effects by co-delivery and targeting of many therapeutic agents, as well as through immunomodulation. Nanoparticles have the potential to enhance treatment results by assuming these functions in combination therapy techniques (119). It is known that the immune checkpoint molecule programmed cell death protein 1(PD-1) can bind with its ligand (PD-L1) to protect tumor cells from immune surveillance via T cell exhaustion. CD8+ T cell infiltration plays a key role in anti-PD-1/PD-L1 therapy (112). Combining tumor vascular normalization with anti-PD-L1 therapy in breast cancer (97,114) and hepatocellular carcinoma (112) has attracted significant interest in recent years. As a result, combination therapies could increase CD3+CD8+T cells, inhibit tumor proliferation and prevent tumor metastasis, providing a promising strategy to enhance immune-checkpoint inhibitor efficacy and the antitumor immunity of highly metastatic tumors.
Vascular normalization can even regulate "cold" immune microenvironment and provide a platform for sequential immunotherapy. The CD40 agonist stimulates antigenpresenting cells to process tumor-associated antigens produced by dying tumor cells, reversing immunosuppressive tumor microenvironments. However, CD40 may not have significant anticancer efficacy as a single treatment in patients with immunologically "cold" tumor (120). Xiang Ling et al. created the combination of anti-angiogenesis bioresponsive nanoparticles and chemotherapy regimens with CD40 agonist in a lung cancer mouse model. Compared with single treatment, combination therapies can reverse immunosuppression to elicit s t r o n g s y s t e m i c a n t i t u m o r i m m u n i t y ( 1 1 3 ) . F o r immunosuppressed tumors, nanomedicine induced vascular normalization provides a new idea for the application of immunotherapy.
Conclusion and prospects
Since the antitumor angiogenesis therapy was first proposed, the structure and function of the tumor microvasculature have gradually been revealed in the past two decades, along with advances in research tools and imaging techniques, and significant progress has been made in understanding the key mechanisms of angiogenesis and vascular remodeling in solid tumors, especially those involved in tumor angiogenesis and tumor vascular network maturation, and the effects of these structures on other components of the TME. The close interactions between these structures and other components of the TME are essential for the development of novel antiangiogenic drugs and better guidance of combination antitumor therapy.
In recent years, immunotherapy has been widely studied and yielded promising therapeutic effects in preclinical studies. However, clinically, some patients do not respond to immune checkpoint therapy or are resistant to long-term use. It should be borne in mind that long-term use of immunotherapy treatment also presents serious cardiovascular side effects, etc. Achieving more efficient targeted delivery and improving suppressive TME while reducing toxic side effects warrants further research. Indeed, the past decade has witnessed unprecedented inroads in nanomedicine with the development of effective delivery systems that are not limited to targeting tumor cells but also normalize tumor vascular structure and function, reduce intratumor hypoxia, and increase blood perfusion while increasing immune cell infiltration and activating immune cells to achieve better immune functions in the TME.
Overall, the abnormalities of tumor vascular structure and function and its effects on the tumor microenvironment were summarized in this review, and the application of nanostrategies in combination with multi-targets and multicombination nano-drugs showed significant anti-cancer effects in a wide range of solid tumors with low systemic toxicities, while exhibiting more low-dose and efficient antitumor effects when combined with other chemotherapeutic agents and immunotherapy.
However, several important issues remain to be addressed before anti-angiogenic nanodrugs are translated into clinical applications. First, the efficacy and safety of anti-angiogenic nanodrugs have only been evaluated over a relatively short period (a few days or weeks) in most current studies. Indeed, long follow-up observations and toxicological experiments are needed to ensure the absence of local or systemic toxic side effects of specific nanodrugs and other components before clinical translation. Currently available functional identification methods for tumor vascular normalization are only applicable in animals, and the establishment of reliable biomarkers and assays for vascular normalization for clinical practice is of great significance to refining the applicability of nanomedicines to cancer patients. Most current nanomedicines have been evaluated using allogeneic transplantation tumor models, and the application of spontaneous tumor models or PDX models would be more beneficial for evaluating the translational application value. Besides, quality control and the dose and mode of administration of nanomedicines warrant further evaluation in clinical trials. In addition, based on the series of issues mentioned above, almost all nanomedicines have failed to achieve the expected efficacy in antitumor clinical trials and clinical applications. More than 100 antitumor clinical trials of nanomedicines have been registered in clinical trials(https:// clinicaltrials.gov/), including those based on LNP, Polysiloxane Gd-Chelates based nanoparticles (NCT04881032), Ceramide NanoLiposome (KNAN2001), SNB-101 (NCT04640480) and others. However, until now, only paclitaxel albumin-stabilized nanoparticle formulation has shown increased percentage of patients with response in clinical trials, but it also showed increased serious and other adverse events, such as hemoglobin decreased, neutrophil count decreased (NCT00626405). Therefore, there are still many issues that need to be thought and solved to achieve clinical translation of nanomedicines.
Despite these limitations, it is widely expected that the rapid development of nanomedicine will solve and greatly improve these problems in the next 5-10 years, and nanomedicines are expected to become the first or second line of standardized treatment for cancer patients.
|
v2
|
2022-11-30T14:47:42.753Z
|
2022-11-29T00:00:00.000Z
|
254072881
|
s2orc/train
|
The predictive ability of routinely collected laboratory markers for surgically treated spinal metastases: a retrospective single institution study
Purpose We aimed to identify effective routinely collected laboratory biomarkers for predicting postoperative outcomes in surgically treated spinal metastases and attempted to establish an effective prediction model. Methods This study included 268 patients with spinal metastases surgically treated at a single institution. We evaluated patient laboratory biomarkers to determine trends to predict survival. The markers included white blood cell (WBC) count, platelet count, neutrophil count, lymphocyte count, hemoglobin, albumin, alkaline phosphatase, creatinine, total bilirubin, calcium, international normalized ratio (INR), platelet-to-lymphocyte ratio (PLR), and neutrophil-to-lymphocyte ratio (NLR). A nomogram based on laboratory markers was established to predict postoperative 90-day and 1-year survival. The discrimination and calibration were validated using concordance index (C-index), area under curves (AUC) from receiver operating characteristic curves, and calibration curves. Another 47 patients were used as a validation group to test the accuracy of the nomogram. The prediction accuracy of the nomogram was compared to Tomita, revised Tokuhashi, modified Bauer, and Skeletal Oncology Research Group machine-learning (SORG ML). Results WBC, lymphocyte count, albumin, and creatinine were shown to be the independent prognostic factors. The four predictive laboratory markers and primary tumor, were incorporated into the nomogram to predict the 90-day and 1-year survival probability. The nomogram performed good with a C-index of 0.706 (0.702–0.710). For predicting 90-day survival, the AUC in the training group and the validation group was 0.740 (0.660–0.819) and 0.795 (0.568–1.000), respectively. For predicting 1-year survival, the AUC in the training group and the validation group was 0.765 (0.709–0.822) and 0.712 (0.547–0.877), respectively. Our nomogram seems to have better predictive accuracy than Tomita, revised Tokuhashi, and modified Bauer, alongside comparable prediction ability to SORG ML. Conclusions Our study confirmed that routinely collected laboratory markers are closely associated with the prognosis of spinal metastases. A nomogram based on primary tumor, WBC, lymphocyte count, albumin, and creatinine, could accurately predict postoperative survival for patients with spinal metastases.
undergo surgery should be balanced against the limited life expectancy and high disease burden in many of these patients.
Accurate assessment of expected survival is an important prerequisite for an optimized therapeutic plan and objective physician-patient communication [6][7][8][9]. The accuracy of prediction algorithms can be improved by adding useful variables [10][11][12][13]. The predictive value of laboratory parameters for a variety of tumors have been widely recognized [14][15][16][17]; for spinal metastases, current evidence suggests serum albumin, hemoglobin, white blood cell (WBC) count, platelet-lymphocyte ratio (PLR), neutrophil to lymphocyte ratio (NLR), alkaline phosphatase, et al. (Table 1) [13]. Laboratory parameters can be measured and objectively evaluated to identify normal biological or pathogenic processes including the nutritional status, the reserve function of the organ systems, and the inflammatory status of the body [11,18,22,23]. Compared to commonly accepted prognostic factors, the prediction ability of routinely collected laboratory markers has received increasing attention in recent years. However, the prognostic markers suggested in different studies vary. No previous studies have comprehensively assessed the potential laboratory markers.
In this study, we aimed to identify effective biomarkers for predicting postoperative outcomes in surgically treated spinal metastases and attempted to establish an effective prognosis prediction model.
Study design and subject selection
We retrospectively reviewed data from all patients who underwent surgery for spinal metastases at our institution from January 2017-August 2020. These patients were used to develop the prediction model. Another group of patients undergoing surgery from September 2020 to January 2021 was used as the validation group. Our institutional review board approved a waiver due to its retrospective nature. A multidisciplinary team managed the therapeutic approaches. The decision to perform surgery was based on the patient's medical fitness, clinical presentation (neurologic deficit, spinal instability, intractable pain), oncological status, and feasibility of surgical treatment. Patient follow-ups were conducted prospectively by the Linkdoc Company under the authority of the hospital. Postoperative follow-up evaluations were scheduled 3, 6, and 12 months after the first year, every 6 months for the next 2 years, and annually thereafter.
The inclusion criteria were: (1) The patient was > 18 years when surgery was performed; (2) the diagnosis of spinal metastasis was pathologically confirmed; (3) the (2) the surgical procedure was percutaneous vertebroplasty alone.
Statistical analysis
To compare the patient and tumor data between the training group and the validation group, the Student t test was used for continuous variables. The chisquare tests (Pearson or Fisher exact test as appropriate) were used for categorical variables.
Log-rank tests were used to perform survival analysis. Kaplan-Meier analysis was used to create the survival curves. We computed univariate Cox analysis for all markers, factors with P value ≤0.1 were subjected to multivariate Cox analysis. The optimal cutoff laboratory marker value to create survival curves was determined through a log-rank test by taking the split with the highest significance [24].
The multivariate analysis guided the development of a nomogram. Each β regression coefficient of every parameter was proportionally transformed to a scale from 0 to 100. The factor with the highest β coefficient was assigned 100 points. The total points are mapped to obtain the 90-day, and 1-year survival probability.
Concordance index (C-index) and area under curves (AUC) from receiver operating characteristic (ROC) curves was used to measure discrimination. Calibration curves were used to evaluate calibration. Using AUC for survival at 90-day and 1-year, the nomogram was compared to Tomita, revised Tokuhashi, modified Bauer, and SORG ML.
The data were statistically analyzed using R version 4.1.3 for Windows (R Project for Statistical Computing, http:// www.r-proje ct. org/). A two-tailed P value of < 0.05 were considered statistically significant.
Patients and characteristics
Based on the inclusion and exclusion criteria, 268 patients (124 male, 144 female) with an average age of 55.4 ± 10.6 years (range, 23-78 years) were included to assessed the potential prognostic laboratory markers and to develop a prediction model. Neurological deficits were observed in 41.8% of the patients preoperatively. The primary tumor histology was as follows: lung (n = 71, 26.5%), breast (n = 52, 19.4%), multiple myeloma (n = 21, 7.8%), Table 3 Univariate and multivariate analysis of the potential prognostic laboratory markers with primary site * P value of < 0.1 in univariate analysis and subjected to multivariate analysis ** P value of < 0.05 in multivariate analysis and used for nomogram construction Table 2.
Another 47 surgically treated patients were also enrolled to validate the accuracy of the prediction model developing using the training group. The datails of the validation group were also summarized in Table 2.
Construction and validation of the nomogram
According to the results of the multivariate Cox proportional hazards regression model, the five significantly independent prognostic factors, including the four predictive laboratory markers and primary tumor, were incorporated into the nomogram to predict the 90-day and 1-year survival probability. To obtain the corresponding point of each predictor, a straight line was drawn from each predictor upward to the points axis. The total point was calculated by summing up all the individual points. By directly drawing a line from the total point axis to the two axes on the bottom, the 90-day and 1-year survival probability after surgical treatment for spinal metastases is determined (Fig. 2). The nomogram was validated with a C-index of 0.706 (95% CI, 0.702-0.710). The calibration curves showed favorable consistency between the predicted probability and the observed probability of the 90-day and 1-year overall survival ( Fig. 3 and Fig. 4).
Discussions
Patients with spinal metastases experiencing mechanical instability, nerve compression, and pain can benefit from surgery [3,[25][26][27]. However, surgical decisions carry significant, non-negligible risk of surgical complications and treatment cost [6,7,9]. Accurate assessment of life expectancy is key to optimized treatments and objective physician-patient communication [8,11,13]. Effective identification and evaluation of prognostically predictive factor can greatly contribute to targeted patient care and avoiding overtreatment or undertreatment. The potential prognostic value of routinely collected laboratory markers has frequently been highlighted in many newer prediction algorithms due to improved accuracy, such as revised Katagiri [18], SORG nomogram [20], SORG ML [11], and New England Spinal Metastasis Score [19]. However, these algorithms use different laboratory items and subcomponent weights for analysis. Here, we systematically assessed potential laboratories markers and quantified their impact on prognosis for spinal metastases to address the discrepancies between such algorithms. Furthermore, we developed a nomogram based on significantly laboratory markers to reliably predict postoperative survival for patients with spinal metastases.
Serum albumin level is a well-established metric for assessing nutritional status, disease severity, and progression [28]. Hussain et al . [29] found that preoperative hypoalbuminemia was associated with increased risk of perioperative adverse events following surgical decompression of spinal metastases, including perioperative mortality, complication, transfusion, prolonged hospitalization, and non-home discharge. The NESMS [19], revised Katagiri [18], and SORG ML [11], have also incorporated serum albumin as a prognostic factor.
Anemia occurs frequently in cancer patients, especially in those undergoing chemotherapy and radiotherapy [30]. Cancer-induced anemia has a complex etiological nature [31]; studies have shown that it is a factor that adversely affects cancer patients' survival [11,32,33]. Anemia can negatively impact survival by increasing patient frailty, complication risks, delaying initiation or failure of adjuvant therapy completion [31,34]. Scoring systems incorporate hemoglobin level including the SORG classic [33], SORG nomogram [33], and SORG ML [11].
Elevated WBC indicates of systemic inflammation and approximately 1-10% of patients with nonhematopoietic malignancies develop tumor-related leukocytosis, which is associated with a poor prognosis [35,36]. Inflammation in the tumor microenvironment facilitates cancer development and progression [16,37]. Inflammatory conditions promote proliferation and survival of malignant cells, angiogenesis, and metastasis, subverting adaptive immune responses and altering hormone and chemotherapy efficacy [37]. Scoring systems incorporate WBC count including the SORG classic [33] and SORG nomogram [33]. Many studies have demonstrated that increased lymphocyte infiltration of tumors correlates with better response to cytotoxic therapy and better prognosis in cancer patients [16,38]. NLR and PLR have been identified in previous publications as prognostic indicators [21]. In the present study, NLR and PLR were found to be significant in univariate analysis but not in multivariate analysis. Serum creatinine is a byproduct of muscle metabolism that is excreted by the kidneys. Elevated blood creatinine indicates active proteolytic activity and impaired renal function, serving as a poor prognostic factor for patients with malignancy [39,40]. For spinal metastases, the SORG ML incorporated it into the algorithm [11]. To our surprise, our prediction model demonstrated satisfactory accuracy based only on laboratory markers and primary tumor histology, without other clinical predictors, such as visceral metastases, general condition, or neurological status. This a reasonable finding, since laboratory markers, body status, and tumor burden are closely linked [15,16,38,39]. Furthermore, compared to other parameters, using laboratory markers for prognosis prediction is relatively objective, clear, and consistent [23]. The individual variations in patients with spinal metastases is large and some variables may be predictive for a specific subset of patients, but not others, reducing the overall reliability of the model.
Poor baseline general condition is considered as an adverse factor in many scoring systems [11,19,33,41,42]. However, it may be resolved in a relatively short period of time after the surgery, especially for patients with pathological fractures or mild neurological deficits [43]. Moreover, the intra-and interobserver variability may also affect the prediction accuracy [44]. Visceral metastasis is another important prognostic factor that has been used in the Tokuhashi [41,45] and Tomita [46], classified into treatable and untreatable (by operation or trans arterial embolization). However, the relevant criteria are not clear, and a visceral metastasized lesion is rarely removed surgically for patients with spinal metastases. Classification of brain metastases as different from metastases from other organs is also controversial [13]. Due to differences in imaging tests for tumor staging, the results of systematic assessment can also vary over time and in different regions.
Compared to other existing prediction algorithms, our nomogram seems to have better prediction ability than Tomita, revised Tokuhashi, modified Bauer, and has comparable prediction ability compared to SORG ML. The accuracy of these scoring systems in the present study was similar to currently published literature [12,13,47]. Although this was a retrospective study, we believe that our finding are reliable. First, the results of laboratory data were less affected by the nature of the retrospective study. Second, patient follow-up was conducted prospectively by the hospital. Laboratory indicators are more objective and less influenced by examination methods when compared to predictors relying on imaging studys and subjective assessment by physicians. The prediction model built by data mining and combination of routinely collected laboratory markers will be more practical and more universal.
The findings of this study must be seen considering the following limitations. First, the study was based on a cohort from a single regional oncology center with risk of model overfitting, external validation is needed for the prediction model to prove the generalizability of the model. Second, we did not analyze some prognostic markers that are not routinely collected in clinical practice, such as C-reactive protein, and lactate dehydrogenase [18]. Prospective studies should include these tests in the protocol to expand the analytical power of the predictive model.
Conclusion
Our study confirmed that many routinely collected laboratory markers can serve as promising predictive factors for postoperative outcomes of patients with
|
v2
|
2022-11-30T15:07:45.746Z
|
2022-11-29T00:00:00.000Z
|
254072245
|
s2orc/train
|
Impact of chronic graft-versus-host disease on quality of life and cognitive function of long-term transplant survivors after allogeneic hematopoietic stem cell transplantation with total body irradiation
Background Total body irradiation (TBI)-based-conditioning before allogeneic hematopoietic stem cell transplantation (allo-HSCT) is standard of care in patients with acute myeloid leukemia (AML) but can cause long-term morbidity. Data on the impact of chronic Graft-versus-host disease (cGvHD) on cognitive function (CF) and quality of life (QoL) of long-term transplant survivors are sparse. Methods We analyzed patient-reported outcomes focusing on progression-free AML patients and 1st allo-HSCT applying a standardized TBI-technique with an average dose rate of 4 cGy/min to the total body and lung shielding in case of doses > 8 Gy. Instruments included the Functional Assessment of Cancer Therapy-Bone marrow transplant (FACT-BMT, version 4), the FACT-Cognition Function (FACT-Cog, version 3) and the Patient Health Questionaire-4 (PHQ-4). We put focus on the impact of cGvHD and compared the results to normative data derived from the general population. Results Out of 41 eligible patients contacted, 32 (78.0%) patients with a medium follow-up of 154 months (Interquartile range 113, 191 months) participated in the study. Eleven patients (34.4%) had active cGvHD, 11 (34.4%) resolved cGvHD and 10 (31.3%) never had cGvHD. Patients with active cGvHD had poorer FACT-BMT, FACT-Cog and higher PHQ-4 scores compared to patients with resolved cGvHD or who never had cGvHD. Outcomes were similar in patients with resolved cGvHD and those who never had cGvHD. Patients with active cGvHD had similar FACT-Cog, but lower FACT-BMT in comparison to normative data. However, the overall patient sample had similar FACT-BMT and FACT-Cog in comparison to normative data. Conclusion Our data indicate that CF of long-term survivors upon TBI-based allo-HSCT is not impaired, even in the presence of active cGvHD. However, active cGvHD has a negative impact on QoL. Trial registration The local Ethics Board of the University of Regensburg approved this study (Number 20-1810_1-101).
Background
Allogeneic hematopoietic stem cell transplantation (allo-HSCT) is a curative treatment modality for selected patients with acute myeloid leukemia (AML). Despite increasing survival rates, allo-HSCT can be associated with long-term morbidity and mortality [1]. The influence of total body irradiation (TBI) as part of the conditioning regimen and chronic graft-versus-host disease (cGvHD) on cognitive function (CF) and quality of life (QoL) of very long-term survivors is still unclear. In this study, we analyzed patient-reported CF and QoL focusing on long-term transplant survivors after 1st allo-HSCT applying a standardized TBI-technique as conditioning regimen. Since cGvHD can have a significant impact on QoL and CF [2] we analysed its impact as additional relevant covariable.
Data collection
We analyzed patient-reported QoL, CF, and symptoms of depression and anxiety in patients with primary or secondary AML who received their 1st allo-HSCT with TBIbased protocols at the Department of Hematology of the University Hospital Regensburg between 1999 and 2017. All patients had a follow-up time of at least 2 years and were relapse-free for at least 2 years. The 2 year follow up was chosen since the primary aim was long term outcome and reports have indicated a protracted recovery of neurocognitive function [3]. Donors included matched sibling donors (MSD), matched unrelated donors (MUD), mismatched unrelated donors (MMUD) and haploidentical/mismatched related donors (MMRD). Source of stem cells were peripheral blood, bone marrow or cord blood. Patients completed the Functional Assessment of Cancer Therapy-Bone marrow transplant (FACT-BMT, version 4), the FACT-Cognition Function (FACT-Cog, version 3), the Patient Health Questionaire-4 (PHQ-4) and a questionnaire about sociodemographic data. All patients visited the Department of Hematology of the University Hospital Regensburg for routine follow-up visits. Clinical data including cGvHD status were abstracted from the medical charts of the Departments of Hematology and Radiation Oncology of the University Hospital Regensburg. Transplantation variables included gender, diagnosis, patient age, Karnofsky performance score (KPS), hematopoietic cell transplantation-comorbidity index (HCT-CI), as described by Sorror et al. [4], 2017 European LeukemiaNet (ELN) genetic risk stratification, as described by Döhner et al. [5], disease status, stem cell source, intensity of conditioning regimen, chemotherapeutic regimen, recipient and donor characteristics (donor type, donor age, HLA-compatibility, gender match, cytomegalovirus serostatus), GvHD prophylaxis and the use of rabbit anti-thymocyte globulin (ATG). Data closing was April 2021. The local Ethics Board of the University of Regensburg approved this study (Number 20-1810_1-101).
Treatment plan
The choice of conditioning regimen was based on the oncologists´ discretion and dependent on patient age, disease risk and comorbidities. All patients included in the analysis received TBI as part of a complex conditioning regimen. TBI was performed in a consistent manner with an average dose rate of 4 cGy/min to the total body and lung shielding in case of doses > 8 Gy. Over the years, four treatment protocols were used (8 Gy TBI/Cyclophosphamide/Fludarabine, FLAMSA-RIC/ Cyclophosphamide/4Gy TBI, 12 Gy TBI/Cyclophosphamide and 8 Gy TBI/Fludarabine). From 2000 to 2013, two Siemens Primus linear accelerators (Siemens Medical Systems, Inc., Concord, CA) were used for TBI, and from 2013 to 2017 two linear accelerators of type Elekta Synergy ™ with an Agility ™ head (Elekta Ltd, Crawley, UK) were applied. We proved clinically good dose distributions and similar parameters with both linear accelerators [6]. All patients received 6 megavoltage (MV) photon beams. Patients were treated with a twice-daily fractionation and a minimum of 6 h between fractions. Patients were lying down on a couch at the floor level in supine and prone positions to extend the source-to-skin distance. A plate of Makrolon ® polycarbonate of 1 cm thickness was placed on a stand above of the patient to neutralize the skin sparing by the buildup effect. The low diameter in the neck region was compensated by using a bolus of plastic modeling mass. Eight rotational arcs were used per patient position. The average time to deliver each fraction was 50-60 min per side (supine and prone). Additional fixed beams were used in cranial and caudal direction to compensate for the effects of inverse square variation with increasing distance. Two individual lung shields of MCP96 of calculated thickness were designed in case of doses > 8 Gy to reduce the total dose to the center of the lung to 3.5 Gy in supine and prone positions (total dose of 7 Gy). Radio-oncologists contoured two individual lung blocks for each patient on a CT scan with Keywords: Total body irradiation, Acute myeloid leukemia, Chronic graft-versus-host disease, Allogeneic hematopoietic cell transplantation, Quality of life, Cognitive function a 1-2 cm margin between the edge of the lung on the CT film and the edge of the block. Lung blocks were tailored to avoid shielding of the vertebrae. MV-imaging verified the shielding positions. Areas of the chest wall that were shielded by the blocks were supplemented once a day with electron beams to achieve the full dose to the thoracic walls. The electron fields delivered a supplemented dose of 5 Gy for 12 Gy regimens. In vivo dosimetry was used to verify the dose delivery on several points on the patient´s body, demonstrating the uniformity of the dose distribution [6].
QoL measures and other data sources
The FACT-BMT (Version 4.0) is a self-report questionnaire. The FACT-BMT combines the 27-item FACT-G total score (score range 0-108), an assessment of physical well-being (PWB, score range 0-28), social/family wellbeing (SWB, score range 0-28), emotional well-being (EWB, score range 0-24) and functional well-being (FWB, score range 0-28) with a 10 item Bone Marrow Transplant subscale (BMTS, score range 0-40) to evaluate self-reported concerns after transplantation. Patients rate on five-point Likert scale the frequency with which each concern was recognized in the past 7 days. The FACT-BMT-Trial Outcome Index (FACT-BMT-TOI, score range 0-96) is the sum of PWB, FWB and the BMTS-score. The FACT-BMT total score (score range 0-148) is the sum of the BMTS score and of the FACT-G total score. Higher scores indicate better QoL. The FACT-Cog (Version 3.0) is a validated measurement to analyze self-reported cognitive complaints in cancer patients. It includes perceived cognitive impairments (FACT-CogPCI, score range 0-72), impact of perceived cognitive impairments on quality of life (FACT-CogQoL, score range 0-16), comments from others (FACT-CogOth, score range 0-16) and perceived cognitive abilities (FACT-CogPCA, score range 0-28). Patients rate on five-point Likert scale the frequency of each complaint in the past 7 days. Higher scores indicate better QoL. All data are analyzed and expressed as mean according to the FACIT recommendations. The Patient Health Questionnaire-4 (PHQ-4) analyzes symptoms of depression and anxiety over the last 2 weeks on a 4 point Likert-type scale. Patients indicate if they feel nervous, anxious or on edge (item 1), if they are not able to stop and control worrying (item 2), if they have little interest or pleasure in doing things (item 3) and if they feel down, depressed or hopeless (item 4). The anxiety subscale (GAD-2) is the sum of the items 1 und 2 and the depression subscale (PHQ-2) is the sum of the items 3 and 4. In summary, there are four categories of psychological distress (None = 0-2, mild = 3-5, moderate = 6-8 and severe = 9-12). Patients with a GAD2 or PHQ2 of ≥ 3 are categorized as present for anxiety or depression. The presence and absence of cGvHD was extracted from the database of the Department of Hematology. Acute GvHD and cGvHD were defined according to described standard criteria [7][8][9]. Acute GvHD is classified as clinically significant at grade II-IV aGvHD. Patients have clinically active cGvHD (Group 1: Currently active inflammatory manifestations of cGvHD independently of the use of immunosuppression), resolved cGvHD (Group 2: All signs of clinically activity of cGvHD have disappeared, past history of cGvHD, no use of immunosuppression) or never had signs of cGvHD (Group 3: Never having cGvHD). The overall rate of completion was 100% for the FACT-Cog and the PHQ-4 as well as 98.1% for the FACT-BMT (Missing answers referred to satisfaction with sexual functioning).
Statistical analysis
Transplant-related characteristics were presented as absolute and relative frequencies for categorical variables and as median and interquartile range (IQR) for continuous variables. The Mann-Whitney U-test was used for comparisons of continuous variables and the chi-square test of independence for categorical variables. Spearman's rank correlation coefficients were calculated to analyze the association of the FACT-BMT, FACT-Cog and PHQ-4. One-way analyses of variance (ANOVA) were performed to explore the effect of cGvHD on QoL outcomes. Post hoc group comparisons were done using the Tukey-test. Median follow-up time was estimated by using the reverse Kaplan-Meier method. Normative data (unadjusted means and standard deviations) of a general U.S. adult population of Brucker et al. [10] were used for comparisons with the FACT-G and normative data (means and standard deviations) of a French healthy population of Lange et al. [11] for comparisons with the FACT-Cog. We excluded AML patients < 30 years of age (n = 4) for comparisons with the normative data of Lange et al. [11] because of missing reference values for patients < 30 years of age. Comparisons between the normative data and the patient population were made using the one-sample t-test. A minimum clinically important difference (MCID) in QoL scores was defined as half of standard deviation (0.5 SD), as reported by Norman et al. [12]. Missing data were treated according to the manual scoring guidelines. We used the cutpoints of van Dyk et al. [13] to discriminate cancer-related cognitive impairment (Perceived cognitive impairmentscore, FACT-CogPCI < 54) from the healthy population (FACT-CogPCI ≥ 54). Allp-values were two-sided and p-values < 0.05 were considered as significant. Statistical analysis was performed using SPSS 26.0 (SPSS Inc.,
Patient and transplantation characteristics
95 patients were identified who received TBI-basedconditioning before 1st allo-HSCT between 1999 and 2017. 54 patients (56.8%) died after allo-HSCT and were not available for the evaluation of the patient-reported outcomes. The causes of death were relapse (n = 37, 68.5%), GvHD (n = 8, 14.8%), infections (n = 6, 11.1%) and other causes (n = 3, 5.6%). The median survival time of the overall population sample (n = 95) was 152 months (IQR 188, 120 months). All 41 long-term transplant survivors were contacted via post between December 2021 and April 2022. 32 patients (78.0%) provided written informed consent and completed the questionnaires. Nine non-responders (22.0%) were excluded from the analysis after two unsuccessful contact attempts (response rate: 78.0%). At the time of the evaluation, all participants were in complete remission of their initially diagnosed AML. Three patients relapsed after 1st allo-HSCT but were successfully treated with azacitidine (n = 1) and donor lymphocyte infusions (DLI; n = 2) and remained in remission with a follow-up of at least 24 months after successful completion of treatment (min 24, max 154). Table 1 shows the baseline transplantation characteristics of the participants (n = 32). The median follow-up time of all participants was 153 months (IQR 113, 191 months). The participants (n = 32) and non-responders (n = 9) showed no differences in patient age at the time of allo-HSCT (p = .374), sex (p = 1.0), diagnosis (p = .401), ELNrisk classification (p = .434), remission status (p = .372), HCT-CI (p = 893), KPS (p = .559), GvHD prophylaxis (p = .402), donor type (p = .646), stem cell source (p = .544), the use of a female donor to a male recipient (p =. 568), donor recipient CMV status (p = .527), use of ATG (p = 1.0), the current cGvHD status (p = .248), length of follow-up (p = .712) and the status of relapse (p = 1.0). Participants and non-responders had similar aGvHD ≥ grade II in history (31.3% vs. 0.0%, p = .083). Table 2 shows the cGvHD characteristics and the NIH severity of cGvHD at maximum severity. Twenty-two patients (69%) developed cGvHD after allo-HSCT. The median time from allo-HSCT to the onset of cGvHD was 326 days (IQR 208, 601 days). At time of the evaluation, 11 patients (34.4%) had currently active cGvHD, 11 patients (34.4%) had resolved cGvHD and 10 patients (31.3%) never had signs of cGvHD. Table 3 shows the socioeconomic data at the time of the evaluation. Table 4 shows the mean scores of the FACT-Cog, FACT-BMT and PHQ-4. Using the classification of Van Dyk et al. [13], 4 patients (12.5%) had present cognitive impairments (PCI-score < 54) (Mean 52.3, SD 0.5). Patients of group 1 (never cGvHD) and group 2 (resolved cGvHD) showed similar values of FACT-CogPCI, FACT-CogQoL and FACT-CogPCA. Patients of group 3 (currently active cGvHD) had the lowest FACT-Cog values of all of the three groups.
FACT-BMT, FACT-Cog and PHQ-4 according to the chronic GvHD-status
Patients of group 1 (never cGvHD) and group 2 (resolved cGvHD) showed similar values of all FACT-BMT scores, while patients of group 3 (currently active cGvHD) had the lowest values of all of the three groups.
15.6% (n = 5) of patients were categorized as present of depression (PHQ2 ≥ 3) and 9.4% (n = 3) as present of anxiety (GAD ≥ 3). Regarding the psychological aspect, patients of group 1 (never cGvHD) and group 2 (resolved cGvHD) showed similar values of PHQ-4 scores, while patients of group 3 (currently active cGvHD) had the highest values. Table 5 shows the Spearman-Rho correlations between the PHQ-2 and the GAD-2 with the FACT-Cog and the FACT-BMT. Table 6 shows the Spearman-Rho correlations between the FACT-BMT and the FACT-Cog scores. Figure 1 illustrates the FACT-Cog scores of the AML patient sample (≥ 30 years of age, n = 28) and of all cGvHD groups (Group 1: never cGvHD; Group 2: resolved cGvHD; Group 3: active cGvHD) compared to the normative data of a French healthy population of Lange et al. [11]. The overall patient cohort (n = 28) had similar FACT-CogQoL, FACT-CogOth as well as higher FACT-CogPCI and FACT-CogPCA (accompanied by MCID) compared to the normative data of Lange et al. [11]. Patients of group 1 (never cGvHD) and group 2 (resolved cGvHD) had better FACT-Cog scores (PCI, QoL and PCA) compared to the normative data, accompanied by MCID. Patients of group 3 (active cGvHD) had similar FACT-Cog scores (PCI, QoL, Oth and PCA) compared to the normative data of Lange et al. [11].
Discussion
In this study, we analyzed the patient-reported CF and QoL of long-term transplant survivors after TBI-basedconditioning, which delivers a homogenous dose to the whole body and examined the impact of cGvHD on outcome parameters. Impairment of CF [3], commonly named chemo-brain, and reduced QoL [14] are common concerns following chemotherapy. Our findings indicate that cognitive impairment is no significant problem of long-term survivors after TBI-based-conditioning. The overall patient sample reported similar CF compared to the normative data of Lange et al. [11]. Even patients with active cGvHD had no worse FACT-Cog scores compared to the normative data which is in line with the fact that neurological manifestations of cGvHD are rare [15,16]. We used normative data from a healthy French population [11] for comparisons with the FACT-Cog because we did not find reference values from a healthy German population. The normative data of Lange et al. [11] didn't include patients < 30 years of age. We therefore excluded four AML patients (12.5%) < 30 years of age from the comparisons with the general population. The excluded of the conditioning regimen [17,18]. A previous study found similar self-reported QoL between patients who never had cGvHD and those whose cGvHD had resolved [14]. Our results confirm this observation. Noteworthy, the overall AML population had no worse FACT-BMT scores compared to the normative data of Brucker et al. [10]. In summary, our data indicate that no relevant impairments persist after resolution of cGvHD. Patients with resolved cGvHD and those who were never diagnosed with cGvHD had comparable long-term QoL and CF [14,18,19]. A reason for the overall good CF and QoL of the AML patients may be the relatively young patient population with a median age of 53 years (IQR 37, 62 years) at the time of evaluation. Moreover, the median time interval between allo-HSCT and the evaluation was 154 months (IQR 113, 191 months). Literature reports moderate impairment of QoL after allo-HSCT that returns to baseline levels as time from transplantation increases and more than 60% of patients have good to excellent QoL 1 to 4 years after allo-HSCT [20,21]. Additionally, our results indicate that patients may have personal benefits after allo-HSCT for AML and report better patient-reported results because of a better appreciation for life [22,23]. Our data show a negative association of depression and anxiety with QoL and CF. The relatively high frequency of anxiety and depression in long-term survivors with active cGvHD support the need for psychological support [14,24]. We didn't analyse fatigue or the impact of fatigue on QoL or CF. Long-term survivors of allo-HSCT can suffer from persisting fatigue several years after allo-HSCT and mental fatigue may be associated with cognitive dysfunction and reduced QoL [25,26].
The low number of patients limits this study, which is the consequence of the long follow-up. In addition, we did not compare the outcome with patients, who received a conditioning regimen not containing TBI precluding an analysis of the specific impact of the latter. Nevertheless, we analysed a homogenous group of AML patients who were treated with TBI as part of the conditioning regimen in a consistent manner in a 20-years-period and did not observe a major impact of the transplant procedure itself on QoL except the impact of cGvHD which occurs independent of the conditioning regimen.
Additionally, cGvHD, the major variable of interest was based on physician-reported institutional databases and National Institutes of Health Criteria. Of note, the overall response rate was high (78%) and we found no differences between participants and non-participants in baseline characteristics.
Conclusion
The present study indicates that CF is not impaired after TBI-based conditioning, even in the presence of active cGvHD. However, active cGvHD has a significant impact on physical, emotional, functional and social wellbeing.
|
v2
|
2022-11-30T15:07:49.352Z
|
2022-11-29T00:00:00.000Z
|
254072023
|
s2orc/train
|
Tautomycin and enzalutamide combination yields synergistic effects on castration-resistant prostate cancer
The androgen receptor (AR) plays an essential role in prostate cancer progression and is a key target for prostate cancer treatment. However, patients with prostate cancer undergoing androgen deprivation therapy eventually experience biochemical relapse, with hormone-sensitive prostate cancer progressing into castration-resistant prostate cancer (CRPC). The widespread application of secondary antiandrogens, such as enzalutamide, indicates that targeting AR remains the most efficient method for CRPC treatment. Unfortunately, neither can block AR signaling thoroughly, leading to AR reactivation within several months. Here, we report an approach for suppressing reactivated AR signaling in the CRPC stage. A combination of the protein phosphatase 1 subunit α (PP1α)-specific inhibitor tautomycin and enzalutamide synergistically inhibited cell proliferation and AR signaling in LNCaP and C4-2 cells, as well as in AR variant-positive 22RV1 cells. Our results revealed that enzalutamide competed with residual androgens in CRPC, enhancing tautomycin-mediated AR degradation. In addition, the remaining competitive inhibitory role of enzalutamide on AR facilitated tautomycin-induced AR degradation in 22RV1 cells, further decreasing ARv7 levels via a full-length AR/ARv7 interaction. Taken together, our findings suggest that the combination of tautomycin and enzalutamide could achieve a more comprehensive inhibition of AR signaling in CRPC. AR degraders combined with AR antagonists may represent a new therapeutic strategy for CRPC.
INTRODUCTION
Prostate cancer is the most common cancer and the second leading cause of cancer-related deaths in Western men [1]. For high-risk localized disease or metastasis, androgen deprivation therapy (ADT) by chemical or surgical castration is the basic treatment, in addition to radical prostatectomy and radiotherapy. Unfortunately, patients who undergo ADT often eventually progress to a lethal stage of castration-resistant prostate cancer (CRPC). At this stage, the patients do not respond to ADT, and the median survival time is only 1-2 years. However, evidence indicates that the androgen receptor (AR)-signaling pathway is still pivotal for CRPC. Increased prostate-specific antigen (PSA) levels are detected in most patients with CRPC [2,3]. Thus, more efforts are required to explore new approaches for blocking AR signaling.
AR is a member of the steroid receptor family of transcription factors that share structurally conserved domains, consisting of an N-terminal domain (NTD), a DNA-binding domain, a ligandbinding domain (LBD), and a hinge region containing a nuclear localization sequence [4]. The importance of AR in prostate cancer development and progression makes it a major target for prostate cancer treatment [5]. ADT uses approaches that target LBD, including directly binding LBD by AR competitive inhibitors, or reducing the level of androgens via LHRH/GnRH analogs and CYP17 inhibitors [6][7][8]. However, in the CRPC stage, AR is reactive due to alterations in expression, structure, and stability [2,3]. Copy-number amplification or overexpression and gain-of-function mutations lead to AR activation by other steroids or even antiandrogens [9][10][11]. The presence of constitutively active splice variants causes the AR to lose the domain responsible for binding to its competitive inhibitors [12,13]. Increased stability contributes to AR nuclear accumulation, which increases its sensitivity to low-level androgens [14]. These alterations and other mechanisms, such as overexpression of coactivators or activation of other ligand-independent roles [15], would maintain AR transactivation despite castrate levels of androgen and resist current antiandrogen treatment.
Recently, some attempts have been made to further block the reactivated AR in CRPC. EPI-001 and its analogs are small molecular inhibitors of the NTD, which could overcome the shortcomings of current therapies targeting the LBD [16]. Selective AR degraders, such as AZD3514 [17] or ASC-J9 [18], and proteolysis targeting chimeras, such as ARV-771 [19] or ARCC-4 [20], are designed to immediately reduce AR protein expression. Moreover, ADT induces susceptibility in prostate cancer cells, rendering them amenable to synergistic treatment. Several clinical studies have shown that combination therapy leads to better outcomes than single-drug therapy [21]. Further clinical trials are ongoing, such as with the NTD inhibitor EPI-7386, the LBD inhibitors enzalutamide (NCT05075577) and CYP17A1, and the proteolysis targeting chimera-type inhibitor abiraterone ARV-110 (NCT05177042). These combinations could overcome the limitations of single drugs and represent a new strategy against clinically reactivated AR.
Here, we explored a newly identified drug combination of enzalutamide and a protein phosphatase 1 subunit α (PP1α) inhibitor tautomycin, which contributed to the increased stability and nuclear accumulation of AR in CRPC. These two drugs synergically inhibited cell proliferation, especially for AR variantpositive cells. The enzalutamide could significantly enhance the tautomycin-mediated degradation of AR and AR-v7 via the ubiquitin-proteasome pathway. These findings suggest the potential of a combination of enzalutamide and tautomycin to develop novel therapeutics for CRPC.
RESULTS
A combination of tautomycin and enzalutamide synergistically inhibits cell proliferation To explore the effect of the tautomycin and enzalutamide combination, an MTT assay was performed to detect cell viability in LNCaP and C4-2 cells. As shown in Fig. 1A, B, both tautomycin and enzalutamide dose-dependently reduced cell viability. In the combination treatment group, we observed the most dramatic inhibition of cell proliferation compared to the single-drug group. The combination index (CI) developed by Chou-Talalay was used to evaluate the synergistic effect of two different drugs. We calculated the CI of tautomycin and enzalutamide in LNCaP and C4-2 cells. The results showed that the CI values were lower than 1, indicating synergism between the two drugs ( Fig. 1C, D). Two additional cell proliferation assays were performed. In line with the MTT assay results, the EdU and colony formation assays supported the combination of tautomycin and enzalutamide, which showed the most dramatic inhibition of prostate cancer cell growth (Fig. 1E-H). Overall, these findings provide compelling evidence of a synergistic effect between tautomycin and enzalutamide on cell growth in prostate cancer.
A combination of tautomycin and enzalutamide synergistically inhibits AR signaling activity The mechanism underlying the inhibition of proliferation by tautomycin and enzalutamide mainly relies on targeting and decreasing the AR signaling activity. Therefore, to investigate the synergistic effect of tautomycin and enzalutamide, we evaluated AR signaling using Western blotting and real-time quantitative reverse transcription PCR (RT-qPCR). As shown in Fig. 2A, B, we first examined the protein levels of AR and PSA in LNCaP and C4-2 cells. With 1 nM DHT treatment, both tautomycin and enzalutamide showed limited effects on AR signaling. We observed only a slight decrease in PSA levels. However, the combination treatment yielded the most marked downregulation. In addition to protein levels, mRNA levels of AR downstream targets were measured. Consistently, the combination of tautomycin and enzalutamide maximally reduced AR signaling compared to a single drug (Fig. 2C, D). Taken together, the combination of tautomycin and enzalutamide synergistically inhibited AR signaling activity, thereby reducing cancer cell proliferation.
Enzalutamide enhances tautomycin-induced AR degradation PP1α reportedly regulates AR protein stability via MDM2, an E3 ubiquitin ligase responsible for the intracellular degradation of AR [22]. As shown in Fig. 2A, B, the protein level of AR was lower in the combination treatment group than in the tautomycin alone group. This suggests that enzalutamide may increase the effect of tautomycin on AR degradation. To test this hypothesis, the halflife of AR was detected with cycloheximide treatment to inhibit protein synthesis in LNCaP and C4-2 cells. We found that AR stability was decreased in the tautomycin single-drug treatment group, consistent with our previous findings [14]. Notably, in the presence of enzalutamide, the effect of tautomycin was amplified, and the half-life of AR was shorter in the combination group than in other groups (Fig. 3A, B). To confirm this observation, we detected AR-ubiquitin levels via co-immunoprecipitation. Expectedly, the highest level of AR ubiquitination was identified in the combination group, substantiating the pivotal role of enzalutamide in tautomycin-induced AR degradation (Fig. 3C, D). In the half-life and ubiquitin assays, we noticed that, except for tautomycin, enzalutamide also reduced AR stability ( Fig. 3A-D). This might be because cells were cultured in a regular medium containing castrated-level androgens. As a competitive inhibitor, enzalutamide competes with androgen for binding to AR, which decreases its stability. Thus, the mechanism underlying the synergistic effect between tautomycin and enzalutamide might be because enzalutamide treatment keeps AR unbound to the ligand, rendering it more easily accessible to AR degraders, such as tautomycin. To test this hypothesis, we cultured cells with a gradient concentration of DHT and treated them with tautomycin in the presence or absence of enzalutamide. The results are shown in Fig. 3E, F. With increased DHT levels, the effect of tautomycin was attenuated due to increased AR ligand-receptor interactions. However, after the combination with enzalutamide, the influence of DHT was markedly decreased. These findings suggest that enzalutamide prevents androgen binding to AR, enhancing the effect of tautomycin.
A combination of tautomycin and enzalutamide inhibits AR variant-positive cell proliferation
The increased AR degradation after tautomycin and enzalutamide combination treatment overcame AR reactivation such as AR overexpression or stability evaluation. We further aimed to identify whether this combination could prevent AR reactivation caused by structural alterations. 22RV1 cells are known to express both full-length AR (FL-AR) and AR variants (ARVs) that are enzalutamide-resistant. The MTT, EdU, and colony formation assays were repeated. As shown in Fig. 4A, enzalutamide had a limited effect on 22RV1 cell viability. Unlike enzalutamide, ARVs did not affect the inhibition of tautomycin, and the cell viability in the tautomycin-treated group was significantly decreased. This was due to the tautomycin-targeted AR promoting the activity of MDM2, which binds to AR at the NTD. Interestingly, the combination treatment group showed the most remarkable inhibition of proliferation across all four groups. The colony formation assay (Fig. 4B) and EdU assay (Fig. 4C) further supported the results of the MTT assay. Although enzalutamide did not reduce cell proliferation, it did potentiate the effect of tautomycin. Overall, the combination of tautomycin and enzalutamide could overcome the antiandrogen resistance of ARVs.
Enzalutamide binds to AR in ARV-positive cells, facilitating tautomycin-mediated AR degradation To assess the AR signaling alteration after tautomycin and enzalutamide combination treatment, we next detected the protein and mRNA levels of AR, ARv7, and their downstream targets. Tautomycin decreased the protein levels of both FL-AR and ARVs, while enzalutamide acted as an enhancer of tautomycin effects (Fig. 5A). With the reduced protein level, the AR signaling activity decreased in the tautomycin and combination treatment groups, while enzalutamide dramatically promoted the activity of tautomycin (Fig. 5A, B). Furthermore, the half-lives of AR and AR-v7 proteins were detected in 22RV1 cells. As expected, tautomycin promoted the degradation of both FL-AR and ARVs. Meanwhile, we observed the lowest AR and ARv7 stability in the combination treatment group (Fig. 5C). Similarly, the AR-ubiquitin level was evaluated in 22RV1 cells by co-immunoprecipitation, and the combination treatment significantly increased the level of ubiquitinated AR (Fig. 5D). Reduced AR stability following enzalutamide treatment was also observed in 22RV1 cells cultured in a regular medium. Therefore, a gradient DHT assay was performed. The result was the same as that in LNCaP and C4-2 cells; enzalutamide treatment competed with DHT and increased tautomycin-mediated AR degradation. These findings indicate that although enzalutamide does not inhibit proliferation and AR signaling activity due to the presence of ARVs, it could still interact with AR and compete for androgen binding, sensitizing cells to tautomycin. This hypothesis was supported by CETSA, which was used to detect direct binding of the ligand and receptor. After enzalutamide treatment, DHT binding affinity was remarkably decreased in 22RV1 cells (Fig. 6A), indicating that enzalutamide still acted as a competitive antagonist in 22RV1 cells. In addition, we performed a long-term CETSA to detect the AR protein interaction status (PRINTS) by treating cells with enzalutamide for 48 h. We found that enzalutamide could dramatically decrease the thermal stability of AR in 22RV1 cells (Fig. 6B). Thus, the binding of enzalutamide and AR would influence the status of AR even in drug-resistant cell lines.
In Fig. 5, our results showed that the combination of tautomycin and enzalutamide not only decreased the level of FL-AR but also targeted ARVs. Previous research has reported an interaction between FL-AR and ARVs in ARV-positive prostate cells and that the transcription of ARVs downstream targets is required for FL-AR [23]. Therefore, we hypothesized that the synergistic effect on ARVs relies on FL-AR. Thus, we knocked down FL-AR expression using siRNA. As shown in Fig. 6C, tautomycin decreased ARv7 expression in 22VR1 cells, with or without FL-AR. However, enzalutamide failed to facilitate the degradation of tautomycin in the FL-AR silenced group. The same results were also identified in the ARv7 ubiquitin assay, in absence of FL-AR, we didn't observe any increase of ARv7 ubiquitination in combination group compared to the tautomycin treatment group (Fig. 6D). These results indicated that the combination effect of enzalutamide and tautomycin on ARv7 might be mediated through FL-AR/ARv7 heterodimerization.
DISCUSSION
Prostate cancer is an endocrine-related cancer, and the AR signaling pathway, which participates in the entire disease process, is indispensable for cancer growth and distant metastasis [24]. Thus, using drugs to target the AR pathway is a frontline treatment for patients with prostate cancer. Contemporary ADT for prostate cancer typically involves chemical castration through the chronic use of GnRH agonists or antagonists, which lowers testosterone levels by stably suppressing androgen secretion from the testes [3]. In addition to chemical castration, a competitive AR antagonist is routinely used to eliminate androgens in the prostate. This incorporation has been termed combined androgen blockade (CAB) and is now in widespread clinical use. However, although CAB could decrease androgen activity, tumor cells still deploy several strategies to escape from CAB. For instance, ADT only targets androgen-form testes, while adrenal androgen, intraprostatic testosterone, and DHT synthesis also exist. With the increased sensitivity of receptors due to overexpression, mutation, or nuclear accumulation, AR signaling is reactivated, and the disease progresses to CRPC [10,25,26]. In this stage, secondary antiandrogens, such as abiraterone and enzalutamide, are applied to impede AR reactivation by reducing intraprostatic testosterone synthesis or competing with ligand-receptor binding. However, each of these approaches targets the LBD of AR and has a narrow therapeutic index. Cancer cells develop drug resistance within a short time [27]. Therefore, a more thorough AR blockade method is urgently required. Here, we provide a new combination strategy, comprising enzalutamide and AR degrader, tautomycin, to maximize AR inhibition in CRPC (Fig. 6D). Our results showed that tautomycin and enzalutamide synergistically inhibited cell proliferation in LNCaP and C4-2 cells and exerted an ideal effect on AR variant-positive 22RV1 cells. Consistently, AR signaling was significantly decreased after treatment with tautomycin and enzalutamide in LNCaP, C4-2, and 22RV1 cells. These findings provide a valuable strategy to block AR reactivation in CRPC continually. Moreover, as enzalutamide and tautomycin target AR by different mechanisms, this might contribute to reducing the potential for developing resistance.
Tautomycin is a PP1α inhibitor. As a protein phosphatase, PP1α negatively regulates E3 ligase MDM2 and SKP2 activity by decreasing their phosphorylation [28]. Accumulating evidence confirms that turnover of AR occurs through the ubiquitin-proteasome pathway [14]. Both MDM2 and SKP2 are major executors of AR degradation. Moreover, the interaction between the AR and MDM2 or SKP2 occurs at the NTD site. Thus, PP1α is not only an important regulator of AR degradation but also regulates ARV turnover [29]. In our previous research, we found that in CRPC cells, the level of PP1α was expectedly increased, which downregulated the activity of MDM2, contributing to the high stability of AR. With the close relationship between AR stability and nuclear accumulation, PP1α is also considered to promote the transition of AR from cytoplasmic distribution to nuclear accumulation along with CRPC progression. These findings indicate that PP1α is a promising candidate for CRPC, while targeting it could simultaneously reverse the alteration of AR expression, structure, and stability. However, the effect of tautomycin alone is unsatisfactory and easily attenuated by androgens. Nishiyama et al. reported that even in patients who underwent castration, the residual concentration of intraprostatic DHT is approximately 4.6 nM, higher than the DHT we used [30]. Therefore, we combined tautomycin with enzalutamide. Benefiting from the competitive effect of enzalutamide on AR, tautomycin can overcome the influence of residual androgen and target the AR protein more dramatically. Indeed, our results confirmed that this combination could greatly enhance the activity of tautomycin and achieve greater inhibition of AR signaling in CRPC.
Enzalutamide is a secondary antiandrogen developed for the treatment of CRPC. Compared with first-generation antiandrogens, enzalutamide shows approximately 8-fold greater affinity than bicalutamide. Previous studies have reported that enzalutamide could block ligand-receptor binding, nuclear translocation, DNA-binding, and coactivator peptide recruitment, thereby affecting the inhibition efficiency of AR downstream target transcription [31]. However, enzalutamide was developed from a nonsteroidal agonist of AR and still works as a competitive inhibitor by targeting the LBD. Thus, the molecular alterations that led to resistance to bicalutamide might also induce resistance to enzalutamide. With the widespread use of enzalutamide in clinical practice, the development of resistance has been observed in most patients [27,32]. The CWR22 xenograft-derived 22RV1 cell line, which expresses high levels of AR-V7, is a classical model for enzalutamide resistance [33]. Our results confirmed that enzalutamide did not inhibit either proliferation or AR activity in 22RV1 cells. Intriguingly, although enzalutamide did not show any effect on 22RV1 cells, it could serve as an enhancer that amplified the activity of tautomycin to further downregulate AR signaling. The CETSA was initially developed to investigate drug-target engagement in live cells based on altered protein thermostability [34]. Recent research indicates that alterations in protein thermal stability could also reflect changes in PRINTS [35,36]. Here, we used two different CETSA to elucidate the role of enzalutamide in 22RV1 cells. The decreased stability and curve shift of AR after long-term enzalutamide incubation treatment revealed that the binding of enzalutamide alters the PRINTS of AR and allows it to be easily targeted by other drugs, including the AR degrader tautomycin. Thus, regardless of sensitivity or resistance, enzalutamide should become a primary choice for antiandrogen treatment in CRPC.
In 22RV1 cells, in addition to the finding that enzalutamide could facilitate tautomycin to further decrease AR signaling, we noticed that enzalutamide also helped block ARVs signaling. Most ARVs are truncations of AR and do not have the LBD; therefore, they are constitutively activated in the absence of androgen or the presence of an AR competitive inhibitor, including enzalutamide. Recently, numerous studies have reported the interaction between AR and ARVs. Xu et al. observed that ARv7 and ARv567es heterodimerize with FL-AR in an androgen-independent manner [23]. Moreover, Watson et al. reported that although some ARVs promote castration resistance, they still rely on FL-AR [37]. These studies confirmed that ARVs are not truly independent from AR but rather rely on each other. We considered that the additional effect of tautomycin in combination was due to enzalutamide impairing the interaction between FL-AR and ARVs. Thus, the combination of enzalutamide and tautomycin is suitable for patients with CRPC with ARVs.
In summary, we provide a new potential strategy for CRPC treatment. Our results revealed that the combination of tautomycin and enzalutamide inhibits prostate cancer cell proliferation by synergistically promoting AR and ARv7 protein degradation via the ubiquitin-proteasome pathway. These findings also raise the possibility of combining AR degraders with AR antagonists to treat CRPC and AR antagonists resistant CRPC.
MATERIALS AND METHODS Cell culture and transfection
The prostate cancer cell lines LNCaP, C4-2, and 22RV1 were purchased from Procell Life Science & Technology Co. Ltd. (Wuhan, China). All the cell lines were cultured in RPMI 1640 medium (Corning) supplemented with 10% FBS (Excell Bio, China) or charcoal-stripped FBS (Biological Industries) and 1% penicillin/streptomycin (Thermo Fisher Scientific) in a CO 2 incubator at 37°C. FL-AR siRNA (CGUGCAGCCUAUUGCGAGAUU) was synthesized by GenePharma (Shanghai, China). Hemagglutinin (HA)ubiquitin was a gift from Edward Yeh (Addgene, plasmid # 18712). The Flag-AR plasmid was synthesized by GeneChem (Shanghai, China). Lipofectamine 3000 Transfection Reagent (Thermo Fisher Scientific) was Fig. 4 A combination of tautomycin and enzalutamide inhibited ARV-positive 22RV1 cells proliferation. A The cell viability of 22RV1 was detected using MTT assay after treatment with indicated drugs. B Representative images of colony formation assay in 22RV1 cells treated with tautomycin and enzalutamide. C Representative images of EdU incorporation in 22RV1 cells treated with tautomycin and enzalutamide. Nuclei were stained with Hoechst 33342 (scale bars: 50 μm). # Synergy by bliss-independent analysis. used to transfect both siRNA and plasmids according to the manufacturer's instructions. All cell lines were authenticated by STR profiling and tested negative for mycoplasma contamination.
MTT assay
Cells (1 × 10 4 cells/well) were seeded in 96-well plates. After 24 h, cells were treated with enzalutamide (MedChemExpress, Shanghai, China) and tautomycin (Wako) at various concentrations. Cells were then grown for 48 h, and cell viability was evaluated using the MTT (Sigma) assay, as previously described [38].
Colony formation assay
LNCaP, C4-2, or 22RV1 cells were seeded in 6-well plates (3000 cells/well), and after 2 days, they were treated with enzalutamide and tautomycin at various concentrations and then cultured in a cell incubator for another two weeks. The cells were fixed with 4% paraformaldehyde for 10 min. The cells were then stained with 0.5% crystal violet for 20 min. The number of cells was calculated using ImageJ software (RRID:SCR_003070).
Quantitative real-time PCR
Prostate cancer cells were seeded in 12-well plates and treated with enzalutamide and tautomycin at the indicated concentrations. After 48 h, TRIzol reagent (Invitrogen) was used for RNA extraction, according to the manufacturer's instructions. Reverse transcription was performed 6 Enzalutamide binds to AR in 22RV1 cells, influencing the interaction between AR and ARv7. A ITDRF CETSA experiments performed for DHT in the presence of 50 μM enzalutamide in 22RV1 cells for 1 h. B CETSA experiments were performed following indicated heat shocks in 22RV1 cells after treating with 10 μM enzalutamide for 48 h. C The protein levels of ARv7 were analyzed using Western blot in 22RV1 cells transfected with FL-AR siRNA and treated with indicated concentrations of tautomycin and enzalutamide for 48 h. D The ubiquitin level of ARv7 was evaluated using co-immunoprecipitation in 22RV1 cells in the presence of 10 μM MG132 for 48 h with or without knockdown of fulllength AR. E A schematic model for the mechanism through which a combination of tautomycin and enzalutamide inhibits the proliferation of prostate cancer. P < 0.05 was accepted as significant, ns as not significant. with 1 μg of RNA using HiScript ® III All-in-one RT SuperMix (Vazyme Biotech Co. Ltd.). Taq Pro Universal SYBR qPCR Master Mix (Vazyme Biotech Co., Ltd.) was used for real-time quantitative PCR on a QuantStudio™ 6 Flex system (Thermo Fisher Scientific). The data were analyzed using the 2 -ΔΔCt method.
Protein half-life assay
Cells were seeded in 6-well plates and, after 24 h, were treated with cycloheximide (Solarbio, 100 µg/mL), enzalutamide, and tautomycin at the indicated concentrations. RIPA buffer containing a proteasome inhibitor cocktail was used to lyse cells after 0, 4, 8, and 12 h. Then, the protein was subjected to Western blot analysis to evaluate AR or AR-v7 protein levels.
Co-immunoprecipitation
Prostate cancer cells transfected with HA-ubiquitin and Flag-AR were treated with MG132 (10 µM), enzalutamide, or tautomycin at the indicated concentrations. After 24 h, the cells were lysed, incubated with anti-Flag magnetic beads (Bimake, China), and incubated overnight at 4°C. The anti-Flag magnetic beads were pelleted, washed three times with immunoprecipitation wash buffer, and then eluted with 1× protein sample loading buffer at 100°C for 5 min.
Isothermal dose-response-cellular thermal shift assay (ITDRF CETSA ) The cells were seeded into a 100 mm dish, and after they reached 80% confluence, they were digested and divided into separate aliquots and exposed to enzalutamide (50 µM) or dimethyl sulfoxide at a gradient concentration of dihydrotestosterone (DHT, Abmole) for 1 h in a cell incubator. 46°C for 3 min was used to perform heat shock and the lysed by freeze-thaw cycle three times using liquid nitrogen. The cell lysate was centrifuged at 20,000 × g for 20 min, and 5× protein sample loading buffer was added to the supernatant after boiling at 100°C for 10 min and detected using Western blotting.
Cellular thermal shift assay (CETSA)
CETSA experiments were performed according to the general CETSA protocol [39]. Briefly, 22RV1 cells were seeded into a 100 mm dish, and once they reached 80% confluence, they were treated with enzalutamide (10 µM) or dimethyl sulfoxide for 48 h. Cells were then harvested and resuspended in phosphate-buffered saline. Treated samples were aliquoted and heated at different temperatures for 3 min in a PCR plate (Veriti thermal cycler, Thermo Scientific). Next, a protease inhibitor cocktail was added before lysing cells by three freeze-thaw cycles using liquid nitrogen and a heat block. The cell lysate was centrifuged at 20,000 × g for 20 min. Supernatants were transferred to new tubes, boiled at 100°C for 10 min, and detected by Western blot.
Statistical analysis
Statistical analyses were performed using GraphPad Prism (version 8.3.1; for Windows, RRID:SCR_002798). Data are presented as the mean ± SEM from at least three biological replicates. The two-tailed Student's t-test was used for data comparison between the two groups. One-way analysis of variance (ANOVA) was used to compare two or more groups. Two-way ANOVA tests, the bliss-independent model [40], and Chou-Talalay method [41] were used to determine the synergistic effect. The determination of synergy was listed in Table S1.
DATA AVAILABILITY
The data that support the findings of this study are available from the corresponding author upon reasonable request.
|
v2
|
2022-12-02T16:08:40.469Z
|
2022-11-29T00:00:00.000Z
|
254147123
|
s2orc/train
|
Advanced Adrenocortical Carcinoma: From Symptoms Control to Palliative Care
Simple Summary Adrenocortical cancer (ACC) is a rare malignancy, often diagnosed late and with a poor prognosis. Currently, ACC best management is achieved in referral centers, where a multidisciplinary approach (endocrinologists, oncologists, surgeons, radiologists and radiotherapists) can intercept the course of a patient with ACC early and operate with life-prolonging intents. Even in cases of advanced disease, multimodal treatments (chemotherapy and mitotane, surgery and/or radiotherapy) and skillful management of the medical complications of ACC can ensure significant improvements in survival. However, patients with advanced ACC suffer from relevant psychophysical symptoms and experience significant losses in quality of life. There is now robust evidence that the early integration of supportive and palliative care in standard oncological management may relieve cancer patients’ burden, mediate aggressive treatments and improve quality of life, and not only in the end-of-life period. In this paper, we provide an up-to-date literature review on the role of supportive and palliative care in ACC management. Abstract The prognosis of patients with advanced adrenocortical carcinoma (ACC) is often poor: in the case of metastatic disease, five-year survival is reduced. Advanced disease is not a non-curable disease and, in referral centers, the multidisciplinary approach is the standard of care: if a shared decision regarding several treatments is available, including the correct timing for the performance of each one, overall survival is increased. However, many patients with advanced ACC experience severe psychological and physical symptoms secondary to the disease and the cancer treatments. These symptoms, combined with existential issues, debase the quality of the remaining life. Recent strong evidence from cancer research supports the early integration of palliative care principles and skills into the advanced cancer patient’s trajectory, even when asymptomatic. A patient with ACC risks quickly suffering from symptoms/effects alongside the disease; therefore, early palliative care, in some cases concurrent with oncological treatment (simultaneous care), is suggested. The aims of this paper are to review current, advanced ACC approaches, highlight appropriate forms of ACC symptom management and suggest when and how palliative care can be incorporated into the ACC standard of care.
Introduction
Adrenocortical carcinoma (ACC) is a rare malignancy, with a reported incidence of 0.7-1.3 cases per million/year [1,2]. The prognosis is variable from its presentation. Positive prognostic markers are stage, pathological grading and expertise of the center [3,4]. In
Endocrine Treatment: Mitotane and Steroidogenesis Inhibitors
Mitotane is the approved drug for the treatment of ACC and it is used both in the adjuvant setting and with advanced/metastatic ACC [10,11]. In patients with advanced disease, combined therapy with etoposide, doxorubicin, cisplatin (EDP) and mitotane (EDP-M) represents the current first-line treatment. The evidence is limited because there are few studies (most of which are observational) reporting the association between mitotane and chemotherapy in the treatment of advanced ACC [5,12]. Guidelines from the ESE/ENSAT and AACE suggest mitotane monotherapy for ACC patients without a residual tumor following surgery who have a perceived high risk of recurrence after radical surgery (as in the case where Ki67 >10%) and association of mitotane with chemotherapy (EDP-M) in advanced cases with poor prognosis [13] Mitotane is a lipophilic drug derived from dichlorodiphenyltrichloroethane with a strong steroidogenesis inhibition effect: steroidogenic acute regulatory protein (StAR) and CYP11A1 are the targets of mitotane action, partially explaining its strong adrenolytic effect [14]. The commercially available mitotane formulation is 500 mg tablets (Lysodren ® in Europe). Mitotane treatment is started as soon as possible after surgery [5] with a low-dose (3 g/day after 12 days) or high-dose (3 g/day after 2 days, 6 g/day after 12 days) regimen, achieving similar plasma levels and demonstrating similar onset of adverse events [15]. Some patients do not achieve the therapeutic plasma concentration of 14-20 mg/L in the follow-up, even at doses up to 6-7 g/day (12)(13)(14) tablets in divided doses), due to poor water solubility, the large volume of distribution, the onset of adverse effects and inter/intra-individual variability [16]. Moreover, it has been found that 40% of unchanged mitotane could be detected in the feces 12 h after an oral intake of a single 2 g mitotane dose in tablet form [17]. The most common mitotane-induced side effects in patients with ACC are gastrointestinal disturbances, neurologic symptoms, leukopenia and hepatic disorder (liver failure is rare; however, asymptomatic increases in hepatic enzymes-in particular, gamma-GT-are common) [5], alone or combined: they represent a major limit to treatment adherence [15][16][17]. Novel oral (recrystallization from microemulsion, nanosuspension, liposomal) and injectable (micellar) formulations are currently being developed in order to improve the efficacy and tolerability of mitotane [16].
Substitutive glucocorticoid replacement is recommended for all patients during mitotane treatment, with the exception of cases that still present glucocorticoid excess. Due to the strong induction effect on CYP3A4 activity and the increase in cortisol-binding-globulin (CBG), ACC patients treated with mitotane need higher substitutive doses for effective replacement [11,15].
It is recommended that treatment with mitotane should begin as soon as possible after surgery (ideally within 6 weeks) with an escalating regime depending on the patient's performance status, aiming to reach a plasma concentration between 14 and 20 mg/L (these values are proposed in several consensuses and guidelines; nonetheless, some experts suggest an enlarged range of 8-30 mg/L). Mitotane plasma levels should be periodically assessed. After the first assessments (more or less monthly at the beginning of treatment), mitotane dosage should be adjusted according to plasma concentrations and tolerability and considering that the threshold for side effects can be different from the suggested therapeutic range (levels >20 mg/L may be well-tolerated and patients can experience side effects with 14 mg/L). In patients without recurrence who tolerate mitotane therapy, it is recommended to administer the drug for at least 2 years [18] and up to 5 years [5,19].
Steroidogenesis inhibitors are adjuvant in the treatment of hypercortisolism, which is the most frequent presentation of hormonal excess in ACC patients (almost 50-60%) [20,21]. Guidelines recommend that every patient with suspected ACC should be evaluated for hormonal hypersecretion with clinical and biochemical assessments at baseline and during follow-up. Hypercortisolism in ACC patients can be severe and appear as rapidly developing Cushing's syndrome with resistant arterial hypertension, hypokalemia, new-onset diabetes, mood disorders, immunosuppression, bone frailty and wasting symptoms. In a minority of cases, ACC can be associated with androgen excess (virilization in women) [19]. Overt hypercortisolism is detrimental and leads to increased morbidity and mortality due to its complications: opportunistic infections, cardiovascular events and wasting syndrome. In the case of severe hypercortisolism, mitotane therapy alone is not enough to control hormonal levels because it takes several weeks to reach efficacy. Therefore, adjuvant therapies, such as steroidogenesis inhibitors (ketoconazole, metyrapone and osilodrostat) or a glucocorticoid receptor antagonist (mifepristone), are suggested [22].
Despite the lack of studies, metyrapone is considered the first choice for advanced ACC with severe Cushing's syndrome due to the rapid onset of its effects [23]. It is welltolerated, it can be administered in association with mitotane and EAP and its metabolism is not affected by mitotane [23]. Metyrapone is an oral formulation and the dosage employed for the treatment of Cushing's syndrome varies between 500 and 6000 mg/day depending on the severity of hypercortisolism [24]. Due to its short half-life (up to 4 h), it requires multiple administrations daily. It acts by inhibiting CYP11B1 and CYP11B2, which has the consequence of reducing aldosterone and cortisol secretion [25]. Due to the accumulation of precursors with mineralocorticoid activity, metyrapone treatment can be associated with worsening hypertension and hypokalemia; in the long term, it leads to hirsutism and/or acne, so it is less preferable in women with androgen-secreting ACC [26].
Ketoconazole is a steroidogenesis inhibitor approved for the treatment of Cushing's syndrome that, due to its short half-life (3-4 h), is orally administered in fractionated daily doses of 200 to 1200 mg/day [26]. Its major adverse effect is hepatotoxicity, demonstrated by an elevation in liver enzymes that occurs early at the start of treatment or at dose up-titration. It is recommended not to start treatment if hepatic liver enzyme levels are > threefold greater than normal and to discontinue treatment if they increase. However, in clinical practice, increased liver enzymes should not preclude ketoconazole prescription [27]. Due to its inhibiting effects on several enzymes involved in adrenal steroidogenesis, it leads to hypogonadism, and its long-term use is less preferred in men. Ketoconazole has a strong inhibiting effect on CYP3A4, which leads to multiple drug interactions [25].
It is important to point out that, once mitotane plasma levels have reached the therapeutic window, the dose can be reduced due to its pharmacokinetics (the reported plasma elimination half-life is 18-159 days [16]) and fat reservoir (it is a lipophilic drug): it is recommended to use the lowest and best-tolerable mitotane dose that is able to guarantee a level of >14 mg/L in the long-term follow up [5]. Moreover, if hypercortisolism is wellcontrolled, the dosages of the steroidogenesis inhibitors can, by relying on clinical status and biochemical measurements, also be reduced (until their withdrawal, since mitotane is also a steroidogenesis inhibitor and acts as a cortisol-lowering drug below the therapeutic range) in order to avoid adrenal insufficiency and reduce the number of pills required per day. A decade ago, Kamenicky et al. assessed the feasibility of concomitant treatment with mitotane, ketoconazole and metyrapone in patients with Cushing's syndrome and severe acute complications. They found out that this combination therapy was a valid alternative to surgical bilateral adrenalectomy in critical patients [28]. Moreover, this therapeutic approach can also be useful in optimizing other types of palliative care for ACC patients with advanced disease, severe symptoms of hypercortisolism and the need for rapid control of the disease.
In some cases, severe hypercortisolism in patients with ACC is a life-threatening condition that represents a management challenge [29]. Osilodrostat, a recently developed inhibitor of adrenal 11 beta-hydroxylase, is effective in the treatment of severe Cushing's syndrome resulting from ACC due to its rapid onset of action, safety and limited drug interactions. The starting dose depends on the severity of the hypercortisolism and whether there is a need to initiate antineoplastic treatment; in the latter case, the "block and replace" strategy is effective, given the high risk of osilodrostat-induced adrenal insufficiency [30].
Mifepristone, originally developed as a progesterone receptor antagonist, is currently used as a glucocorticoid receptor antagonist, with its effects prompting a rise in circulating cortisol levels [22]. Mifepristone provides a rapidly effective and valuable option for patients with severe hypercortisolism when surgery is unsuccessful or impossible: it can achieve swift reductions in body weight, blood pressure, glucose metabolism and most Cushingoid appearances [31]. However, it requires close monitoring of potentially severe hypokalemia and of the clinical signs of adrenal insufficiency [32].
Standard Life-Prolonging Curative Treatments for Patients with ACC
Patients with ACC often require combined multimodal treatment, personalized and shared after a multidisciplinary discussion (see Figure 1). In patients undergoing surgical resection and with localized disease, the only approved systemic adjuvant treatment is mitotane (discussed in Section 2). There is currently no solid evidence to support other systemic treatments in the adjuvant setting for patients with ACC. Considering the high recurrence rate, it might be reasonable to evaluate adjuvant chemotherapy treatment in patients with a high risk of relapse, neoplastic thrombosis or locally infiltrating disease. Currently, the level of evidence present in the literature does not allow definitive conclusions.
Currently, the level of evidence present in the literature does not allow definitive conclusions. Two phase III randomized trials (ADIUVO-2 and ACACIA; NCT03583710 and NCT03723941, respectively) in the active and recruitment phases, respectively, are ongoing, aiming to evaluate the efficacy of platinum-based chemotherapy treatment with or without mitotane in patients with high-risk resected ACC stage I-III and Ki67 ≥ 10%. Obviously, no data are yet available. In the locally advanced or metastatic disease setting, however, there are several studies that have evaluated different chemotherapy schemes, with single drugs or combinations, and found encouraging results [5,33]. A small multicenter study enrolled 28 patients treated with EDP-M and obtained promising results (ORR 53.5%; 95% CI 35-72) [34]. This small study paved the way for the randomized phase III FIRM-ACT trial [35], which cleared the use of the same triplet of chemotherapy drugs plus mitotane in patients with locally advanced or metastatic ACC. Treatment with EDP-M showed a higher response rate (23.2% vs. 9.2%, p < 0.001) and a higher median progression-free survival (mPFS) (5.0 months vs. 2.1 months; HR 0.55; 95% CI 0.43-0.69; p <0.001) than the control arm with streptozotocin plus mitotane (SZ-M). In terms of overall survival (OS), no statistically significant differences were found between the two treatment arms (14.8 months and 12.0 months, respectively; hazard ratio, 0.79; 95% CI 0.61-1.02; p = 0.07). These results could be justified by the possibility of cross-over that was offered to patients with progressive disease after the first line of treatment. EDP-M is presently considered the standard of care for the treatment of patients with locally advanced or metastatic ACC [5,12], and supportive treatments are essential to mitigate EDP-M side effects [36].
For patients progressing after EDP-M treatment, the oncological therapeutic alternatives currently remain very limited. Several studies have evaluated various Two phase III randomized trials (ADIUVO-2 and ACACIA; NCT03583710 and NCT03723941, respectively) in the active and recruitment phases, respectively, are ongoing, aiming to evaluate the efficacy of platinum-based chemotherapy treatment with or without mitotane in patients with high-risk resected ACC stage I-III and Ki67 ≥ 10%. Obviously, no data are yet available. In the locally advanced or metastatic disease setting, however, there are several studies that have evaluated different chemotherapy schemes, with single drugs or combinations, and found encouraging results [5,33]. A small multicenter study enrolled 28 patients treated with EDP-M and obtained promising results (ORR 53.5%; 95% CI 35-72) [34]. This small study paved the way for the randomized phase III FIRM-ACT trial [35], which cleared the use of the same triplet of chemotherapy drugs plus mitotane in patients with locally advanced or metastatic ACC. Treatment with EDP-M showed a higher response rate (23.2% vs. 9.2%, p < 0.001) and a higher median progression-free survival (mPFS) (5.0 months vs. 2.1 months; HR 0.55; 95% CI 0.43-0.69; p < 0.001) than the control arm with streptozotocin plus mitotane (SZ-M). In terms of overall survival (OS), no statistically significant differences were found between the two treatment arms (14.8 months and 12.0 months, respectively; hazard ratio, 0.79; 95% CI 0.61-1.02; p = 0.07). These results could be justified by the possibility of cross-over that was offered to patients with progressive disease after the first line of treatment. EDP-M is presently considered the standard of care for the treatment of patients with locally advanced or metastatic ACC [5,12], and supportive treatments are essential to mitigate EDP-M side effects [36].
For patients progressing after EDP-M treatment, the oncological therapeutic alternatives currently remain very limited. Several studies have evaluated various drugs/schemes, such as streptozotocin, gemcitabine in combination with capecitabine and temozolomide, and obtained modest results [37][38][39]. The need for better comprehension of the molecular pathways involved in the genesis and progression of ACC has led to the study of different target therapies. Unfortunately, most of the studies that evaluated tyrosine kinase inhibitors (sunitinib, erlotinib, gefitinib and sorafenib) were small studies that did not report particu- larly encouraging response rates [33]. A randomized phase III study evaluated linsitinib, an IGF-1 receptor inhibitor, and enrolled 139 patients with locally advanced or metastatic ACC who progressed after standard chemotherapy treatment. Linsitinib did not improve OS compared to the placebo [40]. Cabozantinib, a multi-kinase inhibitor (VEGFR2, MET and RET), was evaluated in a small study with 16 patients previously treated for recurrent ACC (after mitotane discontinuation). At the end of the study, three patients had a partial response and five patients had a stable disease [41]. Two phase II studies (NCT03370718 and NCT03612232) evaluating the use of cabozantinib in patients with ACC are ongoing.
The immunotherapy approach-in particular, with the use of immune checkpoint inhibitors-has been evaluated in patients with advanced ACC. Pembrolizumab, an anti-PD1 immune checkpoint inhibitor, was evaluated in two phase II studies, resulting in disease control rates of 52% and 56%, respectively. In both studies, the efficacy of this therapeutic approach was independent of PD-L1 expression, microsatellite instability/mismatchrepair deficiency and tumor-infiltrating lymphocytes (TILs) [42,43]. Excessive cortisol secretion is able to counteract the immune system and reduce immunotherapy efficacy: we previously reported an impressive response to anti-PD-1 immunotherapy in a young male patient with advanced ACC with mismatch-repair deficiency and adrenal insufficiency [44]. The anti-PD1 monoclonal antibody nivolumab was also studied in a small multicenter phase II study that enrolled ten patients: in this study, only modest activity with an mPFS of <2 months was demonstrated [45]. The greater availability of extended genomic analysis techniques (next-generation sequencing) could pave the way for novel personalized treatment, as effective therapeutic alternatives are currently very limited. Some studies with the aim of personalizing treatments and improving the outcomes for these patients have already been published [46,47] and others are in progress.
In clinical practice, all options for life-prolonging treatment (surgery, mitotane, chemotherapy and radiotherapy) should be considered. The goal is remission for stage I-III ACC; however, a cure is not possible for metastasized patients. In these patients with advanced ACC, life-prolonging treatment attacking the tumor burden should be provided, in accordance with the performance status, with a shared decision involving the patients and their caregivers. Therefore, a careful balance of the patient's performance status (combining mass-related symptoms and endocrine aspects) and the impact of treatments (especially chemotherapy or extended resection during open surgery) should be tailored to match the appropriate patient: a multidisciplinary evaluation can define whether a patient is fit for the therapy and supportive treatment.
Symptom Management
Most oncological patients experience several physical and psychological disorders in the course of their diseases, which are often clustered, simultaneous and occur in such a way as to fuel each other [48]. Highly prevalent symptoms of advanced cancer patients include anorexia, fatigue, anxiety, depression, nausea, vomiting, constipation, pain, confusion and breathlessness [49]. The symptom burden is directly related to patients' functionality and to the perceived QoL for both patients and their families. Moreover, increased disease and symptom burdens negatively impact the appropriate chemotherapy dose, leading to reduced survival [50]. Therefore, intensive symptom management is mandatory in cancer patients. Cancer management guidelines recommend the assessment of pain and other symptoms in oncological practice [51,52], making it possible to improve symptom monitoring over time and allowing early identification of patient needs [53].
Fatigue and Adrenal Insufficiency
Fatigue is an unpleasant subjective symptom that incorporates total body feelings ranging from tiredness to exhaustion, creating an unrelenting overall condition that interferes with an individual's ability to function at normal capacity [54]. Fatigue is among the most common and distressing symptoms in patients with cancer and usually one of the more difficult to manage since it becomes worse in the advanced phase of the dis-ease [55]. The prevalence of fatigue in ACC patients is high in clinical practice, reflecting the overall activity of the hypothalamic-pituitary-adrenal axis (fatigue is a common effect of hypercortisolism and adrenal insufficiency), and it is perceived as a troublesome symptom.
Fatigue is the expression of several combined pathological mechanisms provoked directly by cancer and antineoplastic treatments: malnourishment; anemia; vitamin and micro-elemental depletion; electrolyte disorders (especially calcium, magnesium, potassium and sodium); diabetes; hypothyroidism (which can be also mitotane-induced in patients with ACC [56]); renal, liver, cardiac or pulmonary insufficiency; hypoxemia; depression; spiritual crisis; and physical activity restrictions [55,57,58]. However, many of the mechanisms underlying fatigue are yet to be unveiled. Central roles for immune system misbalance, dysregulation of the hypothalamus-pituitary-adrenal axis, alteration of circadian rhythms, loss of muscle mass, and abnormalities in the ATP cycle have been hypothesized [59]. There is evidence in the literature that variations in inflammation-related genes may be risk factors for fatigue, suggesting a genetic contribution [55]. Fatigue during ACC treatments, particularly mitotane and/or chemotherapy, is the main factor limiting compliance and cannot be explained entirely by adrenal insufficiency.
The possibility of achieving effective control over fatigue is low, even after the correction of the underlining conditions. Corticosteroids are currently the most commonly used drugs; nonetheless, the synthetic steroid type and dose must be carefully selected for patients with ACC (usually, high-dose substitutive glucocorticoid therapy is required for mitotane-induced adrenal insufficiency). Non-pharmacological treatments may include physical exercise, acupuncture and meditation [60].
Nausea and Vomiting
Nausea and vomiting are common symptoms in cancer patients and can occur alone or simultaneously. They are also among the most common side effects of chemotherapy and radiotherapy, and not only in advanced ACC patients.
According to data published by the European Medicine Agency, nausea, vomiting, diarrhea and anorexia are very common adverse effects during mitotane treatment (≥1/10 patients) [5]; the prevalence of nausea has been found to increase to 90% after EDP-M [36]. Mitotane, a lipophilic drug with poor oral bioavailability of 30-40% [16], is better absorbed following the intake of high-fat nutrients (milk, chocolate or yogurt) [5]. In clinical practice, nausea and vomiting (which can evolve into mucositis [17]) can appear early with a low plasma concentration of 5 mg/L [16]. The combination of the number of medications required, the large size of the tablets, altered taste, nausea and reduced appetite ultimately limit the achievement of the therapeutic range.
Some of the possible consequences of nausea and vomiting are metabolic alterations and electrolyte imbalance, non-adherence to therapy, malnutrition and cachexia. Chemotherapeutic agents and radiotherapy protocols are classified according to their ability to induce nausea and vomiting. Moreover, nausea is one of the most frequent side effects of analgesic opioid therapy, imposing the need for a careful balance of beneficial effects and limiting side effects [50].
Anti-dopaminergic drugs can be used for patients with nausea during ACC treatment: metoclopramide (especially for mitotane-induced nausea), domperidone, haloperidol, levosulpiride and other neuroleptics can effectively control nausea and vomiting. If a single agent is ineffective, switching to another treatment is warranted. Refractory nausea can be treated by adding second-line treatments, such as corticosteroids, benzodiazepines or antiserotoninergic drugs with behavioral adaptations. In radiotherapy-and chemotherapyinduced nausea, ondansetron and other antiserotoninergic drugs and neurokinin receptor antagonists (i.e., aprepitant, fosaprepitant), alone or in combination with antidopaminergics, have shown high efficacy. For refractory vomiting from radio-and chemotherapy, cannabis extracts can be considered [48]. Loperamide is suggested for mitotane-induced diarrhea.
Anorexia and Cachexia
Anorexia and cachexia are multifactorial syndromes that depend on individual factors, cancer type, disease stage and treatment protocol. They are the result of the cancer microenvironment and chronic inflammation [61][62][63]. In patients with advanced cortisol-secreting ACC, hormonal dysregulation and metabolic abnormalities, such as insulin resistance, increased proteolytic activity and lipolysis, can worsen anorexia and cachexia [64]. In clinical practice, changes in appetite, or in the taste of food with subsequent loss of appetite, are commonly reported after starting mitotane (and poorly described in the literature). Moreover, cortisol-induced visceral adiposity [65] correlates with weight loss and muscle mass loss, key factors for decreased treatment response and survival in cancer patients [65][66][67]. Malnourishment and sarcopenia are strongly related to reduced tolerance of chemotherapy, increased risk of postoperative complications and deterioration of QoL. Thus, malnutrition and cachexia strongly affect survival: clinical data suggest that almost 20% of deaths are attributable to malnutrition rather than cancer progression [63,68]. Nutritional support for cancer patients is a major aspect of palliative care: minimal goals could be body weight maintenance and prevention of further weight loss [69]. However, at the end-of-life period, nutritive supplements and artificial nutrition do not impact positively on either survival or QoL [70].
Hormonal orexigenic drugs are used to improve appetite and reduce weight loss in advanced cancer patients, ultimately resulting in improvements in QoL (as reported in a recent meta-analysis [71]). Their prothrombotic effect is the major limiting risk in their use. Anecdotally, steroids (for brief treatments), cyproheptadine and cannabinoids can be used to increase appetite. Cannabis extracts are licensed in Italy, with some restrictions, for the treatment of refractory cancer anorexia [68,72]. Oral ghrelin mimetic and other orexigenic drugs that stimulate appetite are in the development pipeline [73,74].
Depression and Neurological Side Effects
Most patients with cancer have a depressed mood, and this disorder gets worse when approaching the end-of-life period. Some are not able to cope with the existential issues that arise from shorter survival and do not develop sufficient adaptive behavior to overcome the devastating impact of cancer on their lives. Finally, many patients develop recognizable psychiatric diseases; notably, depression [75]. Advanced ACC patients hold many additional organic risk factors that increase the risk of the onset of depression; in particular, metabolic and endocrine alterations, especially in cortisol-secreting ACC [76], and the results of oncological treatments [75]. Moreover, chronic pain and disability resulting from extensive surgical interventions may represent further factors that ignite depression [76][77][78]. Patients who have pre-existing psychiatric disorders should be closely monitored after a cancer diagnosis because they demonstrate a higher rate of depression relapse [79].
The prevalence of major depression in patients with advanced cancers is 5-20% [80]. Studies have also reported also a high prevalence of depression among caregivers of oncological patients (12.5-27.9%) [81]. Survival after a cancer diagnosis is lower in subjects with psychiatric comorbidities: mortality risk is 20% higher in depressed patients [82]. Both psychotherapy and pharmacotherapy have been proven useful for depression in cancer patients. While psychotherapy is effective for minor depression, pharmacotherapy is a requirement for severe depression. Shorter survival periods and the necessity for rapid effects should be carefully considered in patients with advanced disease. The preferred antidepressant drug therapies are serotonin noradrenaline reuptake inhibitors (SNRIs) and selective serotonin reuptake inhibitors (SSRIs) [83][84][85].
Neurological side effects during ACC treatment (not only mitotane) reduce compliance with treatment. Patients with normal/low mitotane plasma levels (<10-14 mg/L) can experience several neurological side effects [20], probably due to enzymatic variability and differing metabolites [16,17]. Mitotane-induced adverse effects in the central nervous system are common (although reported in only 1/10 to 1/100 patients in the ESE/ENSAT guidelines [5], they are more prevalent in clinical practice) and are characterized by loss of concentration and confusion, speech disturbance, ataxia, neuromuscular manifestations, somnolence, diminished thinking speed, depression, decreased memory, muscle tremors, polyneuropathy, vertigo and dizziness. Neurological side effects are common in clinical practice; however, evidence for them in the literature is limited. Some studies have reported the onset of dizziness, fatigue, confusion, movement and coordination disorders, memory loss, concentration difficulties and difficulty talking after short-term use of low-dose [86] or high-dose regimens [87]. In rare cases, symptoms can evolve to severe metabolic encephalopathy [88]. After the onset of mitotane-induced neurological side-effects, close monitoring of plasma levels and dose reduction are suggested. If mitotane is used during EDP or other antineoplastic treatments, the neurotoxicity is increased. Chemotherapy-induced peripheral neuropathy is reported in 50% of patients during cisplatin treatment, and recent preclinical studies have shown that the intake of cisplatin via organic cation/carnitine-mediated transporters into dorsal root ganglia neurons might trigger fasciculations, prolonged muscular contractions, paresthesia and dysesthesia [89].
Pain
Pain is a highly prevalent disturbing and disabling symptom in most patients with cancer. More than half of patients complain of pain following diagnosis, and its prevalence grows to up to 80% in the advanced-phase and end-of-life periods [90,91]. Cancer pain is one of the main determinants of QoL, daily activity limitations and performance status.
According to expert consensus, the prevalence of pain in neoplastic patients is high, and its intensity is mostly moderate to severe. In most patients with ACC, pain is not the first or the dominant symptom; nonetheless, it can be relevant in advanced disease. ACC pain may originate from the enlarging adrenal tumor in the retroperitoneal space directly, peritoneal carcinomatosis or bone/organ metastasis. ACC patients may be affected more often than others by painful osteoporotic bone fractures (e.g., hypercortisolism with glucocorticoid-induced osteoporosis or a skeletal disease that may be secondary to mitotane treatment [92]) and neuropathies secondary to mitotane treatment and chemotherapy.
Cancer pain treatment is based on the skillful use of non-steroidal anti-inflammatory drugs, opioids and adjuvants as neuropathic pain analgesics [51,93,94]. Wide steroid prescriptions for pain that could be reasonable for bone and visceral cancer pain should be carefully considered in ACC due to the risks of interfering with endocrine and hormonal therapy assets. Adrenal insufficiency in patients on long-term opioids must be considered [95]. Despite effective pain management with standard pharmacological therapy in over 80% of cancer patients, the prevalence of uncontrolled oncological pain is still high, reflecting current undertreatment and erroneous drug administration [96].
Simultaneous Care and Palliative Care
Palliative care is an "approach that improves the QoL of patients and their families, address the problems associated with life-threatening illness, through the prevention and relief of suffering by means of early identification and smart assessment and treatment of pain and other problems, physical, psychosocial and spiritual" [97,98]. In recent decades, a few disruptive studies on early management in specialized palliative care programs for advanced cancer patients have shown improved control of psychological and physical symptoms, better communication and planning of the cure and improved QoL determinants. The burden of aggressive oncological treatments and medical costs, particularly in the end-of-life period, decreased, and survival did not change (or even improve). This evidence introduced a new paradigm for palliative care, which passed from an accompaniment attitude for dying patients to a specialist and well-defined discipline aimed at symptom management, spiritual and psychosocial care, caregiver support, empathic communication and end-of-life care [99]. Therefore, evolving from the "cure" to the "care" concept, palliative care has become a form of preventative care [100][101][102]. Nowadays, opinions on the fundamental role of palliative care in modern, patient-centered, integrated cancer diagnostic and therapeutic clinical path- ways have achieved a robust consensus both among experts and professional organizations. The WHO states that palliative care is applicable early in the course of illness in conjunction with other therapies that are intended as curative or life-prolonging treatments, such as chemotherapy or radiation therapy, and that it includes those investigations needed to better understand and manage distressing clinical complications [97].
Patients affected by ACC suffer from several physical symptoms and psychosocial and existential issues, and their QoL is dramatically damaged (as summarized in Figure 2). Many of these complaints are similar to those of other neoplastic patients; nonetheless, ACC patients face endocrine complications and the peculiar side effects of specific treatments. The most commonly reported mitotane-induced side effects are nausea, fatigue, loss of appetite and neurological symptoms, which affect the final compliance of the patient. In the case of severe hypercortisolism, cancer-related depression can be enhanced. The patient with ACC is the center of the galaxy. The green solar system is what we actually consider as life-prolonging or curative treatment. Nonetheless, the patient experiences several symptoms (blue solar system) and lives in a social context (orange solar system), which must be considered in a modern, holistic, multidisciplinary approach.
The Italian Association of Medical Oncology, in accordance with the European Society of Medical Oncology and the American Society of Clinical Oncology, recommends early integration of palliative care in cancer treatments. Therefore, the correct questions are "when" palliative care must intervene in the cancer care trajectory and what the optimal model of care is [109,110], as reported in the Table 1. Instruments exist, such as the NeCPal ICO Tool [111], that can be used to detect patients who require palliative care. NeCPal combines the surprise question "Would I be surprised if this patient dies within the next (6, 12, or 24) months?" with additional clinical parameters (such as nutritional status, symptoms, limitations on/dependency of activity of daily living) and is used to identify patients with limited life prognoses [111,112]. Health-care systems are regulated The patient with ACC is the center of the galaxy. The green solar system is what we actually consider as life-prolonging or curative treatment. Nonetheless, the patient experiences several symptoms (blue solar system) and lives in a social context (orange solar system), which must be considered in a modern, holistic, multidisciplinary approach.
Despite the improvement in survival obtained through comprehensive, multidisciplinary treatment focused on disease [103], some disorders are still unaddressed. Palliative care treats patients as whole biopsychosocial unities, and its integration into the ACC multidisciplinary plan can complete the care pathway both during the antineoplastic treatment period (simultaneous care) and when oncological therapies are no longer effective, associated with unbearable side effects or refused by the patients. Italy's laws guarantee the availability of palliative care for cancer patients.
There is much evidence in the literature in favor of the rapid integration of palliative care into the therapeutic path of patients with advanced cancer early on in active oncological treatments [104]. This approach, which involves the multidisciplinary collaboration of several specialists in the treatment of this category of patients (oncologist, palliative care specialist, endocrinologist, nutritionist, nurses, psychologist), is known as "simultaneous care". This model seems to improve not only control over symptoms associated with cancer but also QoL, the costs of care, the satisfaction of patients/caregivers and survival in some cases [105][106][107][108].
The Italian Association of Medical Oncology, in accordance with the European Society of Medical Oncology and the American Society of Clinical Oncology, recommends early integration of palliative care in cancer treatments. Therefore, the correct questions are "when" palliative care must intervene in the cancer care trajectory and what the optimal model of care is [109,110], as reported in the Table 1. Instruments exist, such as the NeCPal ICO Tool [111], that can be used to detect patients who require palliative care. NeCPal combines the surprise question "Would I be surprised if this patient dies within the next (6, 12, or 24) months?" with additional clinical parameters (such as nutritional status, symptoms, limitations on/dependency of activity of daily living) and is used to identify patients with limited life prognoses [111,112]. Health-care systems are regulated by policies based on evidence-based practice: the tool helps the physician in their decision about when to switch a patient to a palliative-centered plan of care [112]. In a recent systematic review and meta-analysis, the surprise question was found to be one of the most significant predictors of mortality (HR 7.57; 95% CI 4.41-12.99) [113].
A recent study evaluated the impact of simultaneous care in a sample of 753 patients treated at a dedicated outpatient clinic (the Simultaneous Care Outpatient Clinic (SCOC)) in our high-volume Comprehensive Cancer Center [114], demonstrating the importance of close collaboration between oncologists and the palliative care team and of guarantying early access to palliative care, even during active oncological treatments. The same model confirmed the need to use indicators for the assessment of the SCOC team's performance and to improve its organization. A further analysis evaluated the demographic characteristics, tumor site, treatment setting, survival and symptom burden using a validated reported outcome measures, identifying the categories of patients with advanced cancer, regardless of tumor types, who require special attention and quick access to simultaneous care [115].
Palliative care organizations deliver appropriate assistance and mobility aids for functionally impaired patients and psychological and spiritual support for patients and their families, both at the patient's home (home care organizations) and residentially (hospices).
However, modern palliative medicine activities extend further than care and assistance for symptomatic patients. Palliative care time is employed proportionately to build trust with patients; understand their needs, desires, aspirations and wills; include them in the planning for optimal symptom control; and support the difficult choices that disseminate through the course of their disease. Palliative care integrates patient wishes and employs treatment options balancing QoL and increased survival while considering therapy-associated risks and complications.
Palliative care skills encompass prognostication and appropriate communication of bad news. The disclosure of a poor prognosis allows patients to better cope with their disease; if the information is given empathically, a climate of trust can be created in which patients can clarify their new priorities, reset goals and plan novel projects [116]. Knowledge of prognosis is also associated with better time management by family members in assisting their relatives in the end-of-life phases [117]. Shared decision making is a key element of cancer care that requires that the patient has sufficient knowledge of their disease and treatment options and which is greatly facilitated through the plain and empathic support of palliative medicine professionals [9]. Patients must be encouraged and supported during cancer-directed therapies to make informed decisions about their future treatments congruent with their wishes and expectations.
Advance care planning (ACP) is a fundamental process in palliative medicine in which cancer patients can build on their personal values and goals to make informed decisions for their future care [118]. ACP discussions are constantly evolving and represent a balance between patient autonomy and guidance from the healthcare team. These conversations may evolve over time and represent a balance between patient autonomy and the input and guidance from caregivers and healthcare teams [119,120].
Lastly, an important aspect of the current global health landscape is the management of health-related costs. Studies show that supporting palliative care is cost-effective because early palliative care results in minimizing expensive investigations, interventions and hospitalizations at the end-of-life period [9,97,[121][122][123].
Patient-Centered Program and Palliative Care for Patients with Advanced ACC: To-Do List for 2030
According to the recommendations of scientific organizations, palliative care must be introduced early, ideally from when a patient is diagnosed-especially for patients with metastatic and incurable diseases-and continue throughout the therapeutic plan (as shown in Figure 3). In this review, we aimed to describe all the factors that should be considered when combining curative and palliative care: data regarding the positive impact of such a holistic approach are lacking, and not only for patients with ACC. Specialized (secondary) palliative care supervision and coordination of primary palliative care activities, with prompt availability for referral of difficult cases, should be guaranteed. Palliative specialists (physicians, nurses, psychologists and social workers) could participate in multidisciplinary discussions about difficult cases and provide consultations for both hospitalized patients and outpatient palliative care clinics.
The ESE and ENSAT clinical practice guidelines recommend that "all patients with suspected and proven ACC are discussed in a multidisciplinary expert team meeting (including health care providers experienced in care of adrenal tumors, including at least the following disciplines: endocrinology, oncology, pathology, radiology, surgery) at least at the time of initial diagnosis. In addition, this team should have access to adrenal-specific expertise in interventional radiology, radiation therapy, nuclear medicine and genetics as well as to palliative care teams" (R.1.1) and further state that "We recommend integrating palliative care into standard oncology care for all patients with advanced ACC" (R.10.4) [5]. Very advanced and complex ACC patients should be referred to tertiary centers early. We recently reported that early multidisciplinary evaluations can increase overall survival in patients with advanced ACC [6]. Nonetheless, curative treatments are the first part of the patient's life: we only Due to the shortage of palliative medicine specialists, ACC patients with few palliative needs could be appropriately managed by their endocrinologists, oncologists and/or general practitioners (primary or basic palliative care delivery) during hospitalization, at scheduled outpatient visits and at home. Knowledge of palliative care principles and basic skills and their incorporation into clinical practice must be consolidated in the coming years (seminars, formal lessons and rotations for medical students and residents and brief visiting periods to specialized palliative care units for graduates). In the authors' opinion, training in palliative care should be provided for all physicians/nurses involved in the natural history of patients with ACC.
Specialized (secondary) palliative care supervision and coordination of primary palliative care activities, with prompt availability for referral of difficult cases, should be guaranteed. Palliative specialists (physicians, nurses, psychologists and social workers) could participate in multidisciplinary discussions about difficult cases and provide consultations for both hospitalized patients and outpatient palliative care clinics.
The ESE and ENSAT clinical practice guidelines recommend that "all patients with suspected and proven ACC are discussed in a multidisciplinary expert team meeting (including health care providers experienced in care of adrenal tumors, including at least the following disciplines: endocrinology, oncology, pathology, radiology, surgery) at least at the time of initial diagnosis.
In addition, this team should have access to adrenal-specific expertise in interventional radiology, radiation therapy, nuclear medicine and genetics as well as to palliative care teams" (R.1.1) and further state that "We recommend integrating palliative care into standard oncology care for all patients with advanced ACC" (R.10.4) [5]. Very advanced and complex ACC patients should be referred to tertiary centers early. We recently reported that early multidisciplinary evaluations can increase overall survival in patients with advanced ACC [6]. Nonetheless, curative treatments are the first part of the patient's life: we only systematically included a simultaneous care approach and palliative care team in the multidisciplinary evaluation of ACC in recent months. Three stakeholders are currently involved in the multidisciplinary adrenal team at Padova: the University of Padova, the Padova University-Hospital and the Veneto Institute of Oncology (the latter includes the only Pain Therapy and Palliative Care with Hospice Unit in the Veneto region). Palliative specialists should be included in all multidisciplinary teams for ACC, and early and side-by-side collaboration is of the utmost importance to improve the QoL of patients in outpatient clinics, at their homes and, when out-of-treatment, in residential hospices. Fundamental to optimal ACC care is a willingness to share responsibility and decisions regarding the treatment options. Shared planning of care during multidisciplinary discussions for more complicated patients and the periodic meeting of the steering committee represent the standard of care required to continuously improve ACC care strategies [1,9,104]. Palliative and curative interventions must harmonize around unanimous objectives. The transition from primary to secondary palliative care is triggered by the complexity of both care and the prognosis. Recently developed instruments, such as the NeCPal ICO Tool [111], could aid oncologists and endocrinologists (after primary palliative care training) in detecting patients who require direct specialist palliative care [51,124].
Conclusions
To conclude, the burden of disease is often greater in patients with ACC. The standard life-prolonging treatments (surgery, mitotane and chemo-or radiotherapy) are not free of adverse events and can negatively impact the QoL of patients. Moreover, in everyday life, patients and their caregivers face several symptoms, such as nausea, pain, fatigue, anxiety, denial, bad prognoses and so on. European ESE/ENSAT [5] and AACE [3] guidelines recommend the early integration of palliative/simultaneous care in the multidisciplinary evaluation of ACC patients. Parallel treatment of both cancer and the patient is the cornerstone of simultaneous care: the secondary palliative care team should be integrated in the multidisciplinary evaluation of patients with ACC, and the other physicians should have training in primary palliative care.
Conflicts of Interest:
The authors declare no conflict of interest.
|
v2
|
2022-12-04T10:56:55.078Z
|
2022-11-29T00:00:00.000Z
|
254198807
|
s2orc/train
|
The Value of Semiquantitative Parameters Derived from 18F-FDG PET/CT for Predicting Response to Neoadjuvant Chemotherapy in a Cohort of Patients with Different Molecular Subtypes of Breast Cancer
Simple Summary The aim of this study was to investigate whether baseline [18F]Fluorodeoxyglucose ([18F]FDG) positron emission computed tomography/computed tomography (PET/CT) could predict pathological complete response (pCR) after neoadjuvant chemotherapy (NAC) and survival outcomes in patients affected by different molecular subtypes of breast cancer (BC). Semiquantitative parameters, extracted from baseline [18F]FDG PET/CT, seem to be promising in the prediction of response to NAC in Luminal B and Luminal B + HER-2 patients and in the survival prediction of triple negative BC patients achieving pCR after NAC. PET/CT scan with advanced parameter analysis could carve out a synergic role, together with other imaging tools, for a more accurate evaluation of these patients at diagnosis. Abstract Pathological complete response (pCR) after neoadjuvant chemotherapy (NAC) is a strong prognostic factor in breast cancer (BC). The aim of this study was to investigate whether semiquantitative parameters derived from baseline [18F]Fluorodeoxyglucose ([18F]FDG) positron emission computed tomography/computed tomography (PET/CT) could predict pCR after NAC and survival outcomes in patients affected by different molecular subtypes of BC. We retrospectively retrieved patients from the databases of two Italian hospitals (Centre A: University Hospital of Ferrara; Centre B: University of Padua) meeting the following inclusion criteria: (1) diagnosis of BC; (2) history of NAC; (3) baseline [18F]FDG PET/CT performed before the first cycle of NAC; (4) available follow-up data (response after NAC and survival information). For each [18F]FDG PET/CT scan, semiquantitative parameters (SUVmax, SUVmean, MTV and TLG) related to the primary tumor (B), to the reference lesion for both axillary (N) and distant lymph node (DN), and to the whole-body burden of disease (WB) were evaluated. Patients enrolled were 133: 34 from centre A and 99 from centre B. Patients’ molecular subtypes were: 9 luminal A, 49 luminal B, 33 luminal B + HER-2, 10 HER-2 enriched, and 32 triple negative (TNBC). Luminal A and HER-2 enriched BC patients were excluded from the analysis due to the small sample size. pCR after NAC was achieved in 47 patients (41.2%). [18F]FDG PET/CT detected the primary tumor in 98.3% of patients and lymph node metastases were more frequently detected in Luminal B subgroup. Among Luminal B patients, median SUVmean_B values were significantly higher (p = 0.027) in responders (7.06 ± 5.9) vs. non-responders (4.4 ± 2.1) to NAC. Luminal B + HER-2 non-responders showed a statistically significantly higher median MTV_B (7.3 ± 4.2 cm3 vs. 3.5 ± 2.5 cm3; p = 0.003) and TLG_B (36.5 ± 24.9 vs. 18.9 ± 17.7; p = 0.025) than responders at baseline [18F]FDG PET/CT. None of the semiquantitative parameters predicted pCR after NAC in TNBC patients. However, among TNBC patients who achieved pCR after NAC, 4 volumetric parameters (MTV_B, TLG_B, MTV_WB and TLG_WB) were significantly higher in patients dead at follow-up. If confirmed in further studies, these results could open up a widespread use of [18F]FDG PET/CT as a baseline predictor of response to NAC in luminal B and luminal B + HER-2 patients and as a prognostic tool in TNBC.
Introduction
Breast cancer (BC) is the leading cause of cancer-related death among females worldwide and constitutes approximately 15% of all cancer-related deaths in females [1]. BC is a complex neoplasm in terms of management and prognostic assessment due to its multiple clinical and pathological variables [2]. The receptor status (i.e., the expression of estrogen receptor-ER, the progesteron receptor-PR, and the human epidermal growth factor receptor 2-HER-2) is considered essential in the clinical management of BC. Indeed, the definition of luminal categories in BC patients has significantly affected the choice of therapy in any setting of disease, from the diagnosis to the management of metastasis. Luminal A and B (positive ER and negative HER-2) are the most common subtypes, followed by HER-2 enriched and triple negative cancer (TNBC). However, the prognosis of the luminal group is more favorable than the others [3]. Locally advanced breast cancer (LABC) occurs in approximately 30% of patients at the time of diagnosis, and it can be treated with neoadjuvant chemotherapy (NAC) for both testing the chemosensitivity and reducing the size of the tumor [4].
A growing interest around NAC in BC has been reported in recent years, although there are still many variables to settle about this issue (i.e., patients selection, therapeutic agents and number of therapeutic schemes), and a standardized treatment is far from being defined [5]. Based on available literature data, NAC did not demonstrate a clear advantage over conventional adjuvant chemotherapy in terms of outcomes. [6,7]. However, NAC was correlated to BC downgrading, and consequently, to an easier and more conservative breast surgery in a large portion of patients [8]. Moreover, pathological complete response (pCR) after NAC is a recognized strong prognostic factor in BC, particularly in TNBC and HER-2 enriched BC [8]. Breast magnetic resonance imaging (MRI) has provided encouraging results in the assessment of response after NAC, becoming the gold standard modality for pre-surgical treatment response assessment [9]. However, breast MRI can provide only an evaluation of T and N staging after NAC, and several factors can reduce its accuracy, including molecular subtypes (Luminal BC), chemotherapy regimen (taxane and antiangiogenetic drugs), and therapy-induced inflammation and fibrosis [9,10]. Therefore, in recent years [ 18 F]Fluorodeoxyglucose ([ 18 F]FDG), positron emission tomography/computed tomography (PET/CT) has been evaluated with growing interest in BC patients addressed to NAC, as it can provide an in vivo functional evaluation of the metabolism of a cancer lesion before and after therapy [11][12][13]. The possibility of predicting pCR after NAC through baseline imaging data would be of great clinical meaning in BC patients, determining a more tailored treatment approach.
Based on these premises, the aim of our work was to assess the possible role of volumetric parameters derived from baseline [ 18 F]FDG PET/CT to predict response after NAC in a cohort of patients with different molecular subtypes of BC. Moreover, we explored the possible prognostic value of volumetric parameters, correlating them with patients' outcomes in terms of disease-free survival (DFS) and overall survival (OS).
Patients Selection
We retrospectively analyzed 133 patients referring to two Italian hospitals (Centre A: University Hospital of Ferrara; Centre B: University of Padua) for the management of BC between February 2015 and August 2020. Inclusion criteria were: (a) histologically proven diagnosis of BC; (b) history of NAC; (c) baseline [ 18 F]FDG PET/CT scan performed prior to starting NAC; (d) availability of histopathology and follow-up survival data. Patients who did not undergo surgery after NAC were excluded from the study. For every patient, data regarding histology, hormone receptor, and HER-2 status, proliferation rate (expressed by Ki67 index), and BRCA genetic analysis of the BC were retrieved.
Before NAC, a clip was placed to identify the residual disease. NAC regimen was selected on the basis of the histological features of BC, according to the most updated guidelines [15]. The following NAC regimen were used: After NAC, surgery was performed.
Response Assessment and Follow-Up
The Sataloff criteria [16] were considered for the evaluation of response to NAC. A pCR was defined as the complete absence of residual invasive tumor cells on microscopy both in the breast and in the axillary or distant lymph nodes. All patients with tumors showing progression, stable disease, or a partial response after NAC were classified as non-responders.
To evaluate patients' survival, follow-up data were retrieved from the hospital archives of both centres. Patients with missing data were contacted with phone interviews. Outcomes were evaluated in terms of DFS, defined as the time (months) from [ 18 F]FDG PET/CT to the evidence of disease relapse at imaging or histopathology, and OS, defined as the time (months) from the first cycle of NAC to death from any cause.
Image Acquisition
The patients were required to fast for at least 6-8 h and maintain adequate hydration before the [ 18
Response Assessment and Follow-Up
In both centres, the PET/CT images were all processed and analyzed using a Syngo.via Workstation (Siemens Healthineers, Enlargen, Germany) by two experienced board-certified nuclear medicine physicians for each centre.
At the visual analysis, pathological findings were considered focal area(s) of increased tracer uptake or diffusely increased uptake, excluding sites of physiological distribution, in comparison with surrounding tissues. Circular regions of interest (ROIs) were drawn around the primary tumor lesion (B), the axillary lymph nodes (N), extra-axillary lymph nodes (DN) and metastases with focally increased uptake in transaxial slices ( Figure 1). The system automatically adapted the ROI into 3-dimensional volume of interest (VOI) and calculated the following parameters: standardized uptake value (SUV)max, SUVmean, metabolic tumor volume (MTV)-defined as the tumor volume with at least 40% uptake of the SUVmax within the VOI-and total lesion glycolsis (TLG)-calculated multiplying SUVmean and MTV. Semiquantitative parameters of primary tumor (SUVmax_B; SU-Vmean_B; MTV_B; TLG_B) and reference lesions (the most representative one in term of uptake intensity and size) for N (SUVmax_N; SUVmean_N; MTV_N; TLG_N) and DN (SUVmax_DN; SUVmean_DN; MTV_DN; TLG_DN) were reported; moreover, the sum of MTV and TLG values ofevery detected lesion in the scanwere calculated(whole body MTV_WB and TLG_WB). IL, USA). A concomitant low-dose CT scan (120 kV and 80 mA/s) was performed for the attenuation correction of the PET emission data acquired from the mid-thigh to the skull vertex.
Response Assessment and Follow-Up
In both centres, the PET/CT images were all processed and analyzed using a Syngo.via Workstation (Siemens Healthineers, Enlargen, Germany) by two experienced board-certified nuclear medicine physicians for each centre.
At the visual analysis, pathological findings were considered focal area(s) of increased tracer uptake or diffusely increased uptake, excluding sites of physiological distribution, in comparison with surrounding tissues. Circular regions of interest (ROIs) were drawn around the primary tumor lesion (B), the axillary lymph nodes (N), extraaxillary lymph nodes (DN) and metastases with focally increased uptake in transaxial slices ( Figure 1).The system automatically adapted the ROI into 3-dimensional volume of interest (VOI) and calculated the following parameters: standardized uptake value (SUV)max, SUVmean, metabolic tumor volume (MTV) -defined as the tumor volume with at least 40% uptake of the SUVmax within the VOI -and total lesion glycolsis (TLG) -calculated multiplying SUVmean and MTV. Semiquantitative parameters of primary tumor (SUVmax_B; SUVmean_B; MTV_B; TLG_B) and reference lesions (the most representative one in term of uptake intensity and size) for N (SUVmax_N; SUVmean_N; MTV_N; TLG_N) and DN (SUVmax_DN; SUVmean_DN; MTV_DN; TLG_DN) were reported; moreover, the sum of MTV and TLG values ofevery detected lesion in the scanwere calculated(whole body MTV_WB and TLG_WB).
Statistical Analysis
Categorical variables were defined as number (%) and continuous data as median (range) groups or as mean standard deviation. The differences among categorical variables were assessed using the chi-square test, while ANOVA was used to compare the distribution of data among different group of patients. Moreover, Student's t test was used to compare the differences between two independent groups of patients. Receiver operating characteristics (ROC) curves were constructed for continuous variables in order to define the best cut-off values. For each ROC curve, the AUC was calculated. For statistical tests, a p-value ≤ 0.05 was considered the threshold for significance. The statistical analysis was performed by using MedCalc software version 20.115-32-bit (MedCalc Software Ltd., licensed by L.E.).
Statistical Analysis
Categorical variables were defined as number (%) and continuous data as median (range) groups or as mean standard deviation. The differences among categorical variables were assessed using the chi-square test, while ANOVA was used to compare the distribution of data among different group of patients. Moreover, Student's t test was used to compare the differences between two independent groups of patients. Receiver operating characteristics (ROC) curves were constructed for continuous variables in order to define the best cut-off values. For each ROC curve, the AUC was calculated. For statistical tests, a p-value ≤ 0.05 was considered the threshold for significance. The statistical analysis was performed by using MedCalc software version 20.115-32-bit (MedCalc Software Ltd., licensed by L.E.).
[ 18 F]FDG PET/CT Semiquantitative Data and Response to NAC
The analysis of semiquantitative parameters in the 3 subgroups is reported in Table 3. In the Luminal B subgroup a statistically significant difference in median SUVmean_B values was found between responders (7.06 ± 5.9) and non-responders to NAC (4.4 ± 2.1) (p = 0.027). Therefore, patients with a higher SUVmean_B value at baseline [ 18 F]FDG PET/CT were more likely to achieve pCR after NAC. Conversely, Luminal B + HER-2 nonresponders showed a statistically significantly higher median MTV_B (7.3 ± 4.2 cm 3 vs 3.5 ± 2.5 cm 3 ; p = 0.003) and TLG_B (36.5 ± 24.9 vs 18.9 ± 17.7; p = 0.025) than responders at baseline [ 18 F]FDG PET/CT. None of the volumetric parameters could predict pCR after NAC in TNBC.
[ 18 F]FDG PET/CT Semiquantitative Data and Response to NAC
The analysis of semiquantitative parameters in the 3 subgroups is reported in Table 3. In the Luminal B subgroup a statistically significant difference in median SUVmean_B values was found between responders (7.06 ± 5.9) and non-responders to NAC (4.4 ± 2.1) (p = 0.027). Therefore, patients with a higher SUVmean_B value at baseline [ 18 F]FDG PET/CT were more likely to achieve pCR after NAC. Conversely, Luminal B + HER-2 non-responders showed a statistically significantly higher median MTV_B (7.3 ± 4.2 cm 3 vs. 3.5 ± 2.5 cm 3 ; p = 0.003) and TLG_B (36.5 ± 24.9 vs. 18.9 ± 17.7; p = 0.025) than responders at baseline [ 18 F]FDG PET/CT. None of the volumetric parameters could predict pCR after NAC in TNBC. The best cut-offs of volumetric parameters for predicting pCR after NAC were calculated using ROC curves. The statistically significant results are displayed in Table 4
[ 18 F]FDG PET/CT Semiquantitative Data and Survival
The median follow-up for DFS was 73. Figure 3.
Discussion
BC is usually a tumor over-expressing GLUT 1-3 and, therefore, is evaluable with [ 18 F]FDG PET/CT [18]. However, the different subtypes of BC present different [ 18 F]FDG avidities, in relation to their diverse glucose metabolism. TNBC and HER-2 enriched BC usually present a high [ 18 F]FDG uptake, whereas luminal BC are usually characterized by a faint [ 18 F]FDG uptake, in particular luminal A [19]. In our cohort of patients affected by different molecular subtypes of BC, baseline [ 18 F]FDG PET/CT detected 98.3% of primary tumors, confirming its accuracy in aggressive BC [20,21]. Moreover, axillary lymph node metastases and distant lymph node metastases were detected in 64 (56.1%) and 26 (22.8%) patients, respectively (Figure 4). Lymph node metastases were more frequently detected in patients affected by Luminal B BC, in keeping with the most updated guidelines that suggest to perform NAC only in high-risk Luminal B BC after a multidisciplinary discussion [15]. Our results support the use of [ 18 F]FDG PET/CT for the baseline staging of patients with aggressive BC addressed to NAC. With this aim, MRI might be superior to [ 18 F]FDG PET/CT in primary tumor evaluation, but PET/CT provides a whole body disease evaluation. Therefore, the two imaging modalities could play a synergic role in the future for this subset of patients; however, the cost-effectiveness of this proposed strategy needs to be further evaluated.
Semiquantitative parameters extracted from PET/CT data saw a rising use in the last decade, both for [ 18 F]FDG and non-[ 18 F]FDG imaging [22][23][24]. Among those, SUVmax is the most commonly utilized, but volumetric parameters have recently been growing in terms of diffusion and interest. MTV defines the volume of metabolic active tumor, whereas TLG combines the volume and the intensity of the metabolic activity of a lesion. Moreover, the sum of the values of the volumetric parameters for each [ 18 F]FDG uptake could provide a quantification of the whole body tumor burden, which is relevant for patients' prognosis. Semiquantitative parameters extracted from PET/CT data saw a rising use in the last decade, both for [ 18 F]FDG and non-[ 18 F]FDG imaging [22][23][24]. Among those, SUVmax is the most commonly utilized, but volumetric parameters have recently been growing in terms of diffusion and interest. MTV defines the volume of metabolic active tumor, whereas TLG combines the volume and the intensity of the metabolic activity of a lesion. Moreover, the sum of the values of the volumetric parameters for each [ 18 F]FDG uptake could provide a quantification of the whole body tumor burden, which is relevant for patients' prognosis.
A few papers investigated the correlation between semiquantitative parameters extracted from [ 18 F]FDG PET/CT and pCR after NAC. In particular, Galán et al. [25] failed to identify a role of volumetric parameters in pCR prediction. Conversely, Evangelista et al. [26] showed a predictive value of TLG_WB for DFS, and Hyun et al. [27] reported that the variation of MTV_WB was predictive for OS at multivariate analysis in BC patients treated with NAC. However, these studies considered BC patients regardless of the molecular subgroup. In our work, we aimed to identify semiquantitative parameters extracted from baseline [ 18 F]FDG PET/CT that could predict pCR after NAC in three different molecular subgroups of patients, being different in terms of NAC regimen, A few papers investigated the correlation between semiquantitative parameters extracted from [ 18 F]FDG PET/CT and pCR after NAC. In particular, Galán et al. [25] failed to identify a role of volumetric parameters in pCR prediction. Conversely, Evangelista et al. [26] showed a predictive value of TLG_WB for DFS, and Hyun et al. [27] reported that the variation of MTV_WB was predictive for OS at multivariate analysis in BC patients treated with NAC. However, these studies considered BC patients regardless of the molecular subgroup. In our work, we aimed to identify semiquantitative parameters extracted from baseline [ 18 F]FDG PET/CT that could predict pCR after NAC in three different molecular subgroups of patients, being different in terms of NAC regimen, chemosensitivity, and prognosis. Luminal B patients who achieved pCR after NAC had significantly higher median SUVmean_B than non-responders. This means that the metabolic activity of the primary tumor seems to be the main feature for predicting NAC results in Luminal B patients. In Luminal B + HER-2 patients, volumetric parameters of the primary tumor resulted significantly lower in responders vs. non-responders. As a consequence, we can speculate that for this sub-group of patients the main feature to consider is the extension of the primary tumor. Surprisingly, we did not find any semiquantitative parameter able to predict pCR after NAC in TNBC patients. Perhaps PET-derived radiomic features and artificial intelligence could provide better results for this clinical target, even though standardization and time-reducing automated software are still lacking for routine radiomic use [28][29][30][31]. The possibility to predict pCR after NAC from baseline imaging would be of utmost clinical relevance. Indeed, detecting responders could induce a calibration of the treatment regimen (reduced number of schemes and, consequently, treatment-related toxicities and optimized time to surgery), while identifying non-responders could induce the clinicians to select a tailored therapeutic approach and a shorter time revaluation. As a consequence, we tried to calculate the best cut-offs of semiquantitative parameters to help the clinicians to early identify patients who could have a reduced possibility of achieving pCR after NAC. We believe that every centre should calculate their own cut-off values for this purpose, as they are relatively easy to obtain and could provide an added value in clinical daily practice. Hopefully, the widespread of automated software will speed up the extraction of these data from PET/CT images, allowing a wider use of semiquantitative parameters in future daily clinical practice.
Several papers have already correlated [ 18 F]FDG PET/CT results and prognosis in patients affected by different molecular subtypes of BC and in several settings of disease [20,32,33]. As expected we found that several median baseline volumetric parameters were higher in patients non-responders to NAC than the counterpart and also in died patients than those who alived, both for Luminal B (MTV_N, TLG_N and TLG_wb) and Luminal B + HER-2 patients (SUVmax_N, SUVmean_N). This is consistent with the multiple literature evidence reporting a strong negative prognostic factor of residual disease burden in BC, which is more likely to remain in patients with a higher baseline burden of disease [8,34]. However, we also found that among TNBC patients who achieved pCR after NAC, the median values of 4 volumetric parameters were significantly higher in patients dead vs. alive at follow-up. Interestingly these parameters are all volumetric parameters, referring to the primary tumor (MTV_B and TLG_B) and to the whole body burden of disease (MTV_wb and TLG_wb). To the best of our knowledge, this is the first paper reporting the potential of [ 18 F]FDG PET/CT in predicting the outcomes of TNBC patients achieving pCR after NAC. Moreover, this result was found for TNBC, which is the most aggressive molecular subtype of BC [35]. We believe that this result could have a very high relevance in daily clinical practice if confirmed in larger sample trials.
Finally, this study is not devoid of limitations. Main limitations are the retrospective design of the study and the lack of sample size calculation. A second mild limitation derives from the two similar, but still different, last generation PET tomographs of the same company (Siemens Medical Solutions) in the two hospitals; although we adopted the same acquisition protocol according to the EANM guidelines [17], no phantom-based harmonization strategy was tested to reduce interscanner quantification variability. Moreover, the number of patients enrolled was inhomogeneous between the 2 centres (34 vs. 99) due to the different catchment area. A limit in the survival analysis derives from the low mortality rate of our patient population (low number of events at follow-up) and the small size of the molecular subgroups.
Conclusions
This work confirmed literature data reporting the high accuracy of baseline [ 18 F]FDG PET/CT for the systemic staging in BC patients. [ 18 F]FDG PET/CT could carve out a synergic role together with other imaging tools for a more accurate evaluation of these patients at diagnosis.
The analysis of semiquantitative parameters demonstrated that the metabolic activity of the primary tumor (SUVmean_B) and the extension of the primary tumor (MTV_B and TLG_B) seem to be the main features to consider for predicting pCR after NAC in Luminal B and Luminal B + HER-2 patients, respectively. Semiquantitative parameters were unreliable for predicting responders vs. non responders to NAC in TNBC; [ 18 Institutional Review Board Statement: The study was conducted in accordance with the Declaration of Helsinki, and approved by the Internal Institutional Review Boards of the two institutions involved (University Hospital of Ferrara and University of Padua).The ethical committee does not provide a code for retrospective studies that do not require the execution of additional diagnostic tests with respect to the standard clinical management.
Informed Consent Statement:
Written informed consent has been obtained from the patients to publish this paper.
|
v2
|
2022-12-05T05:13:36.742Z
|
2022-11-29T00:00:00.000Z
|
254223465
|
s2orc/train
|
The Transcriptome and Proteome Networks of Malignant Tumours Reveal Atavistic Attractors of Polyploidy-Related Asexual Reproduction
The expression of gametogenesis-related (GG) genes and proteins, as well as whole genome duplications (WGD), are the hallmarks of cancer related to poor prognosis. Currently, it is not clear if these hallmarks are random processes associated only with genome instability or are programmatically linked. Our goal was to elucidate this via a thorough bioinformatics analysis of 1474 GG genes in the context of WGD. We examined their association in protein–protein interaction and coexpression networks, and their phylostratigraphic profiles from publicly available patient tumour data. The results show that GG genes are upregulated in most WGD-enriched somatic cancers at the transcriptome level and reveal robust GG gene expression at the protein level, as well as the ability to associate into correlation networks and enrich the reproductive modules. GG gene phylostratigraphy displayed in WGD+ cancers an attractor of early eukaryotic origin for DNA recombination and meiosis, and one relative to oocyte maturation and embryogenesis from early multicellular organisms. The upregulation of cancer–testis genes emerging with mammalian placentation was also associated with WGD. In general, the results suggest the role of polyploidy for soma–germ transition accessing latent cancer attractors in the human genome network, which appear as pre-formed along the whole Evolution of Life.
Introduction
Metastatic cancer is one of the leading causes of death in the world [1,2]. A major determinant of its lethality is the ability of late-stage solid tumours to become increasingly resistant to anti-cancer treatments. Cancer research still lags in understanding the biological reasons for this resistance. Somatic cancers are known to ectopically express the genes related to reproductive processes, such as cancer-testis antigens [3][4][5][6][7] and meiosisspecific genes [7][8][9][10][11][12][13], as well as a wide range of genes specific both to primordial and adult germ cells [14]. Based on the existing overlap between the three aforementioned lists of genes (meiotic, cancer-testis and germ cell-specific), we shall refer to them as a united group of "gametogenesis-related genes" (GG). GG expression is generally associated with a worse patient prognosis [14][15][16][17][18][19]. Reproductive genes paradoxically play a role in promoting the severity and lethality of cancers, which by their origin are somatic. Another notable hallmark of cancer lies in the tendency of tumour cells to acquire whole genome duplications (WGD) and unstable aneuploidy karyotypes, which are also associated with poor outcomes [20]. While at first glance it seems that aneupolyploidy would interfere with mitotic division and proliferation of tumours, it paradoxically favours resistance to treatment, cancer relapse and metastatic growth [21][22][23][24]. This puzzle of cancer could be Int. J. Mol. Sci. 2022, 23, 14930 2 of 26 overcome by the assumption that reproduction-related genes in cancer cells are involved in an atavistic life-cycle-like process ensuring the perpetuation of generations [25], which is realized through reversible polyploidy (ploidy cycles) that gave evolutionary origin to meiosis and sex [26]. This cancer unicellular life-cycle hypothesis was inspired by the observations of tumour giant cells in their prolonged response to ionising irradiation, finding the phenotypes comparable with those of some protists undergoing cycling polyploidy in their life-cycle [25,[27][28][29].
From that standpoint, "dormant" polyploid giant cancer cells (PGCCs), which are heavily implicated in resistance, are presumed to represent a kind of "cancer germline" that is reciprocally linked to a mitotically dividing cell line, cyclically renewing its immortality [30].
The reproductive role of cancer polyploidy has been intensively studied and reviewed over the last two decades in our and about 20 other laboratories, and also earlier, becoming more and more recognised worldwide. It was shown that a single PGCC is able to induce a metastatic tumour at xenotransplantation [31] and appears similar to an early embryo [32][33][34][35][36][37][38][39][40][41][42]. A summary table of these studies is available in [43], the historical arrow diagram of cancer polyploidy research milestones-in Moein et al. [42], the latest advances united in a special issue [44]. This, along with the exchangeability of tumour and embryo nuclei and cells, already shown in the 20th century, has thus awakened and led to the emergence of a new, polyploidy-related twist on the embryonal theory of cancer, which initially originated in the 19th century [32][33][34][35][36][37][38][39][40][41][42].
Meiosis requires a tetranemic bivalent from two replicated parental homologous chromosomes for the main event of meiosis I-meiotic recombination and crossover, which effectively repair DNA, prevent accumulation of deleterious mutations with loss of heterozygosity (LOH), and provide genetic diversity [45,46]. The next important role of meiosis is the ordered halving of DNA content (suppressing one DNA replication cycle between two cell divisions), which might be involved, as suggested in [11,47], in the depolyploidisation of PGCCs whose progeny can start a new life-cycle.
In multicellular organisms, the germ cells are either specified during embryonic development or generated from somatic cells in a soma-to-germ transition (e.g., in plants, this is a very common phenomenon) [48]. Bruggeman et al. [14], who had observed the widespread expression of germ cell-specific (from embryonic to adult) genes in a wide database set from cancer cell lines and primary malignant tumours, proposed the involvement of such a soma-to-germ transition process in cancer evolution; the same was proposed by [5,8,34], while we have reported the induction of the embryonic stem cell-like markers (POU5F1, SOX2, NANOG) starting after DNA damage together with the polyploidy cycles [49]. In turn, cancer-testis (CT) genes are also considered cancer stem cell biomarkers [50,51]. The expression of cancer-testis genes may contribute to the ploidy cycle in both its poly-and depolyploidisation stages. Some of them are involved in meiosis and germ cell development, and some, particularly members of the Melanoma Antigen Gene (MAGE) family and PRAME, are implicated in the downregulation of the p53 tumour suppressor [52][53][54], epigenetic reprogramming to stemness, and germline initiation [55,56], along with suppression of differentiation [57] and poor clinical prognosis [56,58].
However, it still remains to be seen whether this association between GG expression and cancer is pre-programmed (correlated, networked, and module-hubbed), or, as suggested by some authors [59], coincidental and random. On the other side, between those who do not doubt the programmatic atavistic development of cancer, there is a controversy over the time of its evolutionary origin, unicellular or early multicellular [60][61][62]. More fundamentally, there is also no clarity on the functional role of the meiotic toolkit in polyploidy-including life-cycles of the obligatory agamic protists [63,64]. In this study, we approach these questions by means of complex network analysis on publicly available cancer patient datasets (transcriptomes, inferred ploidy/WGD values, phylostratigraphy, and proteomes). To explain our goals, it is important to highlight the prerequisites in more detail.
Firstly, Stuart Kauffman, and then together with Sui Huang and Ernberg, proposed an idea that human cancer is driven by an attractor of the genome network that was evolutionary pre-formed (but not used) near the top of the onto-phylogenetic tree [65,66]. Indeed, phylostratigraphic studies revealed the evolutionary origin of cancer-driving genes [67] and a cancer transcriptome evolutionary gene profile shift to the emergence of multicellularity from unicellularity [60,[68][69][70], likely disrupting the normal gene balance between uni-and multicellularity gene expression in the mammalian genome [61]. Interestingly, the earliest naturally occurring tumour was observed as far back as in the basal Eumetazoan Hydra [71]. However, the role of polyploidy in this phylostratigraphic shift of primary tumours, to our knowledge, has not been investigated.
Polyploidy as such (in normal mammalian tissues) induces a similar epigenetic shift favouring upregulation of unicellular and early multicellular genes (phylogenetic strata 1-5, from Prokaryotes to Eumetazoa), accompanied by downregulation of the genes of complex multicellularity, responsible for apoptosis, differentiation, immunity, and cell communication [72]. This shift towards unicellularity is aided by the ploidy-upregulated key proto-oncogene c-myc (originated in Opisthokonta) opening the chromatin for reprogramming [73], leading to epithelial-mesenchymal transition (EMT) [72,[74][75][76] and hubbing the network nest of upregulated bivalent genes (in the same phylogenetic strata 1-5). The latter enable a critically rapid switch of the gene promoter activity from a suppressed to an active state. Moreover, cancer gene ontology (GO) modules embracing the c-MYC-HRAS axis and EGFR nest become activated by polyploidy [72,[74][75][76].
Here it is worth adding that the current experimental evidence of cancer's resistant response to conventional therapy can be summed up in three stages: induction of cellular senescence (with telomere attrition and persistent DNA damage signalling), polyploidisation, and reciprocal reprogramming/self-renewal [77]. The link between stress-induced accelerated cell senescence and reprogramming has been shown in many studies [30,[78][79][80][81].
The meiotic pachytene recombination checkpoint has initially evolved from the mitotic G2/DNA damage checkpoint and uses some proteins from it [82,83]. As such, the persistent DNA damage induced in accelerated cellular senescence by oncogenes, drugs, or oxidative stress may enable cancer cells to slip from the mitotic DNA damage checkpoint into the meiotic prophase, as suggested in [77], assuming a polyploidisation variant in the form of Mos-driven endomitosis [27]. The other (or the same) route are the cycles of so-called mitotic slippage (reversal of metaphase arrest after DNA re-replication, not accomplishing mitosis) expressing the meiotic proteins (DMC1, SPO11, MOS, REC8, STAG3, SCYP1, SCYP3, POU5F1) observed in vitro on the irradiated p53-mutant lymphoma cell lines [12,27], and doxorubicin-treated basal breast cancer cell line [81] and some meiotic genes in luminal MCF7 cancer after TOPO I inhibitor [84].
The problem is that, although GG genes were found abundantly expressed in tumours and associated with poor survival of patients, thus assigning fitness advantage to cancer cells, the conventional meiosis has never been microscopically observed, but instead, the polyploidy associated with meiotic markers was found [30,85]. On the other hand, there exist valid gene phylostratigraphic results demonstrating the converging of both WGD and the origin of cancer-driving genes to the same paleontological period of early eukaryotic evolution (as indicated above). Moreover, Quinton et al. [86] detected differences between transcriptomes of diploid (WGD-) and polyploid (WGD+) in the Cancer Genome Atlas (TCGA) tumours highlighting suppression of immunity, but the relationship between polyploidy and meiosis was not addressed there. The evidence of GG expression in cancer might have a programmatic evolutionary significance, if not only their presence but also networking and cooperation were to be proven in the context of polyploidy. The theoretical basis of these insights from the literature and the bioinformatics work in similar studies converging to the aim and design of the current work is schematised in Figure 1. The goal was to evaluate, through bioinformatics analysis of GG genes and proteins, their programmatically atavistic link with cancer polyploidy and to define the relevant attractor(s) in the human genome.
polyploidy. The theoretical basis of these insights from the literature and the bioinformatics work in similar studies converging to the aim and design of the current work is schematised in Figure 1. The goal was to evaluate, through bioinformatics analysis of GG genes and proteins, their programmatically atavistic link with cancer polyploidy and to define the relevant attractor(s) in the human genome. [14,25,38,41,60,65,69,72,74,86]); in a green box, the aims and design addressed in the current study.
In synthesis, our results rule out the purely coincidental/random hypothesis of GG expression in favour of the re-activation of highly structured latent coexpression modules. Even if in this work, we do not make any direct PGCC observation, the emerging picture of robust GG upregulation by polyploidy (WGD) in multiple tumour types, as well as the highly organized coexpression networks that include them, give a relevant (albeit implicit) support to this hypothesis. Moreover, the obtained results suggest the role of polyploidy in soma-germ transition by visiting and interconnecting cancer attractors, preformed in the human genome network, during the origin and development of reproductive life-cycles, along the whole Evolution of Life.
In synthesis, our results rule out the purely coincidental/random hypothesis of GG expression in favour of the re-activation of highly structured latent coexpression modules. Even if in this work, we do not make any direct PGCC observation, the emerging picture of robust GG upregulation by polyploidy (WGD) in multiple tumour types, as well as the highly organized coexpression networks that include them, give a relevant (albeit implicit) support to this hypothesis. Moreover, the obtained results suggest the role of polyploidy in soma-germ transition by visiting and interconnecting cancer attractors, pre-formed in the human genome network, during the origin and development of reproductive life-cycles, along the whole Evolution of Life.
Of 29 cancer types, 7 (BLCA, BRCA, GBM, LIHC, LUAD, PRAD, SARC) used in the tumour WGD study by Quinton et al. [86] have >100 ploidy-upregulated genes, of which more than 10% belong to the GG group (the maximum being BRCA at 25.27%). Furthermore, the GG genes are clearly depleted among ploidy-down-regulated genes (lefttailed binomial test p < 0.05 in all cancer types with any down-regulated GG), with the maximum proportion of GG genes among down-regulated genes being just 3.54% (Table 1). A statistically significant (binomial test p < 0.05) trend towards GG upregulation rather than downregulation can be observed in 13 cancer types (BLCA, BRCA, GBM, HNSC, KICH, LIHC, LUAD, OV, PRAD, SARC, STAD, TCGT, UCEC). Furthermore, 17 of 29 tumour types have at least one gene from the GG group fall into the top-25 genes when ranked by the highest logFC. A total of 10 of these tumour cohorts have MAGE group members in their top-25 upregulated genes; 3 (BRCA, HNSC, LUAD) have both MAGEs and PRAME in their top-25 upregulated genes. In an attempt to uncover the evolutionary meaning of GG gene upregulation in polyploid cancer, we next decided to investigate the evolutionary history of GG gene origin using gene-phylostratigraphic information.
The Phylostratigraphic Distribution of GG Genes
After plotting the phylostratigraphic distribution of GG genes based on the gene phylostrata classification used by Trigos et al. [60], we observed significant peaks in phylostrata 2 (Eukaryota) and 8 (Euteleostomi) ( Figure 2). Overall, this distribution was approximately concurrent with the reference of all available genes for which phylostratigraphy information was available. However, compared to the reference, GG genes show higher enrichment in the 12th and 14th phylostrata of placental animals and ancestral primates. The list of GG genes per phylostratum is presented in Table S1.
After plotting the phylostratigraphic distribution of GG genes based on the gene phylostrata classification used by Trigos et al. [60], we observed significant peaks in phylostrata 2 (Eukaryota) and 8 (Euteleostomi) ( Figure 2). Overall, this distribution was approximately concurrent with the reference of all available genes for which phylostratigraphy information was available. However, compared to the reference, GG genes show higher enrichment in the 12th and 14th phylostrata of placental animals and ancestral primates. The list of GG genes per phylostratum is presented in Table S1. Briefly, from this GG list, it can be seen that the powerful meiosis-specific recombinase DMC1 (the homolog of bacterial RecA which appeared in the Archaea in two forms [87,88]), along with the recombinase RAD51, fall into the Prokaryotic stratum 1, while most of the meiotic recombination toolkit with HORMAD (which can organise the axial Briefly, from this GG list, it can be seen that the powerful meiosis-specific recombinase DMC1 (the homolog of bacterial RecA which appeared in the Archaea in two forms [87,88]), along with the recombinase RAD51, fall into the Prokaryotic stratum 1, while most of the meiotic recombination toolkit with HORMAD (which can organise the axial element for chromosome pairing [89], and the meiotic Aurora kinase variant C (cooperating with mitotic AURKB), are already present in the 2nd Eukaryota stratum. DNA damage response elements (ATR and CHEK1, integrating ATR and ATM signalling) also appear in strata 2 and 3, respectively, and the MOS-kinase, responsible for the main steps of female meiosisthe recombination-dependent monopolar spindle and oocyte maturation [34,90,91]-in stratum 4 (Metazoa). Stratum 5 adds PRDM14, PRDM9 and DAZL for the commitment of primordial germ cells. The important element of the conventional meiosis-the protein of the synaptonemal complex central element (SYCP1), together with the SGO stabilisers of the meiotic centromeric cohesin REC8, developed by stratum 8, coinciding with the Cambrian explosion. Late strata 12 and 14, starting from the Eutherians (placental mammals), added the majorly X-chromosome-linked CT genes (PRAME, most MAGEA genes in stratum 12, the GAGE and PAGE groups in stratum 14 (Catarrhini-Old World monkeys)-normally found in both gonads and the placenta [92]. The Homo sapiens stratum 16 added only the STAG2 component of the meiotic cohesin complex. The STRING network representation of the GG genes falling into the respectively oldest and dominant 1st and 2nd strata can be seen in Figure 3. commitment of primordial germ cells. The important element of the conventional meiosis-the protein of the synaptonemal complex central element (SYCP1), together with the SGO stabilisers of the meiotic centromeric cohesin REC8, developed by stratum 8, coinciding with the Cambrian explosion. Late strata 12 and 14, starting from the Eutherians (placental mammals), added the majorly X-chromosome-linked CT genes (PRAME, most MAGEA genes in stratum 12, the GAGE and PAGE groups in stratum 14 (Catarrhini-Old World monkeys)-normally found in both gonads and the placenta [92]. The Homo sapiens stratum 16 added only the STAG2 component of the meiotic cohesin complex. The STRING network representation of the GG genes falling into the respectively oldest and dominant 1st and 2nd strata can be seen in Figure 3. It is seen that the meiotic cell cycle appeared in Eukaryota, coupled with the recombination DNA repair, along with sex (gamete generation). Applying the same method to ploidy-upregulated GG genes in the TCGA dataset ( Figure 4) revealed a dominant peak at phylostratum 2 in 15 of the 17 tumour types eligible for analysis (having >10 upregulated GG genes), along with high variability of the other part of the histogram occupying the whole evolutionary timeline, still highlighting a notable peak at stratum 8 (save for the TGCT cancer, which is also depleted of the later ploidy-upregulated GG genes). In all other tumours including PRAD, CT genes of the strata 12-14 (placental and hominid animals, respectively) are more or less overexpressed; in LUSC, this peak is dominating. The CT genes found, besides tumours and testis, in normal ovaries and placenta, inspired Lloyd Old's witty conclusion: "Cancer is a somatic cell pregnancy" [93]-a paradox which will be later discussed. the whole evolutionary timeline, still highlighting a notable peak at stratum 8 (save for the TGCT cancer, which is also depleted of the later ploidy-upregulated GG genes). In all other tumours including PRAD, CT genes of the strata 12-14 (placental and hominid animals, respectively) are more or less overexpressed; in LUSC, this peak is dominating. The CT genes found, besides tumours and testis, in normal ovaries and placenta, inspired Lloyd Old's witty conclusion: "Cancer is a somatic cell pregnancy" [93]-a paradox which will be later discussed. . The phylostratigraphic distribution of ploidy-upregulated GG genes in 17 primary TCGA tumour types (that meet the criteria of having >10 ploidy-upregulated GG genes). The histograms of the 6 tumour types whose STRING and coexpression networks of upregulated genes are enriched for meiosis and gametogenesis-related GO and KEGG modules are highlighted in red, the 3 tumour types for which the former is true only in the case of STRING networks-in blue. Notably, they have a similar pattern of phylostratigraphic distribution of GG genes along the evolutionary tree, which is also similar in COAD and represents the most frequent types of somatic human cancers. Abbreviations are the same as in Table 1.
Examining the STRING protein-protein interaction (PPI) networks of the 29 TCGA tumours at both medium and high confidence revealed that nine of them (bladder carcinoma, breast carcinoma, glioblastoma, liver hepatocellular carcinoma, lung adenocarcinoma, stomach adenocarcinoma, prostate adenocarcinoma, sarcoma, uterine corpus carcinoma) possess the ploidy-upregulated meiotic GO and KEGG modules. An example of such a network in BRCA samples is shown in Figure 5. It demonstrates a tightly associated sub-network of the meiotic cell cycle with strictly meiosis-specific (i.e., HORMAD1, MND1, SMC1B) genes and includes CT genes such as TTK and PBK (known also for metastatic prostate carcinoma [94]). Furthermore, the giant sub-network is connected through PRAME to a cluster of MAGEfamily of CT-proteins, which are considered to be metastasis-favouring oncogenes playing an important role in the soma-to-germ transition-by epigenetic reprogramming, germ commitment, and differentiation suppression (reviewed in Introduction).
Examining the STRING protein-protein interaction (PPI) networks of the 29 TCGA tumours at both medium and high confidence revealed that nine of them (bladder carcinoma, breast carcinoma, glioblastoma, liver hepatocellular carcinoma, lung adenocarcinoma, stomach adenocarcinoma, prostate adenocarcinoma, sarcoma, uterine corpus carcinoma) possess the ploidy-upregulated meiotic GO and KEGG modules. An example of such a network in BRCA samples is shown in Figure 5. It demonstrates a tightly associated sub-network of the meiotic cell cycle with strictly meiosis-specific (i.e., HORMAD1, MND1, SMC1B) genes and includes CT genes such as TTK and PBK (known also for metastatic prostate carcinoma [94]). Furthermore, the giant sub-network is connected through PRAME to a cluster of MAGE-family of CT-proteins, which are considered to be metastasis-favouring oncogenes playing an important role in the soma-to-germ transition-by epigenetic reprogramming, germ commitment, and differentiation suppression (reviewed in Introduction). In Figure 5, besides the elements of the meiotic cell cycle composed of functional nodes: meiotic cell cycle checkpoint (responsible for meiotic DNA recombination) and female meiosis including oocyte maturation, the polyploidy-related network contains an element of mitotic karyokinesis-spindle midzone assembly, which will be later discussed. The enrichment of GO and KEGG modules related to oocyte meiosis is seen in the six STRING networks of nine meiotic module-enriched tumour cohorts (Files S1).
Moreover, performing coexpression network analysis on six of the total nine meiosis module-enriched tumour types (the other three were rejected from coexpression network analysis due to not meeting both criteria of at least 100 upregulated genes and at least 50 polyploid samples with a purity > 0.5), in line with the STRING results, also revealed that the giant component of the ploidy-upregulated gene coexpression network is enriched for meiosis-related GO and KEGG modules in general, and modules relating to oogenesis/female meiosis in particular. The tumour types selected for coexpression network analysis are listed in Table 2. The analysis revealed a high proportion of the ploidy-upregulated genes associating into a network enriched with the meiotic and female-specific meiotic GO/KEGG modules with high average clustering coefficients. An example of one such coexpression network (TCGA-BRCA), with 125 nodes, 1700 edges, and an average clustering coefficient of 0.68 can be observed in Figure 6A, and the functional enrichment results thereof in Figure 6B. The rest of the networks have been deposited and are publicly available in the Network Data Exchange (NDEX) database (see Data Availability Statement below).
The Senescence Module of the Ploidy-Upregulated Gene Network
Among the six tumour types with highly WGD-upregulated GG genes and enriched meiotic (among them, female-specific) modules in both STRING and coexpression networks, three (BRCA, LUAD and LIHC) demonstrated the enrichment of the cellular senescence KEGG module (seen in File S2). There, we found that the well-known G1/S transition inhibitor CDKN2A (encoding p14 and p16) and the upregulation of CHEK1 Checkpoint kinase 1 integrating signals from ATM and ATR, the two cell cycle proteins involved in DNA damage responses G2M transition regulation, also associate with chromatin in meiotic prophase. Additionally, FOXM1 participating in DNA damage response should be highlighted. The upregulated member of the MYB family of transcription factor genes family MYBL2 has been shown to activate cyclin D1 (involved in polyploidisation) and interact with multiple insulin-like growth factor-binding proteins [95]. This auto-regulating loop is associated with the frequent deregulation of the insulin growth factor signalling pathway in cancer [96]. Interestingly, 14 of the 29 TCGA cancer types, including the three with the enriched senescence module, show ploidy-upregulation of IGFBPs and IGF2BPs, IGF2BP1 and IGF2BP3 being the most frequently encountered. IGF2BP1 and IGF2BP3 are oncofoetal proteins that are involved in stem cell renewal, organogenesis, and gametogenesis [97][98][99], and are also listed as MYBL2 interactants in the Harmonizome database [95].
This may be related to the fact that senescence induces DNA double-stranded breaks (DSBs), which, viewed in the context of GG gene expression and meiosis, may be interpreted as conferring the capability for a soma-germ transition from the mitotic DNA damage checkpoint in G2 (equivalent to WGD, in case of interrupted mitotic cell division, as discussed in Introduction). The insulin-like growth factor (IGF1)-related pathways may play the same or a converging role in a soma-germ transition. Insulin can substitute progesterone for inducing female oogenesis through direct activation of MOS by Ras upregulation in senescent somatic cells [34]. IGF1-related pathways are activated by hypoxia/an acidic environment [100]. As for the ploidy-down-regulated genes, the results of GO and KEGG enrichment analysis on both STRING and coexpression networks largely skew towards immunityrelated processes in all nine analysed GG-enriched tumour types. The same was shown by [74] as related to polyploidy in normal tissues, and by [86] as related to polyploidy in tumours. Modules related to apoptosis and tissue homeostasis are also stably present in the ploidy-down-regulated gene networks (File S3).
Malignant Melanoma (MM) and BRCA Proteome Analysis Reveal Robust Expression and Coexpression of GG Proteins
In order to investigate GG gene expression and coexpression in cancer on the protein level, we selected and analysed two recently published high-throughput proteomics datasets of MM and BRCA.
The Malignant Melanoma Proteome
Hierarchical clustering had stratified the MM500 database [101] patient cohort into six clusters ( Figure S1). Taking into account the limited available clinical data, as well as the presence of non-random missing patterns provoking the impossibility to discriminate the existence of distinct biological subtypes from a batch effect, we decided to focus on the largest distinctive patient subset (n = 142), or Cluster 3 on Figure S1 for further analysis.
Overall, in the whole MM500 database melanoma proteome matrix, 411 proteoforms of reproduction-related genes (382 unique gene IDs) were found to be expressed in at least 20% of the samples (101 of 505). Patient Cluster 3, which was selected separately for further analysis, demonstrated the expression of 513 such proteoforms (501 unique gene IDs) in at least 20% of its constituent samples (>28 of 142).
After calculating correlations, thresholding the protein pairwise correlation matrix at |0.6|, and transforming it into a binary adjacency matrix, it was revealed that the vast majority (n = 452) of the expressed GG genes are also significantly coexpressed, forming the giant component of a network with a total of 3035 edges. Upon analysing the network with base Cytoscape [102] functionalities, it was determined to have an average clustering coefficient of 0.34 and an average shortest path length of 3. 43.
Ranking the nodes in the network by degree ( Figure 7A) reveals a highly interconnected "core" sub-network in its middle. Markov Cluster Algorithm (MCL) clustering at a granularity parameter of 2.5 extracted that interconnected component of 134 nodes and 1432 edges, with an average clustering coefficient of 0.58 and average shortest path length of 2.26 ( Figure 7B).
In addition, GO biological process (BP) and KEGG enrichment analysis (right-sided hypergeometric test using all proteins identified in the MM500 proteome as the background, with the Bonferroni Step-Down (Holm) p-value adjustment method) identified meiotic GO and KEGG modules enriched in both the whole giant component of the network and, in particular, its most interconnected MCL cluster, including meiosis I, reciprocal meiotic recombination, female meiotic nuclear division, meiotic nuclear division, meiotic chromosome segregation, meiotic cell cycle checkpoint signalling, and blastocyst growth ( Figure S2A).
The Breast Carcinoma Proteome
Overall, in the PXD008841 [103] proteome matrix of 45 BRCA (pre-filtered for insufficiently expressed proteins), 316 proteoforms of reproduction-related genes (316 unique gene IDs) were found to be expressed. A total of 196 (62%) of them were found to make up the giant component of a highly interconnected coexpression network ( Figure 8A Ranking the nodes in the network by degree ( Figure 7A) reveals a highly interconnected "core" sub-network in its middle. Markov Cluster Algorithm (MCL) clustering at a granularity parameter of 2.5 extracted that interconnected component of 134 nodes and 1432 edges, with an average clustering coefficient of 0.58 and average shortest path length of 2.26 ( Figure 7B). In addition, GO biological process (BP) and KEGG enrichment analysis (right-sided hypergeometric test using all proteins identified in the MM500 proteome as the background, with the Bonferroni Step-Down (Holm) p-value adjustment method) identified meiotic GO and KEGG modules enriched in both the whole giant component of the network and, in particular, its most interconnected MCL cluster, including meiosis I, recip- GO BP and KEGG enrichment analysis) identified meiotic GO and KEGG modules enriched in both the whole giant component of the network and, in particular, its mostinterconnected MCL cluster ( Figure S2B) including meiosis I, meiotic nuclear division, meiotic chromosome segregation and inner cell mass proliferation ( Figure S2B). In this analysis, the right-sided hypergeometric test, using all proteins identified in the BRCA proteome as the background with the Bonferroni Step-Down (Holm) p-value adjustment method, was applied.
Discussion
In this study, we have addressed a working hypothesis that the genes involved in gametogenesis also cooperate in cancer development as part of a polyploidy-associated, coordinated, and pre-programmed process. To test the hypothesis and attempt to "capture" evidence of this cooperation and ploidy association, we have performed a bioinformatics study, including network analysis, on twenty-nine transcriptomic and two proteomic datasets of malignant tumour patient samples.
In this context, it is important to mention the limitations of the methods employed to acquire the results. This study focuses on bulk-sequenced samples, which complicates the capability to fully assess the complexity of the heterogeneous tumour. As such, the limitations of bulk transcriptome sequencing restrict the analysis of the biology of PGCCs, which are hypothesized to be the reproductive component of cancer, but may represent a very small part of the population, increasing in numbers when the tumour undergoes oncogenic and oxidative stress displayed as reversible cellular senescence [77]. The analysis to identify differentially expressed genes in bulk RNA-seq samples also only assesses the difference between WGD+ and WGD− samples, while taking into consideration sample purity (the proportion of cancerous cells), but not the cancer cell population heterogeneity. We partially bypassed the above-mentioned limitations with the phylostratigraphic analysis of GG genes in WGD+ tumours.
With these restrictions and rigorous statistical selection criteria for each part of our bioinformatics analysis, we obtained "an upturned pyramid": from 17 of 29 tumour types with >10 ploidy-upregulated GG genes, 9 have ploidy-upregulated gene STRING networks enriched with meiotic GO and KEGG modules, and 6 of these 9 tumour types that met the criteria for coexpression network analysis also showed coexpression networks enriched for meiotic modules in general and female meiotic modules in particular, while 3 of the latter (BRCA, LUAD, LIHC) also displayed the KEGG module of cellular senescence (which likely increased the proportion of PGCCs in them).
Altogether, despite the aforementioned limitations, the results obtained in this study show that, in a considerable number of tumour types, gametogenesis-related genes are not only robustly expressed (by the hundreds), but also coexpressed on both the transcriptome and proteome levels and associated with whole genome duplications. As previously mentioned, PGCCs (induced in various tumour cell lines after severe anti-cancer treatments and also found in smaller quantities in the control samples), were shown to be positive for meiotic proteins (MOS, REC8, DMC1, SPO11, POU5F1, DDX4, IFITM3), as revealed in individual cells by immunofluorescence [13,27,81,104,105] and time-series qPCR analysis after genotoxic treatments, along with senescence markers [7][8][9][10][11][12][13]; [13,27,81,104,105]. It is therefore logical to consider that these findings complement the evidence of a link between polyploidy and GG genes from the above-mentioned polyploid cancer single-cell immunofluorescence studies and reinforce the hypothesis. Interestingly, we have also observed that the networks of ploidy-upregulated genes in the datasets are also enriched for functional modules related to female meiosis (apparently regardless of patient sex), which thus favour cancer cell survival.
So, the evidence we currently possess-that of a robust GG gene (germ-meiosis-CT) network expressed in malignant tumours on both the transcriptome and proteome levels and showing links to polyploidy, oocyte development, and preimplantation embryogenesis-is indicative of a non-random pre-programmed process related to the reproduction.
But what kind of reproductive process could it be? Quite clearly, the process is (1) asexual and (2) hardly employs canonical gametic meiosis, which in its full form has never been observed in cancers [30,59,85]. It appears from current data that this cancer-, meiosisand embryonality-related story is linked to polyploidy through its atavistic, evolutionary roots. In particular, the marked dominance of the phylostratum 2 for upregulated GG genes in WGD+ tumours points towards the association of cancer polyploidy with the origins of the eukaryotic life-cycle. As we have seen from the examined phylostratigraphic distribution of 1474 gametogenic genes, the origin of meiosis associated with DNA damage and recombination repair (the hypothesis of meiosis origin proposed by [106] appearing together with the origin of sex (gamete generation) in the very early eukaryote cells was confirmed here. In concord, another study on ancestral character state reconstruction for representatives of 106 eukaryotic taxa indicates that LECA (the last eukaryote common ancestor which likely gave rise to the first eukaryote cell (phylostratum 2) from a symbiosis of archaea and bacteria), in addition to possessing mitochondria, was sexual, meiotic, and multinucleate [107], and thus, polyploid. However, in the case of cancer, the reproduction process is an asexual one; it is thus worth mentioning some features of this kind of atavistic reproduction.
From the point of view of evolutionary genetics, the prevention of the so-called Muller's ratchet [108]-the deleterious loss of heterozygosity (LOH) in asexual reproduction-can replace sexual reproduction (outweighing the "cost of sex") only if it is associated with at least triploidy or tetraploidy [109], or if polyploidy is associated with inverted meiosis and/or cell fusion [110]. Archetti came to the conclusion that "polyploidy has a selective advantage against LOH shown for the evolution of different types of asexual reproduction in nature. This provides an adaptive explanation for cyclical ploidy, mitotic slippage, and cell fusion in cancer cells" [111]. As indicated by the author, DNA recombination in polyploids, occurring also between sister chromatids, can counteract LOH or act along with gene conversion. The latter mechanism was found in polyploid Archaea [112]. It follows that the mechanisms of genome protection by polyploidy were already in action in very early Eukaryota and, according to Kondrashov [26], gave origin to meiosis, which was immediately followed by sex. This mechanism possibly determines the earliest GG-related cancer attractor in the 2nd phylostratum, seen by us in all meiotic module-enriched TCGA WGD+ tumour types.
Indeed, asexual Amebozoa display cyclical polyploidy along with expression of the basic meiotic toolkit of 12-15 genes [63,113]. These genes have been observed in human tumours as well [14,81,114,115], while ameboid multi-nucleated cell patterns and even macrocysts were encountered in cancers treated with genotoxic agents [29,62,81,116]. The dominant basic 2nd phylostratum peak of meiotic recombination and DNA repair was in fact WGD-upregulated in 15 of the 17 eligible tumour types. It is indispensable for any sexual or asexual reproductive process, as it processes the function of meiosis I, which may also be non-conventional, e.g., inverted [81,110] or preceded by biparental genome segregation [23,117]. The budding or bursting of offspring from PGCCs followed in some models after one or several multi-nuclear-bridged reconstruction cycles, preceding the cellularisation of subnuclei by postponed radial cytotomy. This kind of nuclear reconstruction (including pedogamic exchange of the division products in tripolar a-cytotomic karyotomy) of the giant cell shows further the extended central spindles associated with Aurora B kinase converging to a monopolar composed centrosome [118,119]. This process was particularly typical for irradiated HeLa and lymphoblastoma, but also described in senescent mouse fibroblast cultures [119]. It can explain the presence of the mitotic spindle midzone assembly GO BP found enriched in the STRING network of WGD+ BRCA ( Figure 5). Further, these cells underwent cellularisation of subnuclei and disintegration by bursting or budding. Such cell division with postponed cellularisation within multinuclear cells created by a-cytokinetic karyotomy is known in evolutionary biology terms as coenocytosis, which is often associated with reproduction [120]. It is very likely that similar reproductive adaptations could originate at the early transitions from uni-to multicellularity [121].
Besides the basic cancer attractor in the 2nd phylostratum, we observed in the TCGA tumour dataset of ploidy-upregulated GG genes the engagement of the phylostrata of early multicellular organisms (strata 4 and 5), where the oocyte meiosis and preimplantation embryo were already evolutionarily stabilized.
The origin of cancer driver genes is also focused on the first five phylostrata, embracing the origin of unicellular and embryonic reproduction life-cycles and supporting the atavistic ancestry of cancer [60,67,69,70,122].
Our GG phylostratigraphic study also revealed a large group of CT-genes in strata 12-14, for placental animals and Old World monkeys; some were evolutionary amplified in the hominid genome. These CT-GGs were also ploidy-upregulated in TCGA tumours. In particular, they include the MAGEA, B group, multiple SPANX members, and PRAME, which binds CT-GG cluster to the giant meiotic cluster of the human WGD+ cancer network. In fact, this is also a cancer attractor conferring stemness, germline induction, loss of differentiation, immunity modulation, metastases, and poor clinical prognosis [56,58]. It may further reinforce the embryonic attractor by insulin-like-growth factor-related, progesterone-independent pathway [30,34]. One of the CT protein families, SPANX, warrants special attention in association with the budding of survival descendents from PGCCs, claimed by many authors to be amitotic [123,124]. In this context, it is necessary to refer our electron microscopic study applied after 10Gy irradiation or mitotic spindle inhibitor SK&F in Burkitt's lymphoma cell lines. Within induced multiple PGCCs, the intra-cytoplasmic sequestration of nuclear buds and micronuclei was revealed to be started by annulate lamellae (AL), the derivates of the nuclear envelope, branching from the nuclear membrane of the main nucleus, along with the emergence of the folds of the nuclear envelope limited chromatin sheets (ELCS). The process was occurring at the brink of mitotic death with survival of <1% PGCCs resistant cells producing offspring [125]. A somewhat similar transformation of the nuclear membrane with blistering of ELCS and AL is occurring in spermiogenesis, reducing the nuclear volume by blebbing the redundant nuclear envelope into the mammalian sperm cytoplasmic droplet [126]. This process is regulated by SPANX, which is a component of lamin A [127]. The Xq27-located CT-protein SPAN-X family is overexpressed in melanoma, testicular, breast, prostate, lung, and other cancers [126]. Transfection of SPANXA into mammalian cells causes nuclear budding and micronucleation, which are also characteristic of senescing giant cancer cells [127]. Interestingly, the SPANX family originated in rodents from SPANX-N, which is located in the acrosome for sperm motility, and split (via locus amplification) into the SPANX-A/D group specific for hominids (phylostratum 14) with a new function-that of nuclear membrane reduction in spermatids [128]. Some other X-chromosome-linked CT genes (mostly MAGEA group) also appeared late in evolution together with placentation and were amplified in hominids. This may be associated with the human trophoblast developing polyploid giant cells with high invasiveness, which could be evolutionarily necessitated by the large size of the primate foetus and the prolonged pregnancy period [129]. It is also interesting to note that the evolution of placental invasion and cancer metastasis appears to be causally linked [129,130], sharing as reported IGF/MAPK, BCL2, Wnt-signalling [131,132] and, most importantly, immune evasion.
TCGA Polyploid versus Diploid Tumour Transcriptome Comparison
We followed a strategy of analysis tailored upon Quinton et al. [86], who bioinformatically detected and experimentally validated differences between transcriptomes of diploid (WGD−) and polyploid (WGD+) TCGA tumours. The approximate ploidy of analysed samples determined by the ABSOLUTE algorithm (which uses whole-genome copy number information to reconstruct the trajectory of tumour genome evolution and estimate the presence of WGD) [133] was obtained from the supplementary data of Taylor et al. [134]. DE genes obtained from the supplementary materials of [86] were filtered by the adoption of the inferential/effect-size threshold: (pAdj < 0.05, |logFC| > 0.5).
In order to assess the possible presence of germ-soma transition and/or pseudomeiotic features related to polyploidy in the TCGA datasets, a combined gametogenesisrelated (GG) gene set comprised of cancer-testis genes from the CTDatabase [135], cancergerm cell (primordial and adult male) genes from [14] and the MeiosisOnline [136] human meiosis-involved gene database that was updated with a manually-curated set of additional genes (SYCP1, SYCP2, SYCP3, SYCE1, SYCE2, HORMAD2, MAEL, MEIKIN, MEIOB, MEIOC, SYC E1L, TEX11, MAJIN, FAM9C, FAM9B, FAM9A, REC114, TEX19, BRME1, TEX14, MSH4, TEX15), numbering a total of 1474 genes, was used to filter the ploidy-upregulated and downregulated differentially expressed (DE) gene lists. To test for enrichment or depletion of GG genes among DE genes, binomial tests were performed with the R stats package. Information on gene phylostratigraphy was obtained from [60] and phylostratigraphic distributions of GG genes were visualised with ggplot2.
The potential relationship between ploidy and reproductive features was further investigated by constructing networks (a STRING [137] PPI network and a coexpression network). The STRING web interface was used for constructing the STRING networks from the filtered lists of DE genes. The coexpression network analysis was used on cancer types that were shown to have meiotic modules enriched in their STRING networks at least at medium confidence, in order to assess whether these genes are indeed cooperating in this particular dataset.
For the construction of coexpression networks, Rsubread-processed TPM-normalised TCGA data for 9264 tumour samples and 741 normal samples across 24 cancer types [138] were obtained from the Gene Expression Omnibus repository (GSE62944). Using the ABSOLUTE-calculated values, the data for each cancer type were split by the presence or absence of whole-genome duplications (into WGD+ and WGD-, or diploid and polyploid sample cohorts). To minimise the impact of tumour heterogeneity, a purity cutoff of 0.5 was implemented. Of the nine cancer types shown to have meiosis-related modules enriched in STRING, six of them met the conditions for at least 100 ploidy-upregulated genes, and at least 50 WGD+ samples post-purity cutoff (BRCA, LUAD, STAD, UCEC, LIHC, BLCA) were selected for coexpression network construction. The gene expression matrices were filtered for lowly expressed genes with a cutoff of at least 2 TPM in at least 20% of the samples.
The coexpression network (unsigned, with both positive and negative correlation coefficients counting as an edge) was obtained by computing pairwise Pearson correlations between DE genes.
A hard threshold of pairwise correlation coefficients was determined by comparing the number of links (pairwise correlations equal to or exceeding the threshold in absolute value) between 50 randomly picked sets of 300 genes and surrogate data-shuffling of these datasets across columns (50 shuffling for each set). This approach serves to determine a "mean correlation field" linking the genes (or, in the case of the proteomic data described in the next sections, the proteins), and the amount of noise/randomness present in the data [139]. In this case, a list of four possible thresholds, ranging from 0.6 to 0.9, were tested in this manner, and a threshold of 0.6 was found to be sufficient to define an edge in the network, with the number of interactions in "real" data vastly and highly significantly (Wilcoxon test p < 0.001) exceeding that of surrogate data (as seen in Table S2), indicating that the normalisation procedure in the initial data was successful at reducing the noise.
The selected threshold was used to transform the correlation matrix into a binary adjacency matrix, which was imported into Cytoscape via the RCy3 R package [140] and the aMatReader app [141]. The giant components of the upregulated and downregulated gene networks were then extracted for further enrichment analysis to determine.
Gene-set enrichment (Gene Ontology (GO) and Kyoto Encyclopaedia of Genes and Genomes (KEGG)) was adopted (using clusterProfileR in R and ClueGO in Cytoscape for visualisation of enrichment maps) as a proxy of genes' biological functions, and the gene sets were checked for their statistical relevance by tests based upon hypergeometric distribution enrichment analysis with Bonferroni Step-Down (Holm) correction, which is more stringent in terms of false positives than the Benjamini-Hochberg correction implemented in the STRING web tool, for the p-value. For ease of interpretation, the large number of enriched processes was reduced, clustered, and visualised as treemap plots using the rvvgo R package [142] and/or ClueGO enrichment maps. Igraph [143] and graph [144] R packages were used to supplement Cytoscape's network visualisation functionalities for interpretability and aesthetic reasons.
The NDEX database [145] was used for depositing the networks.
Analysis of GG Protein Expression in the MM and BRCA Proteomes
This analysis was performed to assess the relationships between GG gene expressions on the protein (whole-proteome) level. For that purpose, two high-throughput proteomics datasets of two cancer types (MM and BRCA) from public databases were used.
A matrix of normalised relative protein abundances determined by high-throughput LC-MS/MS from 505 late-stage melanoma patient tumour samples and over 12,000 proteincoding genes was obtained from the supplementary materials of the MM500 Melanoma Proteome Atlas study [101]. Hierarchical clustering (hclust in the R stats package) was performed to stratify the samples by abundance and value missingness. Cutting the tree at a height of 1400 (an ultrametrics based on Euclidean Distance) stratified the patient samples into six clusters (Figure 4). Patient Cluster 3 (n = 142) was selected for further analysis due to technical considerations.
The lowly expressed proteoforms were filtered out of the resulting 142-sample matrix, with a cut-off of at least five units of normalised relative expression in at least 20% of the samples. For the rest, the missing values were replaced using minimum imputation (the log2-scale value of the minimum possible measurement) with the assumption of low protein expression as the reason for their missingness.
A matrix of normalised relative protein abundances for 45 BRCA samples (mainly grades 2-3) was obtained from the ProteomeXChange PXD008841 repository [103]. Unlike the MM dataset, the BRCA dataset had already been filtered to only include proteins expressed in every sample, for a total of 9995 proteins. As such, no further low-expression filtering was necessary.
In order to assess the possible presence of soma-germ transition and/or pseudomeiotic features related to embryonalization in late-stage melanoma and grade 2-3 breast carcinoma, the GG gene set (n = 1474) was used to filter out the proteins related to the aforementioned processes.
To investigate the relationship between the expressed proteins, the resulting GG protein abundance matrix was used to calculate pairwise correlations and construct a coexpression network with the same procedure as described in Section 4.1. In the proteome data, the threshold of 0.6 in absolute value was found to be sufficient, as can be seen in Tables S3 and S4. To determine the most interconnected network components or modules, the coexpression network was subjected to MCL clustering with a granularity parameter of 2.5, implemented in Cytoscape's clusterMaker app [146]. GO Biological Process enrichment analysis was performed as described in Section 4.1, but unlike the case of the TCGA transcriptomes, in which all genes in the database were used, for proteomics data, the whole proteome of the cancer dataset in question (respectively, MM and BRCA) was used as the background gene set ("universe"). The enrichment analysis was done separately on the whole giant component of the protein-protein coexpression network, and its most highly interconnected part (MCL cluster 1).
The NDEX database [145] was used for depositing the networks.
Conclusions and Perspectives
We can conclude that human tumours can likely employ three or more cancer-polyploidy associated reproduction attractors of soma-germ transition, pre-formed and developed during life evolution on Earth. While the first, early eukaryotic and basic, is directly associated with DNA damage repair by recombination with the functions of the meiotic prophase, which seems indispensable for starting any reproductive life-cycle (and may be displayed in cancers by the amoeboid reproduction mode with an asexual macrocyst), the second, associated with oocyte maturation and early embryogenesis, is linked to the transition from unicellular to multicellular forms of life [60] (and can induce in cancers the parthenogenesislike reproduction process). The current results provide a hint to the existence of a link between the WGD-related oocyte maturation and cellular senescence, as was suggested earlier [77]. The latest, placental attractor links the embryonic sub-network to germline determination in placental mammals through ectopic activation of PRAME/CT-genes (which presumably may favour "pseudo-placentation"-invasion and metastases). In addition, the coupling of the polyploidising mitotic slippage (that results in the acquisition of meiotic features) with the interruption of the circadian clock in WGD-positive TCGA cancers, shown by us recently [43], likely enables this scanning of the genome evolutionary memory through all aeons, revealing the permissive paths to cancer attractors of asexual reproduction and connecting the most adaptive among them into the very dense network disclosed in this study. Our data and their analysis confirm the view of the extreme adaptability of human cancers to the general pattern states of the genome network, neighbouring and distant tissues, and the microenvironment [147], by means of polyploidy-aided atavistic variable mechanisms of asexual reproduction. Tightly clustered and correlated gametogenesis-and WGD-related cancer networks found here in the common aggressive cancers present an argument in favour of epigenetic cancer evolution "as a model of cell learning", providing its causal potential for anti-cancer therapies [148]. At the same time, carcinogenesis and tumour evolution remain very complex, and the present study is only a step to their better understanding. Data Availability Statement: The coexpression networks resulting from this study have been deposited in the NDEX database, with the transcriptome and proteome network sets available, respectively, under the following URLs: https://www.ndexbio.org/#/networkset/c4934da2-3cf7-11ed-b7 d0-0ac135e8bacf?accesskey=5d269780b0440e6cf61633b03121b398598d19307be4c23760642ae33acbf749 (accessed on 5 October 2022). https://www.ndexbio.org/#/networkset/5e0ba954-3cf5-11ed-b7d0-0 ac135e8bacf?accesskey=e29f7a1571fba879aa0b38158550baae147b7ea39a384f08f7c52a11a6165428 (accessed on 5 October 2022).
|
v2
|
2022-12-05T17:04:10.475Z
|
2022-11-29T00:00:00.000Z
|
254242585
|
s2ag/train
|
Convolutional Neural Networks Improve Radiologists’ Performance in Breast Cancer Screening for Vietnamese patients
ABSTRACT Nowadays, breast cancer is one of the leading cancers in Vietnam, and it causes approximately 6000 deaths every year. The rate of breast cancer patients was calculated as 26.4/100000 persons in 2018. There are 21,555 new cases reported in 2020. However, these figures can be reduced with early detection and diagnosis of breast cancer disease in women through mammographic imaging. In many hospitals in Vietnam, there is a lack of experienced breast cancer radiologists. Therefore, it is helpful to develop an intelligent system to improve radiologists’ performance in breast cancer screening for Vietnamese patients. Our research aims to develop a convolutional neural network-based system for classifying breast cancer X-Ray images into three classes of BI-RADS categories as BI-RADS 1 (“normal”), BI-RADS 23 (“benign”) and BI-RADS 045 (“incomplete and malignance”). This classification system is developed based on the convolutional neural network with ResNet 50. The system is trained and tested on a breast cancer image dataset of Vietnamese patients containing 7912 images provided by Hanoi Medical University Hospital radiologists. The system accuracy uses the testing set achieved a macAUC (a macro average of the three AUCs) of 0.754. To validate our model, we performed a reader study with the breast cancer radiologists of the Hanoi Medical University Hospital, reading about 500 random images of the test set. We confirmed the efficacy of our model, which achieved performance comparable to a committee of two radiologists when presented with the same data. Additionally, the system takes only 6 seconds to interpret a breast cancer X-Ray image instead of 450 seconds interpreted by a Vietnamese radiologist. Therefore, our system can be considered as a “second radiologist,” which can improve radiologists’ performance in breast cancer screening for Vietnamese patients.
|
v2
|
2022-12-06T17:15:39.849Z
|
2022-11-29T00:00:00.000Z
|
254271505
|
s2orc/train
|
Monoclonal gammopathy of undetermined significance: evaluation, risk assessment, management, and beyond
Monoclonal gammopathy of undetermined significance (MGUS) is a premalignant state for a spectrum of lymphoplasmacytic malignancies. The risk of progression of MGUS to a symptomatic therapy requiring plasma cell dyscrasia is about 1% per year. Studies carried out over the previous 10 years have improved risk stratification of MGUS based on serologic and genomic evaluations, which has led to better management of patients. In this review, we address the epidemiology, diagnosis, and pathogenesis of MGUS and discuss risk-adapted best practice approaches to monitor patients.
Introduction
Monoclonal gammopathy (MG) encompasses several conditions defined by the increased proliferation of a clone of plasma cells that produce an abundance of a monoclonal immunoglobulin: monoclonal (M) protein. Within this category fall both benign hematologic conditions such as monoclonal gammopathy of undetermined significance (MGUS) and lymphoplasmacytic malignancies (LPMs), including multiple myeloma (MM), Waldenström macroglobulinemia (WM), and amyloid light-chain amyloidosis (AL) 1 . Though fundamentally similar, each MG has its unique symptoms, diagnostic criteria, treatments, and disease trajectories. The focus of this review is to showcase the recent advances in the diagnosis, risk stratification, and management of MGUS.
MGUS was first described in 1960 by Jan Waldenström as "essential hyperglobulinemia" or "benign monoclonal gammopathy." He firmly believed that benign MG was unrelated to MM 2 . However, in 1978, Robert Kyle coined the current term "monoclonal gammopathy of undetermined significance" after his observational retrospective study of 241 patients showed that some patients with MGUS progressed to MM, WM, or AL 3 . Since that time, population studies from Olmsted County (Minnesota) and Ghana, as well as the National Health and Nutrition Examination Survey (NHANES) in the United States and the Prostate, Lung, Colorectal, And Ovarian (PLCO) cancer screening trial, have significantly advanced our knowledge of MGUS and the disorders it precedes 4-8 .
Definition
MGUS is a clinically asymptomatic, premalignant, clonal plasma cell disorder and is an obligatory precursor for several LPMs, including MM, WM, and AL 9 . It is defined by the presence of serum or urine M protein, <10% clonal plasma cells in the bone marrow, and the absence of a diagnosis of MM or related LPMs 1 . Three distinct subtypes of MGUS are classified based on the M protein isotype: immunoglobulin M (IgM) MGUS, non-IgM (IgG, IgA, or IgD) MGUS, and light-chain MGUS (LC-MGUS). The risk of progression into an LPM is different for each of these subtypes of MGUS 9,10 .
Epidemiology
The prevalence of MGUS increases with age and is observed in nearly 3% of the population ≥50 years old and 5% of those ≥70 years 4,11 . For patients aged <40 years, MGUS is a relatively rare event with a prevalence of <0.3%, and this patient population represents only 2% of all patients with MGUS 12 . The incidence and prevalence of MGUS are also higher in men than women and are two-to three-fold higher in Blacks than Whites. The incidence of MGUS in men is 120 per 100,000 at age 50 and increases to 530 per 100,000 by the age of 90 13 . The corresponding rates for women are 60 per 100,000 population at age 50 and 370 per 100,000 at age 90 13 . The prevalences of MGUS among a well-defined, predominantly White population in persons ≥50, ≥70, and ≥85 years of age are estimated to be 3.2%, 5.3%, and 7.5%, respectively 4 . The age-adjusted prevalences of MGUS using population-based racial surveys are 3.7%, 2.3%, 1.8%, and 2.1% in Blacks, Whites, Hispanics, and Japanese, respectively 5,7,14,15 . Table 1 outlines the prevalence of MGUS in different countries based on population studies. Furthermore, there is a higher risk of an earlier age of onset in Blacks than Whites 6 . In a recent population-based analysis, the prevalence of MGUS detected using matrix-assisted laser desorption ionization time-of-flight mass spectrometry (MALDI-TOF MS) was 17% in Blacks who are >50 years old 16 . In that study, high-risk individuals were categorized as Black patients and those with first-degree relatives with a diagnosed hematologic malignancy, and the prevalences of MGUS were 4.9% and 13% in patients between the ages of 40 and 49 and between 70 and 79, respectively 16 .
Pathogenesis and genomic landscape
Plasma cells are terminally differentiated B lymphocytes derived from post-germinal center B cells 17 . Owing to defined genomic aberrations, monoclonal plasma cell populations emerge from a polyclonal background, and with fluorescence in situ hybridization (FISH), chromosomal abnormalities have been identified in the development of MGUS 18-20 . About 50% of patients with MGUS demonstrate aneuploidy, particularly hyperploidy. This is compared with chromosome aneuploidy seen in about 75% of patients with MM or LPM 21 . Translocations involving the immunoglobulin heavy chain (IGH) locus on chromosome 14q32 and one of five partner chromosomes -11q13 (cyclin D1 gene, the most common), 4p16.3 (FGFR-3 and MMSET), 6p21 (cyclin D3 gene), 16q23 (c-maf), and 20q11 (mafB) -have been identified in close to half of the patients with MGUS (Table 2) 10,22 . In addition to IGH translocations, known myeloma-specific chromosome abnormalities have been detected in MGUS, such as RB1 (13q14) deletion, 1q-gain, and hyperdiploidy; however, the frequency of these abnormalities is lower in MGUS than in MM 23,24 . Consistent with the primary lesion hypothesis, one study found IGH translocations comprising (4;14), t(11;14), t(14;16), and t(14;20) to be around 27%, which is similar to that seen in MM. In another study, t(11;14), t(4;14), t(14;16), t(14;20), and t(6;14) were seen between 0.5% and 16% of patients with MGUS 18 . Moreover, comparable to myeloma, mutations in genes such as RAS, NRAS, DIS3, HIST1H1E, EGR1, and LTB were also found in MGUS 25,26 . Importantly, mutations or deletions of TP53 and MYC translocations were not detected in patients with MGUS as one may see in MM or LPM, suggesting that these events could happen later in the disease course and may lead to MGUS progression to more advanced stages 25 . The genetic alterations in IgM MGUS, unlike those in non-IgM MGUS, seem to be different, where MYD88 L265P and CXCR4 were the main mutations seen in 60% and 9%, respectively 27 . These cytogenetic changes could be the primary events in initiating the process of plasma cell immortalization. Therefore, the fate of MGUS, as in its persistence as an indolent malignancy or its progression to aggressive cancer, is dictated by the different cytogenetic changes acquired by the plasma cell clone over time 10,28,29 . The genomic landscape of myeloma precursor conditions such as MGUS and smoldering myeloma has expanded with the use of whole genome sequencing. A study by Oben et al. identified myeloma-defining genomic events, which include chromothripsis, templated insertions, mutations in driver genes, aneuploidy, and canonical apolipoprotein B mRNA-editing catalytic polypeptide (APOBEC) mutational activity to be associated with MGUS progression 36 . In that study, it was found that patients with MGUS without progression had a lower burden of myeloma-defining genomic events when compared with patients who had a high number of myeloma-defining genomic events in whom MGUS progression was imminent 36,37 .
Myeloma-defining genomic events include structural variants, alterations in driver genes, clonal IGH translocations, genomic copy number changes, hyperdiploidy, and MYC translocation [36][37][38] . The recent advances in molecular and genomic techniques, including whole exome sequencing (WES), single-nucleotide polymorphism array, and global gene expression profiling, have uncovered these myeloma-defining genomic events and have enhanced our understanding of the disease biology of MGUS, smoldering myeloma, and MM. Of these genomic aberrations, hyperdiploidy and canonical IGH translocations are seen more commonly in MGUS, but other genomic alterations are rare. Another study looked at the tumor mutational burden (TMB), single-base substitution (SBS), and activation-induced cytidine deaminase (AID)-induced somatic mutagenesis in MGUS and MM. In that study, the TMB and SBS were high in MM compared with MGUS, and the presence of the APOBEC signature was a predictor of poor overall survival in patients with MM. Additionally, patients with MM who had poor outcomes had high TMB compared with patients with better outcomes 39 . Detecting these genomic aberrations early in the clonal evolution of plasma cells has enabled us to better understand the progression of MGUS to MM 36,40 . The advent of genomic techniques may pave the path to better risk-stratify patients based on genomic alterations and predict disease progression before the appearance of clinical and laboratory indicators. However, these sophisticated genomic analysis techniques are not universally available, and most of the findings based on genomic alterations have yet to be prospectively validated. Hence, the practice patterns should still be based on clinical and laboratory parameters along with chromosomal alterations, which have already been established and incorporated in MM risk stratification models [36][37][38][39][40][41] .
Diagnostic criteria and risk stratification
Based on the current diagnostic criteria from the 2014 International Myeloma Working Group (IMWG), MGUS is diagnosed when all three of the criteria are met: serum M protein less than 3 g/dL or the presence of abnormal free light chain (FLC) ratio, bone marrow plasma cells less than 10%, and the absence of end-organ damage attributed to plasma cells 1 . IgM MGUS is defined by serum IgM M protein, and non-IgM MGUS is characterized by serum IgG, IgA, and (rarely) IgD or IgE M proteins 1 . LC-MGUS is defined by the presence of an abnormal FLC ratio (<0.26 or >1.65; involved-to-uninvolved FLC ratio of less than 100 with a lack of IGH expression on immunofixation), increased level of involved FLC more than the upper limit of normal (ULN), urinary monoclonal protein of less than 500 mg/24 hours, and the presence of the aforementioned three criteria 1,42 .
The absence of end-organ damage translates to the lack of hypercalcemia, renal insufficiency, anemia, and bone lesions (referred to as CRAB features) attributable to an underlying plasma cell disorder. Hypercalcemia is defined by serum calcium greater than 1 mg/dL (>0.25 mmol/L) of ULN or higher than 11 mg/dL (>2.75 mmol/L). Renal insufficiency is defined as a creatinine clearance of less than 40 mL/min or a serum creatinine greater than 2 mg/dL. Anemia is defined by a hemoglobin value greater than 2 g/dL below the lower limit of normal or a value less than 10 g/dL. Bone lesions are osteolytic lesions that can be detected on skeletal radiography, computed tomography (CT), or positron emission tomography-CT 1 . Following the diagnosis of MGUS, risk stratification of patients should be done based on the presence or absence of risk factors that increase the rate of progression of MGUS to LPM.
Risk and assessment of progression
The rate of progression of MGUS to LPM is 0.5-1% per year, but the exact risk depends on the concentration and type of the M protein, serum FLC ratio, bone marrow plasmacytosis, proportion of phenotypically clonal plasma cells, and presence of immunoparesis 1 . The three major risk factors for the progression of MGUS are an abnormal serum FLC ratio (i.e., the ratio of free immunoglobulin κ to λ light chains in the serum), non-IgG MGUS, and a high serum M protein level (≥1.5 g/dL) (Figure 1) IgM MGUS has a higher risk of progression than non-IgM and is typically associated with progression to lymphoplasmacytic lymphoma/WM 1,11 . The risk of progression among patients with IgM MGUS is 2% per year in the first 10 years after diagnosis and 1% per year thereafter 11 . In contrast, non-IgM MGUS is associated with a risk of progression to MM at a rate of 0.5-1% per year 1,11 . Though rare, both IgM MGUS and non-IgM MGUS can progress to AL, and the risk is about 1% over 35 years of follow-up 11 . LC-MGUS can progress to light-chain MM and AL with a risk of 0.3% per year 1 .
In addition to the aforementioned risk factors, a study by Kyle et al. found that the risk of progression was higher when there are >5% clonal plasma cells in the bone marrow and low concentrations of two uninvolved immunoglobulins 11 . However, this heightened risk was not observed with a lower concentration of only one uninvolved immunoglobulin level 11 . The age, sex, presence of hepatosplenomegaly, hemoglobin values, serum creatinine, serum albumin, and quantitative measurements of a monoclonal urinary light chain were not predictors of MGUS progression 11 .
Conversely, the Spanish study group recognized multiparametric flow cytometry as a valuable tool to identify aberrant plasma cell populations and predict the risk of MGUS progression to MM 45 . The antigens that are most frequently used to identify aberrant plasma cells include CD19, CD45, and CD56 in combination with CD38/CD138 46,47 . The validated immunophenotypic approach to identify aberrant phenotypes in plasma cells is the absence of CD19 or CD45, the decreased expression of CD38, and the overexpression of CD56 48,49 . According to the Spanish study group, the two risk factors for the progression of MGUS are the percentage of aberrant plasma cells to bone marrow plasma cells of above 95% and DNA aneuploidy. When these independent variables are used, the rates of progression-free survival at 5 years for MGUS patients with zero, one, and two risk factors are 2%, 10%, and 46%, respectively 45 .
Another study classified patients with MGUS into three risk categories based on the cytogenetic risk factors: high risk (t(4;14) and chromosome 17p deletion), intermediate risk (trisomies without translocations), and standard risk (t (11;14), all translocations other than t(4;14) and chromosome 13 abnormalities). In that study, the median time-to-progression of MGUS was 4.7 years for patients with high-risk cytogenetics and was not reached for other risk groups in a 4.2-year follow-up 18 .
Earlier onset of MGUS does not imply a more aggressive or indolent disease. Pang et al. showed that young patients with MGUS had an average progression rate of 1.4% per year, similar to older patients 12 . Furthermore, autoimmune diseases have been associated with an increased risk of MGUS development with a relative risk of 1.42, and the strongest association was seen with pernicious anemia with a relative risk of 1.67 50 . It has been hypothesized that the constant stimulation of the immune system in immune-related conditions can cause B-cell dysfunction and clonal plasma cell disorders 51 . Interestingly, although the prevalence of MGUS is increased with autoimmune conditions, patients with immune-related disorders may have a relatively lower risk of progression. In one study, the M protein level was found to be higher in patients without autoimmune conditions as compared with patients with autoimmune conditions 12 . However, in that study, the size of the M protein was the strongest risk factor, and the presence of an autoimmune condition by itself was not an independent risk factor for MGUS progression 12 .
In addition to these risk factors, one should pay close attention to clinical and laboratory "red flags" when following patients with MGUS (Table 3). In the presence of these "red flags" in the correct clinical setting without an alternative explanation, one should promptly evaluate patients for progression to an LPM 9 .
Screening and indications for testing
Currently, owing to the lack of evidence supporting the clinical benefit of early detection, screening of asymptomatic MGUS in the general population is not recommended 11 . Therefore, MGUS is generally found incidentally while evaluating a patient with signs and symptoms suggestive of a possible LPM or any of the associated conditions. Clinicians also look for MG by testing for M protein in patients with a nonmalignant disease known to cause or be associated with MG 52,53 .
A recent study at the Mayo Clinic found that monoclonal protein testing is commonly performed for signs and symptoms not typically associated with LPM 54 . The top five indications for testing were neuropathy (19.8%), renal disease (13.7%), anemia (12.8%), bone disorders or connective tissue pain (12.8%), and cutaneous diseases (5.8%). The subsequent diagnoses of the common indications were neuropathy-no other source (NOS), chronic kidney disease-NOS, iron deficiency, and osteoporosis/osteopenia, respectively. In that study, neuropathy was associated with IgM MGUS in close to 19% of patients 54 . Initial screening of MGUS was predominantly done by general internal medicine (31.3%), neurology (10.3%), and cardiology (9.7%) 54 .
The Iceland Screens, Treats, or Prevents Multiple Myeloma (iStopMM) study is the first population-based, prospective screening study and randomized controlled trial based in Iceland to evaluate the potential harm and benefit of MGUS screening 55 . The recent results of the iStopMM study involving 75,422 total participants with a 5% prevalence of MGUS found that active screening of patients with MGUS could identify a higher number of patients with progression than patients who are followed by current established guidelines 56 . However, the study is still evolving, and results pertaining to the survival of these patients are pending. While these data are maturing, the study's authors advised against preemptive MGUS screening in otherwise-healthy individuals 56 . In the meantime, experts believe that it may be beneficial to screen for MG in high-risk patients who have two or more first-degree relatives with MM, AL, or WM 9 .
At the time of initial evaluation of a patient with suspected MGUS, complete blood count, serum M protein, serum FLC, and IGH evaluation should be performed. Based on the 2018 publication by Go et al. 9 , in the absence of concerning clinical or laboratory features along with the presence of low-risk MGUS (IgG MGUS, serum M protein <1.5 mg/dL, and normal FLC ratio, if LC-MGUS FLC ratio <8), one could omit a bone marrow biopsy and skeletal survey as only 2% of these low-risk patients progress during their lifetime 44 .
Management of patients after MGUS diagnosis
Currently, there is no role in initiating any disease-specific treatments with chemoimmunotherapy or targeted therapy for patients with MGUS. However, clinical follow-up in conjunction with focused laboratory evaluations based on the risk of progression as well as establishing patient expectations and proper education is paramount in managing patients with MGUS. The monitoring parameters for patients with MGUS should be based on the risk factors and "red flags" for the progression of MGUS. All patients should undergo repeat laboratory evaluations within 3-6 months from the time of initial MGUS diagnosis. These laboratory evaluations include complete blood count, serum protein electrophoresis, serum FLC assessment, and assessment of calcium and serum creatinine 9 . During these follow-up evaluations, laboratory studies focusing on the complete blood count, creatinine, and calcium should be commenced along with quantification of the serum M protein. Routine imaging studies and bone marrow assessment should not be done without clinical or laboratory "red flags," which could signify disease progression. Figure 2 represents a flow diagram to summarize the workflow involved in monitoring patients with MGUS.
Conclusion and future directions
MGUS is a precursor state for LPMs, including MM, AL, and WM. When patients with MGUS are evaluated, accurate constitutional signs of malignancy, including excessive fatigue, drenching night sweats, fever, unintentional weight loss, excessive bone pain or pathologic fractures, neuropathy, organomegaly and lymphadenopathy, mucocutaneous bleeding, unexplained anemia, elevated creatinine and renal impairment, unexplained hypercalcemia, progression of serum M protein ≥50% or ≥3 g/dL with an absolute increase of ≥0.5 g/dL, progression of involved serum FLC by ≥50% or the ratio of involved to uninvolved FLC ratio ≥100 when absolute FLC ratio is at least 100 mg/L, and urine protein electrophoresis showing urine M protein ≥500 mg in 24 hours. CBC, complete blood count; FLC, free light chain; IgG, immunoglobulin G; MGUS, monoclonal gammopathy of undetermined significance. assessment should be done to risk-stratify patients, as this will guide future monitoring. It is important to keep in mind that the majority of patients with MGUS will never progress to an aggressive malignancy during their lifespan, and having a diagnosis of a precancerous state could be a psychological burden for these patients. With the advent of genetic sequencing techniques such as WES, the field is rapidly evolving and new molecular and genetic signatures that will enable better and early risk stratification of MGUS are looming. With future studies, we hope to be able to better understand the pathobiology of MGUS that leads to disease progression and to be able to better risk-stratify patients and streamline the evaluation, thus improving the physical and psychological well-being of patients.
|
v2
|
2022-12-07T19:13:31.103Z
|
2022-11-29T00:00:00.000Z
|
254345709
|
s2ag/train
|
Surgical and Interventional Management of Lung Metastasis: Surgical Assessment, Resection, Ablation, Percutaneous Interventions
Abstract The lungs are the second most common site of metastases for colorectal cancer after the liver. Pulmonary metastases can be identified at the time of diagnosis of the primary tumor, or metachronously. About 20% of patients with colorectal cancer will develop pulmonary metastases. The best options for treatment include a multidisciplinary treatment approach consisting of surgical resection whenever possible, and chemotherapy. Surgical options most often include minimally invasive segmentectomy or wedge resection, while patients unable to have surgery may benefit from radio frequency ablation or radiation treatment. Prognosis is dependent on preoperative carcinoembryonic antigen level, number, and location of metastatic lesions, and resectability of primary tumor. Overall, pulmonary metastases are best treated by complete resection whenever possible.
|
v2
|
2022-12-07T19:48:41.721Z
|
2022-11-29T00:00:00.000Z
|
254365496
|
s2ag/train
|
Long Non-coding RNA INE1 Induced Autophagy Promotes Sensitivity of Prostate Cancer Cells to Cisplatin
Prostate cancer is most prevalent malignancy of males in the world. In recent years, long non-coding RNAs (lncRNAs) were identified, and their functions are associated with prostate cancer initiation and progression. However, their molecular mechanisms still need to be elucidated before the clinical utility. In the present study, we identified the correlation of lncRNA inactivation escape 1 (INE1) with the characterization in prostate cancer patients, and detected the roles of INE1 in cell autophagy and apoptosis in prostate cancer cells. Our results showed that the lncRNA INE1 expression highly correlate with patients’ survival times, tumor stage, biochemical recurrence, disease recurrence and Gleason pattern. High expression of INE1 was detected in prostate cancer cells, and knockdown INE1 by siRNA resulted in significant inhibition of cell viability. In addition, silencing INE1 induced early autophagy and pro-apoptosis, which augments cisplatin (CDDP)-induced cell apoptosis. Moreover, INE1 played an anti-apoptotic role by targeting the serine/arginine-rich splicing factor 2 (SRSF2).
|
v2
|
2022-12-07T19:51:08.723Z
|
2022-11-29T00:00:00.000Z
|
254354341
|
s2orc/train
|
DNA-Methylation Analysis as a Tool for Thymoma Classification
Simple Summary Thymomas are rare malignant epithelial tumors of the thymus. They show a spectrum of microscopic appearances (histotypes) that correlate with the risk of killing patients. The various high- and low-risk thymoma histotypes must be distinguished from each other (i.e., classified) to make correct treatment decisions. However, classification is often difficult, even for expert pathologists, since unequivocal microscopic and genetic features may not be present in each thymoma. Therefore, the current study had the aim to improve the classification of thymomas through the application of a novel method—artificial intelligence-assisted methylation profiling—that measures and compares the absence or presence of methyl groups (a chemical modification of the genetic material, i.e., DNA) across cohorts of tumors. The analysis of 113 thymomas revealed that most cases of each microscopically defined thymoma histotype shared a distinct methylation profile. However, tumor cases with overlapping profiles (‘borderliners’) and cases with quite different profiles (‘outliers’) were also detected. In conclusion, this type of methylation profiling is a valuable new tool to improve therapeutic decision-making through the refined classification of thymomas. It holds promise for identifying new thymoma variants and opening novel, personalized therapeutic perspectives. Abstract Background: Thymomas are malignant thymic epithelial tumors that are difficult to diagnose due to their rarity and complex diagnostic criteria. They represent a morphologically heterogeneous class of tumors mainly defined by “organo-typical” architectural features and cellular composition. The diagnosis of thymoma is burdened with a high level of inter-observer variability and the problem that some type-specific morphological alterations are more on the continuum than clear-cut. Methylation pattern-based classification may help to increase diagnostic precision, particularly in borderline cases. Methods and Results: We applied array-based DNA methylation analysis to a set of 113 thymomas with stringent histological annotation. Unsupervised clustering and t-SNE analysis of DNA methylation data clearly segregated thymoma samples mainly according to the current WHO classification into A, AB, B1, B2, B2/B3, B3, and micronodular thymoma with lymphoid stroma. However, methylation analyses separated the histological subgroups AB and B2 into two methylation classes: mono-/bi-phasic AB-thymomas and conventional/“B1-like” B2-thymomas. Copy number variation analysis demonstrated methylation class-specific patterns of chromosomal alterations. Interpretation: Our study demonstrates that the current WHO classification is generally well reflected at the methylation level but suggests that B2- and AB-thymomas are (epi)genetically heterogeneous. Methylation-based classifications could help to refine diagnostic criteria for thymoma classification, improve reproducibility, and may affect treatment decisions.
Introduction
Thymoma is the most common mediastinal tumor in adults but counts among the rarest human tumors, making pathological classification difficult, especially for low-volume centers [1,2]. In addition, the great morphological complexity and heterogeneity of some thymoma subtypes pose diagnostic problems and led to proposals aiming at replacing the World Health Organization (WHO) classification system and terminology [3,4] with a more simplified classification and nomenclature [5][6][7]. However, the striking results of The Cancer Genome Atlas (TCGA) effort based on thymoma cases classified by a panel of expert pathologists [8] strongly reinforced the WHO thymoma classification, which is in worldwide use [9]. The WHO classification distinguishes six common thymoma subtypes: A, including atypical A-thymoma as a variant, AB, B1, B2, B3, and micronodular thymoma with lymphoid stroma (MNT), as well as the exceedingly rare metaplastic thymoma that was neither included in the TCGA study nor the current analysis. Thymomas are classified based on variably pronounced "organo-typical" architectural features (e.g., the presence or absence of 'medullary islands' and 'perivascular spaces'), tumor cell morphology (spindly versus polygonal), and the relative abundance of non-neoplastic immature T cells compared to neoplastic epithelial cells. Given this morphological complexity, it is not surprising that inter-observer reproducibility has remained an issue in real-life settings [10][11][12] and made some authors argue in favor of a simplified histological scheme [7]. On the other hand, meticulous immunohistochemical analysis of WHO-defined thymoma subtypes in terms of functional molecules of the cortical and medullary thymic epithelial cells [13] demonstrated the value of the historic classification by Marino and Müller-Hermelink [14], separating thymomas on the basis of the presumed "cell of origin" into two main categories, cortical and medullary thymomas. Since DNA methylation patterns reflect both the cell type of origin as well as acquired changes during differentiation and tumor development [15], we presumed that DNA methylation patterns could be a new tool for 'objective' thymoma subtyping. Surprisingly, many thymoma methylation projects, including TCGA methylation profiling, failed to correlate methylation data with the established WHO histologic subtypes [8]. While TCGA methylation profiling could distinguish thymic squamous cell carcinomas from thymomas [16], it showed no association with the above-mentioned histological WHO classification of thymomas [8]. Since then, however, artificial intelligence has revolutionized the analysis of methylation profiles: the use of deep-learning algorithms has allowed methylome-based cancer diagnosis at such high sensitivity and specificity that methylation profiling has become a commonplace and often indispensable diagnostic tool in the field of brain tumor classification [17], strongly endorsed by the WHO [18]. Furthermore, methylation profiling holds great promise to support the differential diagnosis of cancers with overlapping morphological features, as recently demonstrated for sarcomas [19]. In the present work, we subjected clearly annotated thymoma subtypes to this advanced methylation profile analysis and investigated whether the current WHO-based thymoma subclassification can be retraced by DNA methylation profiling. We also aim to provide a broadly available diagnostic platform to increase diagnostic reproducibility in thymoma pathology.
Sample Selection and Quality Control
Formalin-fixed paraffin-embedded (FFPE) tissue was obtained from the Institute of Pathology, University Medical Center Mannheim, Germany. The Mannheim Institute of Pathology, with its director (Prof. Dr. Alexander Marx) and vice director (Prof. Dr. Timo Gaiser), serves as a reference laboratory for mediastinal pathology and has, therefore, outstanding experience in thymoma classification. The thymoma classification was performed in accordance with the current WHO classification [3]. The study was approved by the local ethics committee of the Medical Faculty Mannheim of the University of Heidelberg, Germany (2012-608R-MA).
Sections of the FFPE samples selected for methylation array analysis were mounted on glass slides (by default, 10 µm thick, 8 consecutive slides). On a consecutive H&E-stained section (3-4 µm), a suitable tumor area was identified by TG or AM. A tumor content of at least 80% was selected where possible, and non-neoplastic tissue, blood, or excessive areas of necrosis were excluded.
DNA Extraction and Quantification
Slides with mounted tissue were dewaxed (3 washes in xylene and 2 washes with industrial methylated spirit) and air-dried. Tissue selected for the analysis was scraped off and collected in lysis buffer, and DNA was extracted with the Maxwell 16 Lev FFPE DNA Purification Kit on a Maxwell 16 extractor. The DNA extraction procedure was carried out according to manual #TM349 for DNA extraction (Promega, Madison, WI, USA). DNA was then quantified, and A260/A280 ratios were determined on a Nanodrop 8000 spectrophotometer (ThermoFisher, Waltham, MA, USA). An A260/A280 ratio of~1.8 was considered to represent sufficient purity to proceed with the methylation study.
Methylation Array Processing and Copy Number Profiling
All thymoma samples were submitted for DNA methylation analysis. The Illumina Infinium Human Methylation EPIC (850K) BeadChip array (Illumina, San Diego, CA, USA) was employed, following the manufacturer's instructions. Copy number profile (CNP) analysis was assessed by R package "conumee" [20] after additional baseline correction (https://github.com/dstichel/conumee, last accessed on 28 November 2022).
Statistical Analysis
DNA methylation data were processed with the R/Bioconductor package "minfi" (version 1.20) [21]. The t-SNE plot was computed by the R package "Rtsne" from 20,000 most variable CPG sites across the dataset, 3000 iterations, and a perplexity value of 20.
Methylation classes (MC) and histologically defined subtypes exhibited a striking overlap. The above-mentioned histological thymoma samples formed seven distinct MC groups: MC-A; MC-AB1; MC-AB2; MC-B1/B2; MC-B2; MC-B3; and MC-MNT. Only the methylation cluster of micronodular thymomas (MC-MNT) was blurred but still formed a distinct group (Figure 1). Normal thymus samples clustered mainly with B1/B2 thymomas, which most closely resemble normal thymus cytologically and architecturally. The following conclusions could be drawn from these analyses: firstly, the initial WHO diagnosis and the methylation groups matched perfectly in 104 out of 113 cases; secondly, five composite thymomas consisting of B2 and B3 components (249910, 249912, 249914, 249920, and 249922) clustered accordingly between MC-B2 and MC-B3; and finally, ABand B2-thymomas formed two different MC clusters each, designated MC-AB-I (13 cases) and MC-AB-II (9 cases), and MC-B2 (21 cases) and MC-B1/B2 (10 cases). As indicated by its name, the "MC-B1/B2" cluster was formed by B1-thymomas together with a subgroup of B2-thymomas ("B1-like" B2-thymomas) ( Figure 1). a distinct group (Figure 1). Normal thymus samples clustered mainly with B1/B2 momas, which most closely resemble normal thymus cytologically and architectu The following conclusions could be drawn from these analyses: firstly, the initial W diagnosis and the methylation groups matched perfectly in 104 out of 113 cases; seco five composite thymomas consisting of B2 and B3 components (249910, 249912, 24 249920, and 249922) clustered accordingly between MC-B2 and MC-B3; and finally and B2-thymomas formed two different MC clusters each, designated MC-AB-I (13 c and MC-AB-II (9 cases), and MC-B2 (21 cases) and MC-B1/B2 (10 cases). As indicate its name, the "MC-B1/B2" cluster was formed by B1-thymomas together with a subg of B2-thymomas ("B1-like" B2-thymomas) ( Figure 1). Each of the MC-groups is mainly composed of one histological subg (displayed by different colors) despite some remarkable features: 1. A-thymomas cluster tog with atypical A-thymomas; 2. AB-thymomas are separated into two clusters that were characte histologically by a rare monophasic and prototypic bi-phasic growth pattern, respectively; a B2-thymomas are separated into two clusters that were characterized histologically by proto Each of the MC-groups is mainly composed of one histological subgroup (displayed by different colors) despite some remarkable features: 1. A-thymomas cluster together with atypical A-thymomas; 2. AB-thymomas are separated into two clusters that were characterized histologically by a rare monophasic and prototypic bi-phasic growth pattern, respectively; and 3. B2-thymomas are separated into two clusters that were characterized histologically by prototypic B2 and "B1-like" B2-thymomas, respectively. MC-MNT forms a separate methylation entity but has poorly defined boundaries. Normal thymus samples clustered mainly with B1/B2 thymomas, which most closely resemble normal thymus cytologically and architecturally.
A retrospective histological review based on these methylation findings revealed different morphologic features in cases from these subgroups. MC-AB-I and MC-AB-II contained AB-thymomas with different lymphocyte contents. Thymomas in the MC-AB-I cluster showed a 'classical' biphasic growth pattern, with separated spindle cell-rich type A areas and lymphocyte-rich type B-like areas ( Figure 2A). In contrast, the AB-thymoma of the MC-AB-II group exhibited a monophasic morphology with a high lymphocyte content throughout the tumor ( Figure 2B). poorly defined boundaries. Normal thymus samples clustered mainly with B1/B2 thymomas, which most closely resemble normal thymus cytologically and architecturally.
A retrospective histological review based on these methylation findings revealed different morphologic features in cases from these subgroups. MC-AB-I and MC-AB-II contained AB-thymomas with different lymphocyte contents. Thymomas in the MC-AB-I cluster showed a 'classical' biphasic growth pattern, with separated spindle cell-rich type A areas and lymphocyte-rich type B-like areas ( Figure 2A). In contrast, the AB-thymoma of the MC-AB-II group exhibited a monophasic morphology with a high lymphocyte content throughout the tumor ( Figure 2B). B2-thymomas were also, by methylation, divided into two distinct subgroups: MC-B2 (21 cases) and MC-B1/B2 (10 cases). Histological assessment revealed that MC-B2 thymomas showed high numbers of epithelial cells and easily visible tumor cell clusters (Figure 3A), while MC-B1/B2 thymomas were dominated by thymocytes ( Figure 3B). Nevertheless, the diagnostic criteria for B1 thymomas (resemblance to a normal thymus, obvious medullary islands, and a lack of epithelial cells) were not met. B2-thymomas were also, by methylation, divided into two distinct subgroups: MC-B2 (21 cases) and MC-B1/B2 (10 cases). Histological assessment revealed that MC-B2 thymomas showed high numbers of epithelial cells and easily visible tumor cell clusters ( Figure 3A), while MC-B1/B2 thymomas were dominated by thymocytes ( Figure 3B). Nevertheless, the diagnostic criteria for B1 thymomas (resemblance to a normal thymus, obvious medullary islands, and a lack of epithelial cells) were not met.
A retrospective histological review based on these methylation findings revealed different morphologic features in cases from these subgroups. MC-AB-I and MC-AB-II contained AB-thymomas with different lymphocyte contents. Thymomas in the MC-AB-I cluster showed a 'classical' biphasic growth pattern, with separated spindle cell-rich type A areas and lymphocyte-rich type B-like areas (Figure 2A). In contrast, the AB-thymoma of the MC-AB-II group exhibited a monophasic morphology with a high lymphocyte content throughout the tumor ( Figure 2B). B2-thymomas were also, by methylation, divided into two distinct subgroups: MC-B2 (21 cases) and MC-B1/B2 (10 cases). Histological assessment revealed that MC-B2 thymomas showed high numbers of epithelial cells and easily visible tumor cell clusters (Figure 3A), while MC-B1/B2 thymomas were dominated by thymocytes ( Figure 3B). Nevertheless, the diagnostic criteria for B1 thymomas (resemblance to a normal thymus, obvious medullary islands, and a lack of epithelial cells) were not met. Surprisingly, atypical and conventional A-thymomas formed a single distinct methylation class (MC-A) (Figure 1). Since atypical A-thymomas resemble B3-thymomas in many ways [22], one might have expected clustering closer to B3-thymomas, which was obviously not the case.
Lastly, it is remarkable that micronodular thymomas with lymphoid stroma formed a distinct cluster (MC-MNT) that was clearly separated from the clusters comprising Athymomas and AB-thymomas, although these three thymoma subtypes share morphologic, immunohistochemical, and genetic features [8]. The different methylation profiles could therefore indicate an important contribution of the non-neoplastic lymphoid stroma to the individual "bulk methylation profile". In particular, we speculate that the near-absence of a lymphoid stroma in A-thymomas, the variable abundance of immature T cells in ABthymomas, and the dominance of numerous mature B cells and T cells in the stroma of MNTs may have caused different footprints in the methylation profiles of these tumor entities.
Of note, no association with gender was observed (Supplementary Figure S1A), but interestingly, the distribution of older (>61.5 years) and younger (<61.5 years) individuals was skewed between the MC groups. While in accordance with the literature, younger patients were mainly affected by type B1/B2 thymomas, older patients more frequently developed type A thymomas (Supplementary Figure S1B).
Reassuringly, heatmap analysis recapitulated the methylation differences in the distinct thymoma histotypes identified by t-SNE analysis (Supplementary Figure S2).
Case-by-Case Discussion for "No Match" Samples
While methylation profiling assigned almost all thymoma samples to distinct MCs, eight cases (9/113; 8%) were 'outliers', i.e., they did not cluster within a distinct MC group or did not cluster in the histologically anticipated MC group. For the following five cases not falling into a distinct or their anticipated MC group, clarifying the discrepancy was easy: all of them (249910, 249912, 249914, 249920, and 249922) were heterogeneous thymomas with B2 and B3 components, making their intermediate position between MC-B2 and MC-B3 plausible. Two B2-thymomas (249860 and 249880) clustered near the MC-MNT group. Microscopically, both tumors showed a circumscribed clear B2-thymoma area that was altered by (pseudocystic) regression, sclerosing, and inflammatory changes, possibly modifying the methylation pattern ( Figure 4).
for the diagnosis of B1-thymoma (hematoxylin and eosin staining). Surprisingly, atypical and conventional A-thymomas formed a single distinct methylation class (MC-A) (Figure 1). Since atypical A-thymomas resemble B3-thymomas in many ways [22], one might have expected clustering closer to B3-thymomas, which was obviously not the case.
Lastly, it is remarkable that micronodular thymomas with lymphoid stroma formed a distinct cluster (MC-MNT) that was clearly separated from the clusters comprising Athymomas and AB-thymomas, although these three thymoma subtypes share morphologic, immunohistochemical, and genetic features [8]. The different methylation profiles could therefore indicate an important contribution of the non-neoplastic lymphoid stroma to the individual "bulk methylation profile". In particular, we speculate that the nearabsence of a lymphoid stroma in A-thymomas, the variable abundance of immature T cells in AB-thymomas, and the dominance of numerous mature B cells and T cells in the stroma of MNTs may have caused different footprints in the methylation profiles of these tumor entities.
Of note, no association with gender was observed (Supplementary Figure S1A), but interestingly, the distribution of older (>61.5 years) and younger (<61.5 years) individuals was skewed between the MC groups. While in accordance with the literature, younger patients were mainly affected by type B1/B2 thymomas, older patients more frequently developed type A thymomas (Supplementary Figure S1B).
Reassuringly, heatmap analysis recapitulated the methylation differences in the distinct thymoma histotypes identified by t-SNE analysis (Supplementary Figure S2).
Case-by-Case Discussion for "No Match" Samples
While methylation profiling assigned almost all thymoma samples to distinct MCs, eight cases (9/113; 8%) were 'outliers', i.e., they did not cluster within a distinct MC group or did not cluster in the histologically anticipated MC group. For the following five cases not falling into a distinct or their anticipated MC group, clarifying the discrepancy was easy: all of them (249910, 249912, 249914, 249920, and 249922) were heterogeneous thymomas with B2 and B3 components, making their intermediate position between MC-B2 and MC-B3 plausible. Two B2-thymomas (249860 and 249880) clustered near the MC-MNT group. Microscopically, both tumors showed a circumscribed clear B2-thymoma area that was altered by (pseudocystic) regression, sclerosing, and inflammatory changes, possibly modifying the methylation pattern ( Figure 4). Two other cases did not cluster in the histologically anticipated MC group. Both cases (249832 and 249834) were AB-thymomas that clustered with the MC-A cohort. Retrospective histological re-analysis of these "type A-like" cases showed a very low lymphocyte content, making A-thymoma a reasonable differential diagnosis ( Figure 5). Two other cases did not cluster in the histologically anticipated MC group. Both cases (249832 and 249834) were AB-thymomas that clustered with the MC-A cohort. Retrospective histological re-analysis of these "type A-like" cases showed a very low lymphocyte content, making A-thymoma a reasonable differential diagnosis ( Figure 5). In such cases, the distinction from type A-thymoma is difficult and arbitrary.
Copy Number Profiling of Thymomas
We generated copy number variation (CNV) plots from all thymomas based on MCand histological subgrouping (Figures 6 and S3). Summary copy number plots (SCNP) were generated by overlaying individual CNV plots from the distinct subgroups. While histological vs. MC-based SCNPs were concordant, different MC/histology groups exhibited remarkable differences ( Figure 6). A-thymoma and atypical A-thymoma exhibited few numerical alterations with no consistently recurrent changes. The impression that atypical A-thymomas exhibit more alterations is deceptive because it was caused by a single case with higher chromosomal instability. MC-MNT, including all cases of micronodular thymoma, showed no recurrent alterations. Similar findings were observed for MC-AB-I and MC-AB-II. All tumors in MC-B1/B2, including all B1 and a fraction of B2-thymomas ("B1-like" B2-thymomas), exhibited a low number of alterations, too. In contrast, MC-B2 (conventional B2-thymoma) showed more alterations with a gain of chromosomal arm 1q in more than half of the cases. MC-B3 was characterized by the highest number of copy number alterations, with gains of chromosomes 1q and 14q in virtually all cases, followed by gains of chromosomes 7, 9, 8, 16, 5, and 4. Losses most frequently involve chromosome 6. In such cases, the distinction from type A-thymoma is difficult and arbitrary.
Copy Number Profiling of Thymomas
We generated copy number variation (CNV) plots from all thymomas based on MCand histological subgrouping ( Figure 6 and Figure S3). Summary copy number plots (SCNP) were generated by overlaying individual CNV plots from the distinct subgroups. While histological vs. MC-based SCNPs were concordant, different MC/histology groups exhibited remarkable differences ( Figure 6). A-thymoma and atypical A-thymoma exhibited few numerical alterations with no consistently recurrent changes. The impression that atypical A-thymomas exhibit more alterations is deceptive because it was caused by a single case with higher chromosomal instability. MC-MNT, including all cases of micronodular thymoma, showed no recurrent alterations. Similar findings were observed for MC-AB-I and MC-AB-II. All tumors in MC-B1/B2, including all B1 and a fraction of B2-thymomas ("B1-like" B2-thymomas), exhibited a low number of alterations, too. In contrast, MC-B2 (conventional B2-thymoma) showed more alterations with a gain of chromosomal arm 1q in more than half of the cases. MC-B3 was characterized by the highest number of copy number alterations, with gains of chromosomes 1q and 14q in virtually all cases, followed by gains of chromosomes 7, 9, 8, 16, 5, and 4. Losses most frequently involve chromosome 6.
Discussion
We here demonstrate the successful classification of thymomas by methylation patterns based on array-generated DNA methylation data. Specifically, we show that the current WHO subtyping of thymomas is substantially reflected by our methylation classifier. Furthermore, some unexpected relationships between histological subtypes became obvious: (a) A-thymomas cluster together with atypical A-thymomas; (b) AB-thymomas were separated into two groups, namely the classical biphasic and the less common monophasic AB variant; (c) B2-thymomas were also separated into two subgroups, one of which is epithelial-rich (conventional) and the other constituting "B1-like" lymphocyte-rich B2thymomas; (d) thymomas consisting of B2 and B3 components clustered between MC-B2 and MC-B3; and (e) A-/AB-thymomas and micronodular thymomas with lymphoid stroma formed distinct methylation groups.
(a) A-Thymomas Cluster Together with Atypical A-Thymomas
The 2015 version of the WHO classification system introduced atypical A-thymoma as a variant of A-thymoma [3] to account for a small subgroup of A-thymomas that exhibit hypercellularity, increased mitotic counts, and foci of necrosis [22]. In the current WHO classification, atypical A-thymoma was established as an A-thymoma subtype [9]. However, only necrosis appears to show prognostic significance [23,24]. On the other hand,
Discussion
We here demonstrate the successful classification of thymomas by methylation patterns based on array-generated DNA methylation data. Specifically, we show that the current WHO subtyping of thymomas is substantially reflected by our methylation classifier. Furthermore, some unexpected relationships between histological subtypes became obvious: (a) A-thymomas cluster together with atypical A-thymomas; (b) AB-thymomas were separated into two groups, namely the classical biphasic and the less common monophasic AB variant; (c) B2-thymomas were also separated into two subgroups, one of which is epithelial-rich (conventional) and the other constituting "B1-like" lymphocyte-rich B2thymomas; (d) thymomas consisting of B2 and B3 components clustered between MC-B2 and MC-B3; and (e) A-/AB-thymomas and micronodular thymomas with lymphoid stroma formed distinct methylation groups.
(a) A-Thymomas Cluster Together with Atypical A-Thymomas
The 2015 version of the WHO classification system introduced atypical A-thymoma as a variant of A-thymoma [3] to account for a small subgroup of A-thymomas that exhibit hypercellularity, increased mitotic counts, and foci of necrosis [22]. In the current WHO classification, atypical A-thymoma was established as an A-thymoma subtype [9]. However, only necrosis appears to show prognostic significance [23,24]. On the other hand, distant metastasis in A-thymomas was associated with recurrent genetic aberrations independent of atypical histological features [25], making it debatable whether a distinction between conventional and atypical A-thymomas is clinically warranted. Our data here underline the close relationship of both morphologically defined A-thymoma subtypes. Future comparisons of clinically aggressive (advanced, unresectable, and lethal) and indolent A-thymomas should therefore increasingly focus on genomic and methylomic differences to identify more meaningful biomarkers instead of morphological features.
(b) Methylation Analyses Separate AB-Thymomas into Two Subgroups: Monophasic and Bi-Phasic AB-Thymoma
One of the most interesting findings presented here was the separation of AB-thymoma into two distinct subgroups. The growth pattern of most AB-thymomas is biphasic, with separated spindle cell-rich type A and lymphocyte-rich type B-like areas in highly variable proportions [9]. However, there are also monophasic AB-thymomas that lack a lymphocytepoor type A component but are characterized by high numbers of lymphocytes among epithelial spindle cells throughout the tumor [26,27]. So far, there are no established clinical differences between these two subgroups of AB-thymoma, and genetic data is extremely sparse [26,27]. However, the results presented here suggest that it might be relevant to further characterize these two subgroups clinically and at the molecular level.
(c) Methylation Analyses Separate B2-Thymomas into Two Subgroups: Conventional and "B1-like" B2-Thymomas
The two methylation clusters were associated with different thymocyte/epithelial cell ratios on histology. It is well known that the proportion of epithelial cells can vary widely between B-thymomas [9]. Interestingly, one B2-thymoma subgroup (termed "B1-like" B2thymomas) clustered together with the B1-thymomas, while the other B2-thymoma cases formed a distinct cluster distant from MC-B1/B2. It is noteworthy that both B2-thymoma subgroups did not show medullary islands, therefore ruling out true B1-thymomas. Nevertheless, the current data suggest that future studies should clarify whether B2-thymomas from the MC-B1/B2 cluster have the same indolent clinical course as the vast majority of B1-thymomas [9]. If confirmed, the criteria for the diagnosis of B1-thymomas and B2thymomas may need reconsideration and refinement. Such an adjustment of diagnostic criteria would be clinically relevant because non-encapsulated B2-thymomas classified according to current WHO criteria are common candidates for adjuvant radiotherapy even after radical resection, while radiotherapy is generally not recommended for completely removed locally invasive B1-thymomas [28].
(d) Composite Thymomas Consisting of B2 and B3 Components Clustered Accordingly between MC-B2 and MC-B3
Five thymomas were initially diagnosed as 'composite thymomas' consisting of a mixture of distinct B2 and B3 areas. This histological heterogeneity is a very common finding [7], and it is interesting that methylation analyses were able to recapitulate this heterogeneity by plotting these samples between MC-B2 and MC-B3.
This apparently high sensitivity and discriminatory power of methylation profiling could be meaningful in two settings. Firstly, it could help to improve the clinically meaningful recognition of heterogeneous B2/B3-thymomas that were previously shown to have a relatively favorable or poor prognosis depending on whether the proportion of the B3-component was below or above 10% [7,29]. Secondly, the high discriminatory power can potentially discover new biological tumor entities that are currently counted among the major thymoma histotypes [30]. In the field of non-thymic cancers, the discovery of new tumor entities through methylation profiling has already opened up new therapeutic perspectives, as demonstrated for histologically identical-looking brain tumors [31] and sarcomas [19].
(e) A-Thymoma and Micronodular Thymoma with Lymphoid Stroma form Distinct Methylation Groups Distant from Each Other
MNT has been considered to be closely related to type A-thymoma due to histologic and immunohistochemical similarities between the spindle epithelial cells found in both entities [32]. In addition, extensive areas resembling A-thymoma are found in up to 30% of heterogeneous MNT [33]. Finally, the highly characteristic L424H mutation of the GTF2I gene is encountered in both MNT and A-thymomas [8]. Despite these striking similarities, our results suggest that the hyperplastic B cell-rich lymphoid stroma present in all MNTs-a major criterion for the diagnosis-may have shifted the overall methylation pattern to a cluster that is clearly separated from the methylation cluster of A-thymomas.
Calculation of CNV was possible in all thymomas studied here. In line with TCGA findings [8] and historic CGH studies [34][35][36], our analysis revealed an overall low prevalence of CNVs in thymomas, with the highest CNV load in B3-thymomas followed by B2-thymomas (the conventional subtype). Of note, the B2-thymoma subgroup within the MC-B1/B2 cluster (B1-like B2-thymomas) showed barely any CNVs, as did 'true' B1 thymomas. This could be another hint that the MC-B1/B2-thymomas could pursue a more indolent clinical course. The CNVs in the different thymoma subgroups consisted mainly of gains and losses of whole chromosomes or chromosome arms. The gain of 1q represented the most frequent genomic alteration across all thymoma subtypes, followed by gains of chromosomes 14, 7, 9q, 5p, and 4, and losses of chromosome 6. Significantly, atypical A-thymomas did not show more alterations than conventional A-thymomas, except for one aberrant case with multiple CNVs.
Our study has limitations. Clustering based on methylation profiles may simply reflect different ratios of thymocytes to epithelial cells. In fact, our findings strongly suggest an impact of the non-neoplastic stroma on the overall methylation profile of a given thymoma. However, determining these ratios is one of the diagnostic cornerstones of the current WHO classification. Moreover, we observed strong clustering differences between thymoma subtypes with similar ratios of thymocytes to epithelial cells (such as thymocytepoor A-thymomas vs. B3-thymomas or thymocyte-rich AB-thymomas vs. B2-thymomas). The latter cases suggest a high sensitivity of our approach in identifying specific tumor cell methylation profiles even against a background of abundant non-neoplastic thymocytes.
In summary, our study is the most comprehensive methylation analysis of thymomas to date, generally supporting the current WHO classification. Methylation analysis points towards refinements regarding a fraction of B2-thymomas sharing molecular features with B1-thymomas, with potential for clinical consequences.
Supplementary Materials: The following supporting information can be downloaded at: https:// www.mdpi.com/article/10.3390/cancers14235876/s1, Figure S1: DNA methylation-based thymoma classification established by t-Distributed Stochastic Neighbor Embedding (t-SNE) dimensionality reduction, Figure S2: Methylation-based clustering of the different thymoma types shows a decent separation according to the different thymoma histotypes whereby particularly type B1-and B2thymomas (especially B1-like type B2-thymomas) intermingle, Figure S3: Frequency plots of copy number alterations in thymomas grouped according to histologic subtype. Informed Consent Statement: Patient consent was waived due to the retrospective design of the study. Data Availability Statement: Data have been uploaded to the GEO database, and access will be provided upon acceptance of the manuscript.
|
v2
|
2022-12-07T19:51:08.811Z
|
2022-11-29T00:00:00.000Z
|
254364472
|
s2ag/train
|
Anti-Yo Paraneoplastic Cerebellar Degeneration and Breast Cancer: A Long Survival of Persistent Cerebellar Syndrome
Paraneoplastic neurological syndromes (PNS) occur in 1–3% of all cancer patients with several cancer-related neurologic diseases involving any part of the nervous system. Paraneoplastic cerebellar degeneration (PCD) is a specific type of PNS characterized by sub-acute cerebellar syndrome with trunk and limb ataxia, dysarthria, diplopia, and vertigo. We report herein the case of a 70-year-old female patient with cerebellar symptoms and transient anti-Yo antibody PCD positivity manifested three years after a breast cancer diagnosis who is currently neurologically stable after an extended follow-up.
|
v2
|
2022-12-07T19:59:07.518Z
|
2022-11-29T00:00:00.000Z
|
254355579
|
s2orc/train
|
DIODE LASER FOR THE MANAGEMENT OF UPPER TRACT UROTHELIAL CANCER (UTUC) – CASE SERIES
Background and Objective: Upper tract urothelial carcinoma (UTUC) is uncommon; however, at the time of diagnosis, they are usually more invasive than bladder urothelial carcinomas. Although nephroureterectomy (NU) has been the gold-standard treatment, guidelines have been set for kidney-sparing treatment in selected groups of patients. While these guidelines are aimed towards patients fit for salvage radical treatment, little has been published on managing the symptomatic patient not fit for NU. Various modali - ties of endoscopic ablation in managing UTUC have been described in the literature, but there is currently no reported use of the diode laser. Therefore, we aim to assess its efficacy and safety profile in the ablation of UTUC in patients unfit for major abdominal surgery in radical nephroureterectomy regardless of the tumour grade and size. Patients and method: A single centre retrospective review of patients who underwent Diode Laser treatment for UTUC over 4 years was done. Follow up through 6 monthly ureteroscopy alternating with com-puted tomography (CT) urogram was done to assess the need for further treatment. Results: 30 patients were identified, with mean age 76 years (64-88) and variable tumour locations, includ - ing lower and mid ureter and renal pelvis, upper and lower calyces. 76.7% were ASA 3 and 20% ASA 4. The mean tumour size was 3.8 cm (2-7 cm). The mean number of sessions was 2.1 (1-6). 63.3% of the tumours were grade 2, while 30% were grade 3. A case of metastatic renal-cell carcinoma was diagnosed as a 4 cm filling defect in the kidney where the diode laser was used for resection biopsy and ablation. 16.7% experienced Clavien-Dindo grades 1-2 complications. A total of 6.7% of patients were converted to an inpatient stay. None of the patients needed blood transfusion nor did any develop a ureteric stricture on subsequent ureteroscopies. 48.3% of patients experienced clinical recurrences of which 57.1% were at a different site. Two of the patients developed metastatic disease. One patient died 3 years after initial treatment with disease progression. Conclusion: The management of UTUC with diode laser is a safe and efficacious conservative treatment for disease and symptom control in patients unfit for radical treatment
INTRODUCTION
Upper tract urothelial carcinoma (UTUC) is uncommon and accounts for 5 to 10% of all urothelial cancers, with a yearly incidence of 2/100 000 population in developed countries. 1 UTUC refers to malignant changes of the urothelium extending from the distal ureteric orifice to the renal calyces. At the time of diagnosis, UTUCs are usually multifocal and more advanced than bladder urothelial carcinomas making them more invasive. Although radical nephroureterectomy (NU) has been the gold-standard treatment for UTUC, endoscopic management has been used in selected cases. The European Association of Urology (EAU), in published guidelines, has recommended kidney-sparing management as the primary treatment option for low-risk tumours (unifocal, <2 cm, low grade, and no evidence of invasion on CT) and patients with solitary kidney and/or impaired renal function providing that it will not compromise survival. 3 Some comparative studies have shown similar 5-year cancer-specific survival for NU and patients managed with endoscopic ablation. [4][5][6] Variations in endoscopic ablation of UTUC continue to evolve because of the continuous advances in the endoscopic armamentarium. Previously, the most frequently used lasers in managing UTUC were the holmium yttrium aluminum garnet (Ho:YAG) and the neodymium yttrium aluminum garnet (Nd:YAG); however, increasing success has been reported with the thulium laser in recent years. [7][8][9][10][11] Despite the differences in laser properties, no study has shown the superiority of one laser type over the other. In addition, there are currently no published data on the use of the diode laser in managing UTUC.
Whilst the guidelines are clear regarding managing patients with UTUC who will benefit from NU if kidney-sparing management fails, little is documented on managing patients who may not be fit for radical surgery. These patients can be challenging to manage, requiring frequent hospitalizations due to ongoing symptoms from bleeding, pain and/or obstruction.
AIMS
To assess the efficacy and safety profile of using diode laser for ablation of UTUC in patients unfit for major abdominal surgery in the form of radical nephroureterectomy regardless of the tumour grade and size. In addition, we considered the impact of repeated short general anaesthetic, the disease control achieved, the development of complications, disease progression, and the optimal follow-up regime in these patients.
METHODS
A single-centre retrospective review of the database for patients who had ureteroscopic Diode Laser ablation of UTUC over 4 years between June 2016 and December 2020 was performed. Data on patients' fitness, including comorbidities and American Society of Anaesthesiologists physical status scores (ASA), was collected. The tumour grade, stage, type, number, size, and location were also assessed. Postoperative analgesia, admissions, and complications were reviewed for all patients.
SURGICAL TECHNIQUE
All Cases had pre-procedure ureteroscopy and Biopsies (Except the case with metastatic Renal cell carcinoma). All cases were discussed at Urology multidisciplinary team meeting (MDT) and had an anaesthetic assessment performed by a senior anaesthetist including Cardio Pulmonary Exercise Test to assess their fitness for radical treatment. Patients were offered either diode laser ablation as a palliative option or watchful waiting. All patients were operated on by the same surgeon. The operative time was limited to 60 minutes in all cases.
All patients were listed as day cases. A sensor guidewire was inserted into the affected side. Rigid ureteroscopy was done for lower and middle ureteric tumours, while flexible ureteroscopy was done for the rest of the upper urinary tract. A 10-12F access sheath was used to reduce the intrarenal pressure when a flexible ureteroscopy was done. The diode laser was set to emit 2 W output power at 1470 nm. There was no mitomycin-C used after the procedure. Anticoagulant medications were only stopped when it was deemed safe at preoperative assessment and continued in high-risk patients. Postoperative pain was managed with a 5-day course of paracetamol 1 g QDS and codeine 60 mg QDS.
Follow-up
Initially, the procedure was repeated on a 6 monthly basis to asses for recurrence and clearance. During the COVID-19 Pandemic, a 6 month CT urogram alternating with ureteroscopy was used as a followup method to determine whether further treatment was needed alongside patients' symptoms.
RESULTS
A total of 30 patients with ureteric or renal transitional cell cancer and 1 with a solid renal pelvic lesion (which turned out as metastatic RCC), unsuitable for radical nephroureterectomy, underwent ureteroscopy, biopsy, and diode Laser ablation in the period June 2016 -December 2020. The mean patient age was 76 years at the time of diagnosis (range 64-88). They all had American Society of Anaesthesiologists physical status scores (ASA score) calculated (see table below). Although ASA grade 2, one patient was offered endoscopic management due to a solitary kidney.
All patients had at least three or more of the flowing recorded comorbidities: left ventricular systolic dysfunction, atrial fibrillation, Reynaud disease, obesity, herniated spinal disc, Myocardial Infarction, cardiac defibrillator, chronic obstructive pulmonary disease, congestive cardiac failure, diabetes mellitus, transient ischaemic attack, chronic kidney disease; stage 3B or more, dialysis, pernicious anaemia, hypertension, cardiac stents, gastro-oesophageal reflux, pacemaker, Lynch syndrome.
The tumours were present in the mid and lower ureter and renal pelvis, upper calyx, and lower calyx. 40% of tumours were ureteric while 60% were renal.
The median follow-up period was 30 months. The mean tumour size was 3.8 cm (range 2-7cm). The tumour was low grade in 44.8% of cases. The number of treatment sessions varied from 1-6 sessions (mean 2.1). There was a reduction in tumour size in all cases. On follow-up ureteroscopy, 51.7% of patients were noted to have achieved complete tumour clearance after their initial treatment. Clearance has been maintained on subsequent follow-up urograms. However, 48.3% of patients experienced recurrences, 57.1% at a different site to the primary tumour. Two cases developed distant metastasis; one with high-grade disease and the second with low-grade disease. The data is represented in Table 2.
A single metastatic renal cell carcinoma on immunotherapy in the right kidney was initially diagnosed with a 4 cm filling defect in the left kidney. The diode laser was used for resection biopsy and lesion ablation. The laser settings, in this case, were different using 2 watts of 980 nm for the resection biopsy then 2 watts of 1470 nm to ablate the lesion. The subsequent histology showed the lesion to be a metastatic RCC. There was no need for further endoscopic management as the patient continued on immunotherapy and showed no evidence of recurrences in subsequent scans at the ablated site.
One patient with grade 3 upper calyx TCC received no benefit from the endoscopic management of the tumour due to repeated significant contact bleeding resulting in very poor vision during the procedure preventing any significant reduction in tumour size. After 3 ureteroscopy attempts, including one failed attempt of chemo-resection using mitomycin C, the decision was taken to offer no further endoscopic management and refer onward for palliative immunotherapy due to possible small lymph node metastasis (less than 1 cm). Repeat CT urogram in 3 months showed an increase in tumor size by 1cm and lymph nodes metastases despite immunotherapy.
One case had a low-grade, low-stage tumour on all biopsies but had chest nodules which were kept under observation. The patient developed a lesion anterior to the sternum confirmed on biopsy as metastatic TCC and was referred for palliative 16.7% of patients experienced Clavien-Dindo 1 and 2 complications. These included haematuria (3.3%), haematuria, and acute kidney injury (AKI) in a patient with a singlefunctioning-kidney (3.3%), vomiting (6.7%) and acute urinary retention (3.3%). Only 6.7% of these patients were converted to inpatient stay (haematuria and AKI) for 2 days and managed conservatively at the ward level. None required blood transfusion. None of the patients required hospital admission for postoperative pain management nor were any cases found to have a ureteric stricture on repeated ureteroscopy or CT urogram.
There was one mortality in a patient with a single functioning kidney and chronic kidney disease stage 4, after 3 years of treatment with renal failure and disease progression.
DISCUSSION
Over the past years, various types of lasers have been used successfully in managing UTUC.
However, the effect depends on the type of laser used, where shorter wavelengths result in greater heat conversion; and a high tissue absorption coefficient results in shallow penetration. Although the renal sparing approach has been recommended for managing low-risk tumours, there is no specific recommendation for managing UTUC in high-risk or patients who are unfit for radical treatment.
The diode laser is a compact and portable unit whose energy is absorbed by water and haemoglobin. This allows the diode laser to have both good haemostatic and vaporization effects at low energy levels, making it suitable for ablation therapy. 12 Despite the multiple published series on the three most documented used laser modalities in managing UTUC (Ho:YAG, Nd:YAG and thulium), no conclusive evidence indicates the superiority of a particular laser type. The thulium laser provides a continuous wave, precise incisions, and excellent coagulation and vaporization functions while avoiding temperature increases which can lead to surrounding tissue damage. 13 The holmium laser, on the other hand, can lead to ureteral transluminal microperforations or microperforations due to discontinuous tear-like damage to tissues. As a result, in some series, the thulium laser has demonstrated better efficacy with few complications than the holmium laser system. [14][15][16] Due to the high risk of recurrence and progression associated with endoscopic laser management of UTUC, guidelines have suggested careful and long-term follow-up. 17 One important criterion affecting endoscopic ablation's success is tumour size. 11,18 Our series showed a recurrence rate of 48.3%; however, 86.2% of our patients presented with tumour sizes greater than the recommended size eligible for endoscopic ablation. None of the patients experienced tumour progression on subsequent biopsies or imaging. There was definite reduction in all tumour sizes with a diode laser except in one case with highgrade disease. With a median follow-up period of 30 months, 51.7% of the patients experienced complete tumour response after 1 session without needing further procedures. 73.3% of these patients had tumour sizes above 2 cm and 66.7% with high-grade disease.
Laser treatment for UTUC is generally safe and well tolerated; however, the risk of perforation and ureteric stricture remains a limiting factor. In a systematic review, Chieng Hin et al. reported that complications were not uniformly reported but ranged from 7.1 to 46%, with the commonest serious complication being ureteric stricture. 19 In our series, 20% of patients experienced complications, all of which were Clavien-Dindo grades 1 and 2. Only 2 of the patients needed admission for further management. One was a CKD patient with a single kidney who developed haematuria and AKI. This patient was anticoagulated and was thought to be too high risk to discontinue anticoagulation medication. The AKI was likely due to clot colic and resolved spontaneously. The other patient was one with very friable tumours with easy contact bleeding. None of the patients required blood transfusion, and no ureteric strictures were diagnosed despite treating patients with significantly large tumours with multiple sessions. This may be attributed to the low power settings of the laser.
Although a risk-stratified approach to follow-up has been recommended for surveillance in patients managed endoscopically for UTUC, these are for patients who would benefit from radical treatment should ablation therapy fail. 20 In our cohort of patients who were already deemed unfit for radical treatment we aimed to develop the optimum follow-up protocol. The follow-up protocol was initially designed with a repeat ureteroscopic examination on 6 month basis which was well tolerated by patients. However, with the COVID-19 pandemic and the resulting reduced access to the operative theatre we shifted the follow-up to alternating 6 monthly CT urogram with ureteroscopy and eventually yearly CT urogram, with ureteroscopy being performed only if indicated.
Overall, our data shows very encouraging results for disease clearance and control for UTUC when using a low-energy diode laser in high-risk patients, with minimal complications. In addition, with a low postoperative admission rate (6.7%), we have potentially reduced the risk of frequent hospital visits by these patients due to symptoms associated with their UTUC.
CONCLUSION
In our limited Series, Diode Laser was both a safe and effective method for managing UTUC in patients unfit for radical treatment. The procedure was well tolerated by often frail and comorbid patients and allowed for disease control including in large-size tumours. Although the initial aim of the intervention was palliative, we note disease clearance in a significant proportion of patients, including those with high-risk diseases. No major complications were reported, although the number of cases in this study is still low. Based on these preliminary results, the diode laser can be considered an option alongside the thulium and holmium laser in kidney-sparing surgery for UTUC.
|
v2
|
2022-12-07T20:07:07.911Z
|
2022-11-29T00:00:00.000Z
|
254344873
|
s2ag/train
|
Application of the data-driven concept in the management of medical organizations: Successful cases and steps for implementation in the Russian Federation
Aim. The presented study aims to create a business model of a medical institution where the data-driven decision-making concept is implemented.Tasks. The authors define the data-driven concept; analyze successful cases of implementation of the data-driven concept in various organizations, including medical organizations; identify the technical requirements of this concept; develop business models of budgetary and commercial medical institutions with the with the introduction of the data-driven concept.Methods. This study uses such research methods as description, theoretical and comparative analysis, construction of business models, and systematization.Results. The concept of the data-driven approach to managerial decision-making is explored. Excerpts from foreign analyses of this approach are presented. The authors provide examples of successful implementation of the data-driven concept in organizations operating in various fields, including marketing, management, and medicine. The cases of PJSC Sibur Holding, PJSC SberBank, Seoul National University Bundang Hospital, and Memorial Sloan Kettering Cancer Center are considered. Technical requirements for the implementation of the data-driven concept are indetified. The business models of budgetary and commercial medical institutions operating according to this concept are described and analyzed in detail.Conclusions. The scope of application of the data-driven approach in managerial decisionmaking is extensive: this concept can be successfully applied in marketing, management, and medicine. In most cases, the company’s field of activity does not limit the applicability of this management approach. However, the implementation of the data-driven concept in the organization’s management will inevitably lead to high financial and labor costs. The authors believe that this concept can be used to successfully manage budgetary and commercial medical institutions in Russia in view of the steps toward implementing the data-driven approach provided in this study. The introduction of data-driven management will allow medical institutions to develop a personalized approach to patients and increase the level of work efficiency.
|
v2
|
2022-12-09T16:17:15.187Z
|
2022-11-29T00:00:00.000Z
|
254448846
|
s2ag/train
|
Management and Outcome of Acute Mechanical Bowel Obstruction in a Teaching Hospital
Objective: To identify and analyze the clinical presentation, management and outcome of patients with acute mechanical bowel obstruction along with the etiology of obstruction and causes of bowel ischemia, necrosis, and perforation. Methods: This is a prospective observational study of adult patients admitted with acute mechanical bowel obstruction between September 2010 and August 2011. Results: Of the 100 patients included in the study, 73 (73%) presented with small bowel and 27 (27%) with large bowel obstruction. Absence of passage of flatus and/or feces (96%) and abdominal distension (92%) were the most common symptoms and physical finding, respectively. Adhesions (51%), incarcerated hernias (14%), Volvulus (14%) and large bowel cancer (12%) were the most frequent causes of obstruction. Sixty-seven patients (67%) were treated operatively and 33 (33%) were treated conservatively. Bowel ischemia was found in 20 cases (20%), necrosis in 13 (13%), and perforation in 3 (3%). Bands and adhesions, hernias, and volvulus, were the most frequent causes of bowel ischemia (65%, 20%, 10%), necrosis (38.46%, 23.08%, 38.46%), and perforation (33.33%, 33.33%, 33.33%). A comparatively higher risk of strangulation was noticed in incarcerated hernias and volvulus than bands and adhesions. Conclusion: Absence of passage of flatus and/or feces and abdominal distension are the most common symptoms and physical finding of patient'> with acute mechanical bowel obstruction, respectively. Adhesions, hernias, volvulus and large bowel cancer are the most common causes of obstruction, as well as of bowel ischemia, necrosis, and perforation. Although an important proportion of these patients can be non-operatively treated, a major portion requires immediate operation. Great caution should be taken for the treatment of these patients since the incidence of bowel ischemia, necrosis, and perforation is significantly high.
|
v2
|
2022-11-30T14:27:00.623Z
|
2022-11-30T00:00:00.000Z
|
254071302
|
s2orc/train
|
Biomarkers in the development of individualized treatment regimens for colorectal cancer
Introduction Colorectal cancer (CRC) is the third most common and second most deadly malignancy in the world with an estimated 1. 9 million cases and 0.9 million deaths in 2020. The 5-year overall survival for stage I disease is 92% compared to a dismal 11% in stage IV disease. At initial presentation, up to 35% of patients have metastatic colorectal cancer (mCRC), and 20–50% of stage II and III patients eventually progress to mCRC. These statistics imply both that there is a proportion of early stage patients who are not receiving adequate treatment and that we are not adequately treating mCRC patients. Body Targeted therapies directed at CRC biomarkers are now commonly used in select mCRC patients. In addition to acting as direct targets, these biomarkers also could help stratify which patients receive adjuvant therapies and what types. This review discusses the role of RAS, microsatellite instability, HER2, consensus molecular subtypes and ctDNA/CTC in targeted therapy and adjuvant chemotherapy. Discussion Given the relatively high recurrence rate in early stage CRC patients as well as the continued poor survival in mCRC patients, additional work needs to be done beyond surgical management to limit recurrence and improve survival. Biomarkers offer both a potential target and a predictive method of stratifying patients to determine those who could benefit from adjuvant treatment.
Introduction
Colorectal cancer (CRC) is the third most common and second most deadly malignancy in the world with an estimated 1.9 million cases and 0.9 million deaths in 2020 (1). With improved screening and enhanced surgical options, the overall survival in patients with CRC has improved over time with a current overall relative survival of 65% at 5 years (2). However, this survival varies greatly as the disease progresses. The 5-year overall survival for stage I disease is 92% compared to a dismal 11% in stage IV disease (3). At initial presentation up to 35% of patients have metastatic colorectal cancer (mCRC) with 20-50% of stage II and III patients eventually progressing to mCRC (4).
Current recommendations suggest that patients with stage III (lymph node-positive) colon cancer undergo surgical resection followed by adjuvant chemotherapy. There continues to be controversy about the survival benefit of chemotherapy in patients with stage II disease (5). The intention of adjuvant chemotherapy is to decrease the chances of recurrence in the setting of curative resection. As stage II disease is node-negative, there is a presumption of local disease without metastases. Current recommendations suggest that stage II patients do not receive adjuvant therapy, however up to 23% will have a recurrence within 5 years indicating we are not currently capturing a population who may indeed have initial early spread and would benefit from additional therapy (6). Therefore, some argue that "high risk" stage II patients should receive adjuvant therapy in hopes of rescuing this population who will eventual relapse. Some high risk factors in stage II disease that have been suggested as warranting adjuvant treatment include T4 tumors, <12 lymph nodes harvested at surgery, presence of bowel obstruction or perforation, poorly differentiated tumors, and the presence of lymphovascular/perineural invasion (7). Of these, only T4 disease has been validated to help identify the subset of stage II patients who benefit from adjuvant chemotherapy (8). Standard adjuvant treatment regimens for high risk stage II or stage III disease include combination therapies of CAPEOX (capecitabine and oxaliplatin) and FOLFOX (leucovorin, fluorouracil (5-FU), and oxaliplatin). However, only 20% of patients benefit from adjuvant chemotherapy, exposing 80% of patients to unnecessary toxicity (9). In addition to these combination therapies of classic chemotherapy agents, newer targeted agents exist and may confer benefits in specific patient populations. Better biomarkers that stratify patient risk (prognostic) and predict therapeutic responses (predictive) could reduce the exposure of patient populations to unnecessary toxicity and increase the likelihood of eliminating the chance of recurrence in patients after resection. Biomarkers could aid in defining the optimum regimen of adjuvant chemotherapy, the duration of treatment, the utility of additional targeted treatments, and which patient populations should receive it (Table 1).
Microsatellite instability
High microsatellite instability (MSI-H) is the phenotype of a deficient mismatch repair (dMMR) system and is present in about 15% of colorectal cancers. Microsatellites are short tandem repeats of single nucleotide or di-, tri-, or tetra-nucleotides in DNA sequences found throughout the tumor genome and are a marker of a hypermutable phenotype. The mismatch repair (MMR) system functions to rectify errors that may occur during DNA replication. With the inactivation of at least one of the DNA MMR genes (MLH1, MSH2, MSH6, and PMS2) through either mutations or transcriptional silencing, the MMR system is unable to function leading to an accumulation of errors in the DNA (10). This inactivation stems from either germline mutations in the MMR genes themselves or somatic hypermethylation of CpG islands surrounding the promotor region in the genes. Germline mutations in MMR lead to hereditary non-polyposis colorectal cancer (HNPCC or Lynch Syndrome) which causes ∼3% of all CRCs (11). The somatic hypermethylation of CpG islands is known as the CpG island methylator phenotype (CIMP). These CIMP tumors comprise the majority of sporadic MSI-H CRCs (12). These CIMP tumors are in contrast to tumors with chromosomal instability (CIN) which follow the more traditional pathway of initial APC mutation causing a tubular adenoma with subsequent accumulated mutations leading to cancer (13).
MSI-H/dMMR is more common among stage II tumors compared with stage III CRCs and relatively uncommon in stage IV (metastatic) CRCs suggesting MSI-H/dMMR tumors are less likely to metastasize. Indeed, MSI-H/dMMR is independently associated with improved survival compared with tumors with proficient MMR (pMMR) (14). In addition, MSI-H/dMMR tumors also have lower recurrence rates compared with pMMR tumors (15). It has also been shown that MSI-H/dMMR tumors do not respond well to 5-FU-based adjuvant chemotherapy (16). Indeed, cells require a competent MMR system for 5-FU to be effective (17). Current recommendations suggest that patients with stage II colon cancer with MSI-H/dMMR should not receive adjuvant 5-FU-based chemotherapy based on this known favorable prognosis and lack of response to therapy.
Unlike 5-FU, oxaliplatin leads to DNA-cross linking and inhibits DNA synthesis and transcription. This damage is not recognized by the MMR system and dMMR tumors should not be resistant to oxaliplatin. The MOSAIC trial revealed improvement in 5-year DFS and 6-year OS for stage III colon cancers with the addition of oxaliplatin to 5-FU regardless of MMR status (18). Ten year follow up of the MOSAIC trial confirmed the benefit of oxaliplatin as adjuvant therapy in stage II/III colon cancers. More recent work has revealed a potential benefit to the addition of oxaliplatin to fluoropyrimidines in adjuvant chemotherapy for MSI-H stage III colon cancer (19).
In addition to standard chemotherapy, additional treatment options exist that may specifically benefit in MSI-H/dMMR patients. As previously discussed, MSI-H/dMMR have a baseline improved clinical course compared to tumors with pMMR. This may be due to their hypermutable phenotype contributing to the production of abnormal peptides that serve as neoantigens, producing specific antitumor immune responses leading to decreased tumor growth and metastasis (20). Sporadic MSI-H CRC have a distinct phenotype that includes right colon predominance, increased prevalence in women and poor differentiation/mucinous histology. MSI-H tumors also exhibit an elevated number of tumor-infiltrating lymphocytes (TILs), supporting this neoantigen hypothesis (21). This baseline local immune control contributes to improved patient survival in .
/fmed. . MSI-H CRC and also sensitizes tumors in these patients to immune checkpoint inhibitors targeting either programmed cell death-1 protein (PD-1) or cytotoxic T-lymphocyte-associated protein 4 (CTLA-4). PD-1 is expressed on T cells, and binding of its ligands (PD-L1 and PD-L2) downregulates T cell effector function. In that context, tumors can escape immune detection by upregulating expression of programmed death ligand 1 (PD-L1) (22). Inhibitors of PD-1 block the receptor from interacting with its ligands, promoting tumor cell killing by effector T cells.
Inhibitors of PD-1, pembrolizumab (Keytruda) and nivolumab (Opdivo), are FDA-approved for patients with mCRC with dMMR or MSI-H and confer a significant survival benefit when used (23,24). An additional target, CTL-4, is transiently expressed on activated T cells with its expression inhibiting the production of cytokines and providing a negative feedback signal to T cells prompting T cell cycle arrest. Inhibition of CTLA-4 may lead to reactivation of T cells allowing them to overcome tumor-induced immune tolerance (25). Ipilimumab (Yervoy) is an anti-CTLA-4 antibody used in metastatic dMMR/MSI-H patients in combination with nivolumab (26). This combination of nivolumab and low-dose ipilimumab produced an objective response rate of 64%, complete response rate of 9%, and disease control rate of 84%, all of which were durable (27). While the results of immune checkpoint blockade in dMMR/MSI-H CRC patients have been encouraging, single agent checkpoint inhibitors are not efficacious in patients with pMMR which makes up the majority of CRC patients (28). In addition, while immune checkpoint inhibitors are approved in mCRC dMMR/MSI-H disease, their utility as adjuvant therapy in localized disease and their efficacy in combination are being explored (29,30). The use of dMMR/MSI-H as a biomarker in determining the need for adjuvant therapy, the type of adjuvant chemotherapy and the addition of an immune checkpoint inhibitor could better optimize the alignment of treatment groups and therapies.
MAPK pathway (Ras-Raf-MEK-ERK)
Gain or loss of function mutations in proteins in the mitogen-activated protein kinase (MAPK) pathway lead to dysregulated proliferative cell signaling ultimately driving tumorigenesis. The first protein to be activated in the pathway is RAS, a commonly mutated protein in CRC (31). In the normal cell, activation of RAS begins with an extracellular ligand binding to a receptor-linked tyrosine kinase like epidermal growth factor receptor (EGFR). This binding activates the tyrosine kinase in the cytoplasmic domain of the receptor causing phosphorylation of EGFR and interaction with RAS. This triggers RAS, a GTPase, to exchange a GDP molecule for GTP, activating the pathway and initiating a kinase cascade leading to the activation of Raf, MAPK/ERK (MEK1 or 2) and ultimately MAPK (32).
RAS (KRAS, NRAS, and HRAS) is the most frequently mutated gene family in cancers with the most common oncogenic mutant of the RAS family being KRAS G12C. KRAS mutations are present in 30-50% of CRC with NRAS mutated in 3-5% and HRAS mutated in <1% (33, 34). KRAS mutations account for up 45% of mCRC and ∼15-37% of early stage tumors (35, 36). Historically, RAS was considered "undruggable" due to its picomolar affinity for GTP/GDP, the absence of identified allosteric regulatory sites, and the necessity of wild type RAS in normal biologic functions. However, small . /fmed. . molecules that specifically inhibit the G12C variant have been identified, making RAS a potential therapeutic target (37). Monoclonal antibodies targeting EGFR, including cetuximab and panitumumab, are routinely used in mCRC. These monoclonal antibodies compete with the endogenous EGFR ligand and after binding, block phosphorylation, leading to internalization and degradation of the receptor. Cetuximab has been approved as a first-line treatment in mCRC patients with wild-type KRAS in combination with chemotherapy (38). Unfortunately, the addition of cetuximab to FOLFOX failed to improve disease-free or overall survival in post-resection stage III colon cancer patients (39). There is emerging evidence of the effectiveness of combining EGFR and KRAS G12C inhibitors in advanced disease. EGFR signaling has been identified as the primary mechanism of resistance to KRAS G12C inhibitors and this combination may overcome this resistance (40). The combination of anti-EGFR and KRAS G12C inhibitors is effective in cell lines, patient-derived organoids, and xenografts (41).
One downstream effector target of RAS is the RAF family, made up of c-RAF1, BRAF, and ARAF. Of these, BRAF is the most frequently mutated in tumors (42). Outside the constitutive activation of RAS, mutations in codon 600 of the BRAF gene produce RAS-independent activation of the MAPK pathway, leading to increased cell proliferation and survival. Sporadic MSI CRCs often show increased co-occurrence of BRAFV600E mutations compared to CRCs overall (43). These somatic BRAFV600E mutations increase BRAF/MEK/ERK signaling leading to the CIMP which silences MLH1, ultimately resulting in dMMR. The presence of a BRAF mutation indicates a sporadic MSI tumor and virtually excludes the diagnosis of Lynch syndrome (44). Patients with BRAF mutations experience poorer survival compared to patients with wild-type BRAF (45). BRAF mutations are associated with more right-sided primary tumors and with an increased risk of metastasis to the peritoneum and distant lymph nodes (46). BRAF and KRAS mutations are not coincident in tumors, and many KRAS wild type mCRC have BRAF mutations. These mutations identify tumors that are unresponsive to anti-EGFR therapies when combined with chemotherapy (47).
BRAF inhibitors are used extensively in BRAFV600E melanomas with positive treatment results (48). While BRAF inhibitor monotherapy in BRAFV600 melanoma leads to response rates of >50%, only ∼5% of BRAFV600 CRC patients respond (49). Since EGFR mediates resistance to BRAF inhibitors, the differing expression of EGFR in CRC, compared to melanoma, may explain this difference in response rates. In CRC, BRAF inhibition leads to feedback activation of EGFR which increases proliferation even in the presence of BRAFV600 inhibition (50). In contrast, simultaneous blockade of EGFR and BRAF produced synergistic inhibition of tumor growth in murine CRC models through enhanced MAPK suppression (51). Dual treatment with EGFR and BRAF inhibitors in previously-treated patients with BRAF V600E mCRC improved overall survival and progression-free survival compared to standard chemotherapy (52). Moreover, triple therapy inhibiting BRAF, EGFR, and MEK is effective against BRAFV600 tumors (53, 54). HER HER2 (human epidermal growth factor receptor 2) is a transmembrane receptor that acts as an intracellular tyrosine kinase. Homo-or heterodimerization of HER2 with an additional member of the EGFR family (EGFR/HER2/ERBB) leads to the activation of either the RAS-RAF-ERK or PI3K-PTEN-AKT pathway leading to increased cellular proliferation. The amplification of the HER2 gene or overexpression of the HER2 protein has been targeted in solid tumor malignancies other than CRC. While therapies that block HER2 (trastuzumab, lapatinib, and pertuzumab) have gained prominence in treating patients with HER2-overexpressing tumors in these other malignancies, there are no HER-2-directed therapies approved by the FDA to treat CRC.
Preclinical work initially showed that HER2-amplified tumors were responsive to dual HER2-directed therapies, but not individual agents alone. Using this information, a phase 2 trial examining dual HER2 therapy comprising a tyrosine kinase inhibitor and anti-HER2 monoclonal antibody in KRAS wild-type, HER2-positive mCRC patients demonstrated that 30% of patients had objective responses and 44% had stable disease (55). A phase 2 trial of trastuzumab deruxtecan, a HER2-targeted antibody-drug conjugate, in patients who had previously progressed on at least two previous treatment regimens, showed an objective response rate of 45.3% (56). In quadruple WT populations (KRAS, NRAS, BRAF, and PIK3CA WT) treated with anti-EGFR therapies, the HER2 pathway may function as a bypass leading to resistance to anti-EGFR agents (57) (Figure 1). Indeed, HER2 expression predicts unresponsiveness to EGFR-targeted therapies in mCRC (58).
In addition to predicting response to HER2 and EGFR directed therapies, HER2 expression could help identify which patients may have a benefit from adjuvant chemotherapy. One study showed that among HER2 high patients, those who received chemotherapy had better OS and DFS than chemotherapy naïve patients. They showed no difference in outcomes among chemo-treated and chemo-naïve patients in the HER2 low group (59). This implies HER2 expression in CRC can be used as a direct target as well as a biomarker of resistance, and even eventually a guide in chemotherapy.
APC
In most CRCs Wnt/β-catenin signaling is activated by loss-of-function mutations in the adenomatous polyposis coli .
/fmed. . (APC) gene. The β-catenin-dependent Wnt signaling pathway is initiated by the binding of secreted cysteine-rich Wnt glycoproteins to LRP5/6 receptors and FZD receptors. The secretion of Wnt ligands depends on acylation by Porcupine (PORCN) (60). Binding of the Wnt ligands to LRP5/6 and FZD receptors on the cell surface induces disheveled (DVL) which leads to suppression of glycogen synthase kinase 3β (GSK3β). Together GSK3β, axin, and casein kinase 1 (CK1a) form a destruction complex which is stabilized by APC and phosphorylates β-catenin, priming it for degradation by the ubiquitin-proteosome pathway. In the presence of Wnt, and suppression of GSK3β, un-phosphorylated β-catenin accumulates in the cytosol, translocates to the nucleus, and interacts with TCF/LEF transcription factors to trigger expression of Wnt targets like c-Myc, cyclin D1, and CDKN1A (61). Inactivating mutations of APC de-stabilize the destruction complex, leading to activation of the Wnt signaling pathway which drives tumorigenesis. While dysregulation of the Wnt/β-catenin signaling pathway is common in CRCs, this pathway lacks druggable molecular targets. Tankyrases (TNKSs) are members of poly-ADP-ribose polymerases (PARPs) family that poly-ADP-ribosylate and downregulate axins resulting in an overexpression of β-catenin. Tankyrase inhibitors (TNKSi) have been developed as potential therapeutic agents in CRC (62). APC may effect response to tankyrase inhibitors. It has been shown that drug-sensitive CRC cells had truncated forms of APC that lacked all seven β-cateninbinding 20-amino acid repeats (AARs) resulting in cell response to TNKSi. Conversely, drug-resistant CRC cells had longer forms of APCs with two of more 20AARs (63). Identification of APC status could be prognostic in determining potential response to TNKSi.
CEA
Carcinoembryonic antigen (CEA) is a cell adhesion molecule that is elevated in the serum of patients with a variety of cancers, including CRC. CEA levels have been used postoperatively in surveillance and higher preoperative CEA levels have been shown to be an independent predictor of both overall and disease-free survival rates. In addition, patients with node-negative colon cancer but elevated preoperative CEA levels have a poor prognosis similar to those with node-positive
NTRK
Neurotrophic tyrosine receptor kinase (NTRK) gene fusions are extremely rare in CRC occurring in less than 1% of tumors (66). However, they are more frequently found in patients with dMMR (67). The FDA has approved two tropomyisin receptor kinase (TRK) inhibitors, entrectinib, and larotrectinib, for use in patients with NTRK fusion-bearing cancers in either a worsening metastatic setting or locally advanced unresectable tumors (68). This is an example of tissue agnostic treatments that can be used in any solid tumor, not just CRC.
Consensus molecular subtypes
An additional method of categorizing CRCs that may help guide treatment decisions are the Consensus Molecule Subtypes (CMS). CMS1 or MSI immune tumors account for 14% of CRCs. They have a high rate of mutations, with frequent BRAF mutations, and sizeable immune infiltration. The majority of MSI tumors fall in this category and, as previously discussed, these tumors are responsive to immune checkpoint inhibitors. In addition, the BRAFV600E mutation predisposes resistance to treatment with anti-EGFR agents. CMS2 or canonical tumors make up 37% of tumors and have upregulated Wnt/Myc signaling. These tumors stem from the canonical adenomato-carcinoma sequence typified by the initial loss of APC, a following activating mutation in KRAS, and an ultimate loss of TP53. CMS3 or metabolic tumors comprise 13% of cases and have frequent KRAS mutations and dysregulation of cancer metabolic pathways. As discussed previously, KRAS mutation may indicate a poor response to anti-EGFR therapy. CMS4 or mesenchymal tumors form 23% of cases and are characterized by transforming growth factor beta (TGFβ) pathway activation, enhanced angiogenesis, stromal activation and inflammatory infiltrates (69).
These four molecular subtypes can be broadly divided into "hot" and "cold" CRCs based on immune infiltration. The high immune infiltration of CMS1/MSI-H tumors has been discussed, as well as their responsiveness to treatment with immune checkpoint inhibitors. While CMS4 tumors also have increased immune cell infiltrates, responses to immunotherapy may be altered by TGFβ signaling. In comparison to the antitumor immune environment of CMS1 tumors, the CMS4 tumor microenvironment is pro-inflammatory (70). Indeed, TGFβ may be immunosuppressive and drive immune evasion in CRC (71). Alternatively, CMS2 and CMS3 tumors are "cold" tumors reflecting low immune cell infiltrates. CMS2 and CMS3 tumors may respond to alternative immunogenic stimuli, like vaccines or co-stimulatory compounds, but do not respond to immune checkpoint inhibitors. CMS2 and CMS3 tumors also respond to anti-VEGF agents (72). CMS classification has the potential to provide prognostic information, since CMS2 and CMS3 tumors have a better prognosis than CMS1 and CMS4. One study examining CMS status among stage II CRC found adjuvant chemotherapy had no benefit in CMS1 subtype tumors, and a significant decrease in DFS for CMS4 tumors (73). In contrast, stage II and III patients with either the CMS2 or CMS3 have benefit from adjuvant therapy (74). While not currently used in clinical practice CMS subtypes may eventually help guide targeted and chemotherapy decisions.
Circulating tumor cells (CTCs) and circulating tumor DNA (ctDNA)
The concept of a "liquid biopsy" for solid tumors has recently emerged, reflecting sampling convenience and its ability to capture the varying molecular markers of a solid tumor. Liquid biopsies have multiple advantages over tissue biopsies, such as assessing molecularly divergent metastatic lesions, capturing the heterogeneity of a tumor, and evaluating potential resistance mutations in real time as treatment progresses. Circulating tumor cells (CTCs) are individual, or clusters of, cancer cells circulating in the bloodstream resulting from passive shedding or intravasation from the primary lesion or metastases (75). The amount of detectable CTCs detected is associated with treatment outcomes and overall survival (76). In contrast to CTCs, cellfree circulating tumor DNA (ctDNA) comprises somatic and epigenetic DNA alterations from tumor cells released into bloodstream following apoptosis or necrosis. ctDNA is more abundant within the bloodstream than CTCs but both can be detected and interrogated for actionable treatment targets and emergent resistant sub-clones, therefore assisting in treatment decisions before and after initiation of therapy.
There is an established relationship between ctDNA and tumor burden, with ctDNA positivity increasing with CRC stage (77). In this sense, ctDNA could identify high risk early stage patients. In addition, as discussed earlier, there are several biomarkers that can predict prognosis or treatment response in CRC such as MSI-H/dMMR (susceptibility to immune checkpoint inhibitors) as well as KRAS/BRAF (anti-EGFR resistance). A study interrogating the emergence of mutated KRAS alleles in ctDNA during anti-EGFR therapy revealed that these alleles decline when treatment is suspended, demonstrating that liquid biopsies can be used to track treatment resistance (78). The ability to accurately capture these .
/fmed. . markers prior to the initiation treatment could help tailor therapeutic planning. Furthermore, the ability to track these markers during treatment could both ensure treatment response and monitor for developing resistance.
Currently, there is controversy as to what proportion of stage II CRC patients should receive adjuvant therapy. While some high risk characteristics have been suggested, these are not validated and there is no consensus (79). In stage II CRC, post-operative patients who were positive for ctDNA were at extremely high risk for recurrence when not treated with adjuvant chemotherapy (80,81). A study surveying ctDNA status in patients after curative-intent surgery revealed that 100% of patients with ctDNA detected after treatment completion ultimately recurred (82). In patients with resectable colorectal liver metastases, patients with ctDNA detected after surgery had a significantly poorer relapse-free survival and overall survival. In addition, all patients with persistently detectable ctDNA after adjuvant chemotherapy recurred (83). A study in stage I-III patients revealed that in the majority, ctDNA identified relapse after definitive treatment. The same study also showed that ctDNA status was independently associated with relapse after adjusting for other clinicopathologic risk factors (84). ctDNA could potentially be used as an adjunct to the traditional TNM staging and other potential prognostic markers in determining which patients receive adjuvant therapy.
Summary
Despite improvements in screening and surgical interventions, CRC has remained the second most common cause of cancer-related death in the United States. While it has an overall favorable relative survival 5 year survival of 65%, inadequacies in treatments are revealed when stage by stage prognosis is examined (2). The 5-year overall survival for stage I disease (small, no lymph node spread) is 92% compared to 11% in stage IV (metastatic) (3). Approximately 35% of patients have metastatic disease at initial presentation with 20-50% of stage II and stage III patients eventually progressing to metastatic disease (4). These survival statistics illuminate multiple areas for improvement in the treatment of CRC. The high recurrence rates among patients who present with localized disease indicates missed opportunities for curative treatment in some patient populations. Currently, adjuvant therapy is consistently given to patients with stage III disease (positive lymph nodes) with some controversy in stage II disease. Again, the high recurrence rates among this population suggest there could be additional benefit from adjuvant treatment.
Further, much like innovations in targeted therapy, strides have been made in novel sampling techniques. ctDNA in the blood of CRC patients reflects the entire tumor genome.
Increasing levels of ctDNA have been shown to be correlated with worse survival showing ctDNA could potentially be included in staging algorithms (85). In addition to sampling at diagnosis in order to stage and determine molecular markers, ctDNA levels and mutation expression can be followed to monitor for recurrence or emerging treatment resistance. While CMS subtypes currently are not recommended for use in clinical practice, this may change as a greater understanding of their biology emerges.
Author contributions
Review of relevant papers and manuscript preparation: MC and SW. All authors reviewed the results and approved the final version of the manuscript.
Conflict of interest
SW is the Chair of the Scientific Advisory Board and member of the Board of Directors of Targeted Diagnostics & Therapeutics, Inc. which provided research funding that, in part, supported this work and has a license to commercialize inventions related to this work.
The remaining author declares that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.
Publisher's note
All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.
|
v2
|
2022-11-30T15:11:07.333Z
|
2022-11-30T00:00:00.000Z
|
254072362
|
s2orc/train
|
Laparoscopic gastric dissociation using a two-port approach in minimally invasive esophagectomy
Background A new approach for laparoscopic gastric dissociation in minimally invasive esophagectomy (MIE) was attempted. This study aimed to evaluate the short-term outcomes, safety, and efficacy of two-port laparoscopy using the McKeown procedure. Methods This retrospective study included 206 consecutive patients with esophageal cancer who underwent a modified two-port laparoscopic or the traditional five-port McKeown procedure at our institution from August 2019 to August 2021. Surgical outcomes of the two methods were compared. Results Of the 206 patients, 106 (51.46%) underwent the modified two-port procedure, whereas 100 (48.54%) underwent the traditional five-port procedure. Subsequently, 182 propensity score-matched patients were compared. No significant differences were observed in laparoscopic operative time, blood loss during laparoscopic surgery, number of dissected lymph nodes, and pain score on postoperative day 1 between the two groups. The rate of complication and postoperative length of hospital stay did not differ significantly between the two groups. The total hospitalization cost also did not differ significantly between the two groups (p = 0.325). No postoperative deaths occurred in either group. Conclusions Our findings demonstrate that laparoscopic gastric dissociation using the two-port approach in MIE is a safe and effective procedure, with short-term outcomes comparable to those of the traditional five-port procedure in patients with esophageal cancer. Larger studies with longer follow-up duration are warranted.
Introduction
Esophageal cancer is a common gastrointestinal malignancy, with surgery as the primary treatment option. With the promotion of minimally invasive technology and concept of enhanced recovery after surgery (ERAS), minimally invasive esophagectomy (MIE) has become increasingly popular because of several advantages, such as reduced trauma, rapid recovery, few postoperative pulmonary complications, and improved esthetic appearance [1][2][3][4]. In MIE, the traditional five-port procedure is routinely used for laparoscopic gastric dissociation, which can be facilitated by the assistance and exposure provided by surgical assistants. However, there are several abdominal incisions, and various complications, such as operative scar formation, incision bleeding, hernia formation of the puncture hole, and incision infection, often develop [5][6][7].
Open Access
With the continuous pursuit of extremely minimally invasive techniques by surgeons, single-and reducedport laparoscopic techniques have been developed in the fields of cholecystectomy and appendectomy as well as in gastric benign disease treatment and radical resection of gastric cancer, resulting in smaller abdominal incisions and improved esthetic appearance [8][9][10]. However, surgery for esophageal cancer is relatively more complex and includes gastric dissociation, tubular stomach construction, and esophagogastric anastomosis. To the best of our knowledge, no study to date has evaluated its feasibility in MIE. Therefore, in this study, we retrospectively analyzed the clinical data of 206 consecutive patients with esophageal cancer who were treated with MIE by the same operator to evaluate the short-term outcomes, safety, and feasibility of laparoscopic gastric dissociation using the two-port approach in MIE (i.e., modified twoport McKeown procedure) compared with the traditional five-port procedure. We also preliminarily summarized the technical experience.
Patients
The inclusion criteria were as follows: (1) esophageal squamous cell carcinoma confirmed via preoperative endoscopic histopathological examination, (2) modified two-port laparoscopic or traditional five-port McKeown procedure on the abdomen, (3) preoperative clinical staging of esophageal cancer of cT 1-3 N 0-3 M 0 (8th edition of the American Joint Committee for Esophageal Cancer Staging Manual), (4) American Society of Anesthesiologists rating of I-III, (5) ability to tolerate surgery based on the preoperative cardiopulmonary function examination, and (6) availability of complete clinical data.
According to the abovementioned criteria, 206 consecutive patients with esophageal cancer underwent the modified two-port laparoscopic or traditional fiveport McKeown surgery at the First Affiliated Hospital of Anhui Medical University from August 2019 to August 2021. Patient data on baseline characteristics and outcomes were retrospectively collected. The surgical procedure was based on patient's preference in all cases. All surgeries were performed by the same medical team, comprising surgeons experienced in performing more than 800 MIEs. This study was reviewed and approved by the Ethics Committee of the First Affiliated Hospital of Anhui Medical University (Quick-PJ 2022-06-16).
Surgical procedure
Preparation and establishment of the operating platform: Single-lumen endotracheal intubation anesthesia (left lateral position first) with artificial pneumothorax (pressure, 3 mmHg; flow, 3 L/min) was established. Four-port thoracoscopy was used for thoracic esophageal and mediastinal lymph node dissection. After the thoracoscopic phase, the patient was placed in the supine position with the head high and feet low by 30° and was tilted 20° to the right side so that the greater omentum and intestine are moved to the right lower abdomen, exposing the operative field of the abdominal cavity. In the modified McKeown group, the surgeon and first assistant stood on the right and left side of the patient, respectively. A 5-cm incision was made along the anterior edge of the left neck sternocleidomastoid muscle, and the esophagus was dissociated and cut off. An appropriately-sized circular stapler anvil was placed at the proximal end, and the distal end was sutured and connected to a sterilized gastric tube for traction. A small 4-cm incision was made in the middle of the upper abdomen 2 cm below the xiphoid process (indicating laparoscopic operative start time). After penetrating the abdominal cavity layer by layer, a disposable multichannel single-hole laparoscopic trocar (IA-3A-70 × 150; Schneider Xiamen Medical Instrument Co., Ltd.) was placed. Three puncture channels (12 mm × 1, 5 mm × 2) were arranged on the airtight cover of the multichannel single-hole puncture device. First, a 12-mm trocar was placed on the airtight cover to establish a pneumoperitoneum, and intra-abdominal pressure was maintained at 15 mmHg. After the establishment of a satisfactory pneumoperitoneum, the abdominal cavity was assessed for metastasis and adhesion via endoscopy, and a 12-mm trocar was placed 3 cm to the left of the umbilicus as an endoscopic observation hole. Subsequently, two 5-mm trocars were placed on the airtight cover, and the operating platform was established ( Fig. 1A-C).
Laparoscopic surgical procedures: Conventional laparoscopic instruments were used, and the assistant used intestinal forceps to block the liver to the cephalic side for exposing the lesser omental sac. The surgeon separated the lesser omental sac to the right side of the cardia using an ultrasonic knife. Lymph nodes in groups 17, 18, and 20 were dissected along the common hepatic artery, left gastric artery, and celiac trunk in the posterior pancreatic space (the American Joint Committee on Cancer/Union for International Cancer Control esophageal cancer staging system, 8th edition) [11]. The left gastric artery and vein were dissected using an ultrasonic knife after double ligation with Hem-o-lok ligature clips at the root. The right gastro-omental artery was located, and the gastrocolonal ligament was separated using an ultrasonic knife. The free greater omentum was located in the direction of spleen and approximately 1 cm away from the right gastro-omental artery. A wet gauze with intestinal forceps was used to lift the fundus of the stomach upward to fully expose the short gastric and posterior gastric vessels, and a vascular clamp was used with an ultrasonic knife to disconnect the vessels. The fibrous connective tissue around the cardia and lower esophagus were separated using an ultrasonic knife so that the abdominal and chest cavities were completely connected at the diaphragmatic hiatus. The esophagus was dragged from the diaphragmatic hiatus to the abdominal cavity under laparoscopic vision. Gas flow into the abdominal cavity was stopped, following which the puncture outfit vent was opened, abdominal residual gas was slowly released, and airtight cover was removed (indicating laparoscopic operative end time). Through the small incision in the epigastric abdomen, the esophagus and stomach were raised extraperitoneally, and a tubular stomach was constructed. Subsequently, the tubular stomach was lifted from the mediastinal esophageal bed to the neck and anastomosed with the proximal esophagus. The airtight cover was used again to establish a pneumoperitoneum. The abdominal cavity was assessed for active bleeding using laparoscopy, and the surgery was ended ( Fig. 1D-F).
For five-port laparoscopy, a similar preparation maneuver was used. The puncture point was made at 1 cm above the umbilicus, and an artificial pneumoperitoneum was established. For laparoscopic surgery, the incisions of the five ports were made as follows. A 12-mm incision was made exteriorly at 1 cm above the umbilicus and used as the laparoscopic port; further, 12-mm and 5-mm incisions were made at 3 cm away from the paraumbilical region and used as the main operative ports. Next, a 5-mm incision below the right costal margin and another 5-mm incision under the xiphoid process were made and used as the assisting ports. Mobilization of the stomach and abdominal lymphadenectomy were performed using traditional laparoscopic methods. Subsequently, a 4-cm subxiphoid vertical incision was made based on the original auxiliary port, through which the stomach was pulled out. Finally, a tubular stomach was constructed, and esophagogastric anastomosis was performed proximal to the esophagus.
Postoperative care
After surgery, intravenous nutritional support was provided based on body weight. Following the resumption of defecation, the patient's family or nursing workers was instructed to provide liquid diet through the indwelling nasointestinal tube and to appropriately reduce the amount of intravenous fluid. Chest radiography and routine blood examination results were reviewed on postoperative days 1 and 2. In the absence of any complications, defined as a drainage volume of < 200 mL for 3 consecutive days and no air leakage, the drainage tube was removed on postoperative day 4 and the patient was discharged with a nasointestinal tube on the following day. Upper gastrointestinal radiography using water-soluble iodine-based contrast agent was performed approximately 2 weeks after the surgery, and the nasointestinal tube was removed after confirming the absence of contrast-enhanced external fistula. The patient was then instructed to resume oral feeding.
Study outcomes
The primary study endpoint was the number of dissected celiac lymph nodes. The operative time was defined as the time from making the abdominal skin incision to the removal of the airtight cover. Morbidities were defined as complications requiring extended hospital stay or readmission. Postoperative complications included those occurring during the initial 30 days after surgery.
Statistical analysis
To minimize the effect of basic clinical data on the outcomes of the two sets, we used one-to-one propensity score matching (PSM) analysis, and the absolute normalized mean difference of the variables after matching using a caliper of 0.05 can be considered to indicate matching equilibrium. Variables included age, sex, BMI, and tumor location. The SPSS 22.0 (IBM, Armonk, New York) software was used for PSM and statistical analyses. Continuous and categorical data were compared using the two-tailed t-test and χ 2 test, respectively. A p-value of < 0.05 was considered statistically significant.
Results
A total of 206 patients successfully underwent the modified two-port or traditional five-port McKeown procedure for esophageal cancer between August 2019 and August 2021 in our institution. The clinicopathologic features of the patients in both groups are presented in Table 1. Using PSM, 182 patients were included for comparison. Owing to extensive abdominal adhesion, two cases in the traditional five-port group were converted to open surgery, whereas in the modified two-port group, only one case added with a 12-mm auxiliary port in the right paraumbilical region. As shown in Table 2, the total operative time was 230.44 ± 46.31 and 237.74 ± 45.46 min in the modified two-port and traditional five-port groups, respectively (p = 0.285). Meanwhile, the laparoscopic operative time was 48.40 ± 13.33 and 45.75 ± 10.65 min, respectively (p = 0.140). Blood loss during laparoscopic surgery in the modified two-port group was comparable to that in the traditional five-port group (16.87 ± 18.93 vs. 15.88 ± 17.62 mL, p = 0.716). There was no significant difference in the median number of dissected celiac lymph nodes between the modified two-port and traditional five-port groups (7.69 ± 3.37 vs. 8.56 ± 6.54; p = 0.262), and the number of positive celiac lymph nodes was 0.36 ± 1.01 and 0.64 ± 1.32, respectively (p = 0.116). Although the histologic tumor type differed significantly between the two groups, it was not associated with the number of dissected celiac lymph nodes (p = 0.015).
Complication rates of the patients in the modified two-port and traditional five-port groups did not differ significantly (13.2% vs. 18.7%, p = 0.563). The most common complication in the modified two-port group was pulmonary inflammation (8 patients), followed by anastomotic leakage (3 patients). A similar result was noted in the traditional five-port group. The postoperative length of hospital stay was 10.21 ± 4.23 and 10.22 ± 4.24 days for the modified two-port and traditional five-port groups, respectively (p = 0.986). More importantly, the total hospitalization cost did not differ significantly between the modified two-port and traditional five-port groups (58,371.2 ± 3213.6 vs. 57,896.5 ± 4234.3 yuan, p = 0.325). The pain scores on postoperative days 1, 3, and 5 were comparable between the two groups (p = 0.685, 0.366, and 0.786, respectively) ( Table 3). No patients developed postoperative incisional hernias, and no perioperative deaths occurred in either group.
Discussion
With the continuous promotion and popularization of thoracoscopy, thoracic surgeons continue to make breakthroughs based on previous surgical techniques, and incisions are becoming smaller. In particular, the previous four-port surgery in lung resection has gradually transitioned to three-, two-, and single-port surgery, which is currently widely performed [12]. A multicenter open-label randomized controlled trial reported a lower incidence of postoperative short-term pulmonary infections, shorter hospital stay, and better short-term quality of life in patients undergoing MIE than in those undergoing open esophagectomy [13]. Breakthroughs in MIE to further reduce operative scar formation and surgical trauma under the premise of radical treatment of esophageal tumors are needed in thoracic surgery.
Recently, an increasing number of general surgeons have successfully completed cholecystectomy, appendectomy, radical resection of colon cancer, and even radical resection of gastric cancer with a 3-4-cm incision at the lower umbilical margin, thus resulting in reduced trauma and pain, rapid recovery, and improved esthetic appearance [14,15]. However, because the laparoscope and operator's instruments entering the abdominal cavity through a single-hole puncture device, the operator's manipulation may cause the endoscope to shake, resulting in unstable screen display; therefore, the laparoscopic assistant should firmly support the endoscope with both hands, keep the lens stable, flexibly adjust the lens angle, avoid the operator's instruments, prevent collisions, keep the operator's instruments located in front of the endoscope, avoid frequent lens swing, and minimize the operator's dizziness and eye fatigue. The laparoscopic assistant should be familiar with the surgical steps and have long-term experience in cooperating with the surgeon. To avoid obstruction of the visual field by the liver, purse suture is often used to lift the liver lobes and fix them in vitro, thus providing good exposure for dissociating the stomach and dissecting abdominal lymph nodes.
In common MIE abdominal procedures, a 4-cm incision is made in the middle epigastrium of the subxiphoid to remove the esophageal tumor, construct a tubular stomach, and guide the placement of the nasointestinal tube. Therefore, in this study, considering the relevant experience of the general surgeon and characteristics of esophageal surgery in the thoracic cavity, we attempted to take maximum advantage of the small incision and made all operation ports, except the endoscopic observation ports, through the small incision. Previously, the endoscopic observation port was usually placed at the lower margin of the umbilicus; however, in the modified "two-port method, " the observation port was selected at 3 cm to the left of the umbilicus, which could avoid interference from the endoscope and operating instrument; simultaneously, the ultrasonic knife could be inserted into the observation port to dissect the short gastric vessels more conveniently. Moreover, if necessary, a latex drainage tube can be placed using the observation port. Ultimately, PSM to compare the short-term outcomes of the 182 patients revealed no significant differences in the laparoscopic operative time, blood loss during laparoscopic surgery, number of dissected lymph nodes, and pain score on postoperative day 1 between the two groups. The complication rate, postoperative length of hospital stay, and, more importantly, the total hospitalization cost did not differ significantly between the two groups. Moreover, no postoperative deaths occurred in either group.
Some advantages of this approach should not be overlooked. During abdominal surgery, we first established a small incision in the epigastric abdomen, which can determine the presence of adhesion in the abdominal cavity under direct vision; subsequently, a disposable multichannel single-port laparoscopic puncture device was placed to establish the pneumoperitoneum, thereby avoiding the risk of intestinal injury and bleeding caused by a pneumatic needle or direct penetration of the puncture. Simultaneously, the operation can be immediately converted to open surgery. Although the position of the three puncture ports on the airtight cover is relatively fixed, we can rotate the airtight cover according to the needs of the operation and adjust the relative position of each puncture port to facilitate the operation. Additionally, the instrument and lens can be freely moved between the two ports depending on the surgical area and operative requirements, thus reducing the difficulty associated with the surgery. During the surgery, we selected a disposable multichannel singlehole laparoscopic puncture device with a diameter of 7 cm, which was slightly larger than the abdominal incision of 4 cm, causing difficulty in removing the puncture device through the surgical incision. This led to the establishment of a more reliable pneumoperitoneum and expansion of the operating space for surgery. After completing the laparoscopic surgery, the airtight cover was removed and the esophageal tumor and stomach were dragged out under the protection and along the extension of the incision via a laparoscopic puncture instrument, thereby avoiding the possibility of abdominal incision implantation of the tumor. This makes it easier to release the adhesion connective tissue around the pylorus and place the prepared tubular stomach into the abdominal cavity. When the surgery was completed, the airtight cover was applied again to rapidly establish a pneumoperitoneum, and the abdominal cavity was examined for active bleeding via laparoscopy.
The modified two-port McKeown procedure for esophageal cancer may exhibit a certain degree of difficulty during the initial application. We optimized the surgical ideas and methods according to our own experience in the following manner: (1) the previously used operation sequence involved the abdomen followed by the neck; we adjusted this sequence by disconnecting the esophagus in the neck and then performing abdominal surgery. In this way, the lower esophagus and cardia can be fully dissociated after abdominal dissociation of the stomach as well as when the short gastric or posterior gastric vessels are obstructed. Thus, dragging the lower esophagus into the abdominal cavity and then treating the blood vessels from the rear side can greatly reduce the difficulty associated with surgery and risk of bleeding. (2) Instead of the entire palm, the right middle and index fingers were used to guide the nasointestinal tube through the small abdominal incision.
The following problems should also be noted: first, patients should be carefully selected in the early stage of the technology. It is recommended to select patients with no history of abdominal surgery, slim build, and long epigastric length to reduce the difficulty and risk of surgery. Second, in case of difficulties, laparotomy should be performed as soon as possible or an operative port should be added. The quality and time of surgery should not be neglected to complete the procedure. During our procedure, a 12-mm auxiliary port was added to the right side of the umbilicus in one patient because of extensive adhesion in the abdominal cavity after previous open cholecystectomy. For patients with obesity or severe adhesions around the pylorus, a small incision in the abdomen can be appropriately extended to 5 cm to achieve direct vision for separating the remaining parts, which is convenient for exposure, preventing injury to the right gastro-omental artery, and adequately releasing the adhesions.
However, our study has some limitations. First, this was a retrospective study involving only one surgeon, and no randomized approach was used for the selection of patients in both groups. In addition, according to the Clavien-Dindo complication grading system, both groups were classified as grade I and could not be studied further [16]. Therefore, the study findings cannot be generalized to large populations or other centers. Second, although we utilized PSM to minimize the effects of confounding factors, the predominant histologic tumor type was squamous cell carcinoma. Finally, owing to the relatively short study duration, complete data on long-term survival and recurrence were not available. Therefore, further prospective and multicenter clinical studies are warranted to clarify these aspects.
In summary, this study revealed that the modified "two-port method" in MIE exhibits good operability and safety in lymph node dissection and gastric dissociation, and surgical trauma is reduced following the principle of tumor-free operation and standard lymph node dissection. Currently, single-port and reduced-port laparoscopy is the most popular minimally invasive technology, which not only indicates the origin and innovation of the traditional five-port laparoscopic technology but also represents the direction of the development of precision minimally invasive technology. Moreover, single-port and reduced-port laparoscopic techniques meet the development needs of the contemporary concept of ERAS. Considering the lower invasiveness and better cosmetic outcomes of the modified two-port method, this approach is expected to be the next step in reduced-port laparoscopy.
Learn more biomedcentral.com/submissions
Ready to submit your research Ready to submit your research ? Choose BMC and benefit from: ? Choose BMC and benefit from:
|
v2
|
2022-12-01T06:17:53.459Z
|
2022-11-30T00:00:00.000Z
|
254094794
|
s2ag/train
|
Nurse and pharmacist systemic anti-cancer therapy review clinics and their impact on patient experience and care: A systematic review.
AIM
To review the evidence of how nurse and pharmacist roles have been incorporated into the management of patients undergoing systemic anti-cancer therapy (SACT) services and their impact on patient experience and care provision.
DESIGN
Systematic Review.
DATA SOURCES
Seven databases were searched on 10 April 2022.
REVIEW METHODS
Research studies that met defined inclusion criteria were included. Quantitative findings were converted into textual descriptions and combined with qualitative results for thematic analysis. Data were categorized and aggregated into themes. Heterogeneity of studies meant meta-analysis was not possible.
RESULTS
Fifteen papers were included. Three main themes were identified: advanced clinical practice (ACP) SACT service development; ACP skills and qualifications; and the impact of ACP SACT services on patient care and outcomes. There is a variation in tasks undertaken by nurses and pharmacists and role integration is restricted by limited physician engagement. Role titles used and skills and qualifications acquired differ and professional autonomy is variable. Qualitative studies were limited.
CONCLUSION
Evidence of how nursing and pharmacist ACP roles are implemented, what skills are essential and how roles are impacting patient experience and outcomes is limited. More research is required to explore patient and physician experience of, and satisfaction with multi-professional care, alongside further evaluation of clinical delivery models.
|
v2
|
2022-12-01T06:17:53.805Z
|
2022-11-30T00:00:00.000Z
|
254095481
|
s2ag/train
|
Exosomal circNFIX promotes angiogenesis in ovarian cancer via miR-518a-3p/TRIM44 axis.
Ovarian cancer (OC) is a gynecological cancer with high mortality. OC-derived exosomal circRNAs can regulate angiogenesis. This study aims to explore the role and mechanism of exosomal circRNA nuclear factor I X (CircNFIX) derived from OC cells in angiogenesis. Quantitative real-time polymerase chain reaction was employed to evaluate the levels of circNFIX, miR-518a-3p, and tripartite motif protein 44 (TRIM44) in OC and adjacent tissues. Exosomes from the ovarian surface epithelial cell (HOSEpiC) and OC cells (SKOV3 or OVCAR3) were isolated by differential centrifugation. Exosomes were cocultured with the human umbilical vein endothelial cells (HUVECs). The angiogenesis capacity was analyzed by Tube formation assay. 3-(4,5-dimethyl-2-thiazolyl)-2,5-diphenyl-2-H-tetrazolium bromide (MTT) and Transwell assays were used to determine the cell viability and migration ability. The dual-luciferase report, RNA immunoprecipitation (RIP), and RNA pull-down assays were applied to validate the gene's interaction. CircNFIX and TRIM44 expression were higher and miR-518a-3p was lower in OC tissues than in the adjacent tissues. Upregulated circNFIX and TRIM44 were significantly correlated with the tumor size and International Federation of Gynecology and Obstetrics (FIGO) stage of OC patients. HUVECs treated OC-derived exosomes had higher proliferation, migration, and angiogenesis capacities than the control group. While OC-derived exosomal circNFIX silencing restrained HUVECs' proliferation, migration, and angiogenesis, compared with the OC-derived exosomes group. OC-derived exosomal circNFIX positively regulated TRIM44 expression by targeting miR-518a-3p in HUVECs. OC-derived exosomal circNFIX promoted angiogenesis by regulating the Janus-activated kinase/signal transducer and activator of transcription 1 (JAK/STAT1) pathway via miR-518a-3p/TRIM44 axis in HUVECs.
|
v2
|
2022-12-01T06:17:54.284Z
|
2022-11-30T00:00:00.000Z
|
254095690
|
s2ag/train
|
Comparison of Lobectomy vs Total Thyroidectomy for Intermediate-Risk Papillary Thyroid Carcinoma With Lymph Node Metastasis.
Importance
Surgical treatment of patients with papillary thyroid cancer (PTC) by either lobectomy or total thyroidectomy (TT) has long been a topic of debate, especially for patients with intermediate-risk PTC.
Objective
To compare recurrence-free survival (RFS) for patients with PTC and lymph node metastasis after lobectomy vs TT.
Design, Setting, and Participants
This retrospective cohort study included a review of patients with PTC treated from January 1, 2000, to December 31, 2017. Propensity score matching (PSM) was performed between patients treated with lobectomy and TT. This study involved a single institute in a cancer referral center. Enrolled were adult patients (aged 18-75 years) with unilateral PTC and ipsilateral clinical lateral neck metastasis (cN1b). Patients with the following characteristics were excluded: a lymph node yield less than 20, primary tumor size greater than 4 cm, gross extrathyroidal extension, metastatic lymph node size greater than 3 cm, and distant metastasis. Data analysis was performed from April 1 to April 30, 2022.
Exposures
Lobectomy and TT.
Main Outcomes and Measures
The primary outcome was the association between extent of surgery and RFS, assessed using Cox proportional hazards regression models.
Results
A total of 946 patients with PTC (mean [SD] age, 37.0 [12.1] years, 630 female individuals [66.6%]) were analyzed. Lobectomy (624 [66.0%]) was negatively correlated with the frequencies of older age (≥65 years, 17 [2.7%]), female sex (393 [63.0%]), multifocality (132 [21.2%]), minor extrathyroidal extension (259 [41.5%]), number of metastatic lymph nodes (median [range], 9 [6-14] nodes), and radioactive iodine ablation (0). After PSM with treatment period and potential prognostic factors (age, sex, primary tumor size, multifocality, minor extrathyroidal extension, number of lymph node metastases and lymph node ratio), 265 pairs of patients were available for analysis. After a median (range) follow-up of 60 (9-150) months in the lobectomy group and 58 (8-161) months in the TT group, 21 (7.9%) and 17 (6.4%) structural recurrences were identified in the lobectomy and TT groups, respectively. Lobectomy was not associated with significantly compromised 5-year RFS rate (lobectomy, 92.3% vs TT, 93.7%; adjusted hazard ratio, 1.10; 95% CI, 0.58-2.11; P = .77). Power analysis indicated that the test had 90% power to detect a more than 4.9% RFS difference. No significant difference in RFS was observed between patients treated with TT and radioactive iodine ablation (n = 75) and their counterparts (adjusted hazard ratio, 0.59; 95% CI, 0.14-2.41; P = .46).
Conclusions and Relevance
Results of this cohort study suggest that patients with PTC and lymph node metastasis had a similar RFS after lobectomy vs those who had TT. If radioactive iodine ablation is not going to be performed, lobectomy may be an effective alternative option.
|
v2
|
2022-12-01T06:17:54.389Z
|
2022-11-30T00:00:00.000Z
|
254094523
|
s2orc/train
|
Multigroup prediction in lung cancer patients and comparative controls using signature of volatile organic compounds in breath samples
Early detection of lung cancer is a crucial factor for increasing its survival rates among the detected patients. The presence of carbonyl volatile organic compounds (VOCs) in exhaled breath can play a vital role in early detection of lung cancer. Identifying these VOC markers in breath samples through innovative statistical and machine learning techniques is an important task in lung cancer research. Therefore, we proposed an experimental approach for generation of VOC molecular concentration data using unique silicon microreactor technology and further identification and characterization of key relevant VOCs important for lung cancer detection through statistical and machine learning algorithms. We reported several informative VOCs and tested their effectiveness in multi-group classification of patients. Our analytical results indicated that seven key VOCs, including C4H8O2, C13H22O, C11H22O, C2H4O2, C7H14O, C6H12O, and C5H8O, are sufficient to detect the lung cancer patients with higher mean classification accuracy (92%) and lower standard error (0.03) compared to other combinations. In other words, the molecular concentrations of these VOCs in exhaled breath samples were able to discriminate the patients with lung cancer (n = 156) from the healthy smoker and nonsmoker controls (n = 193) and patients with benign pulmonary nodules (n = 65). The quantification of carbonyl VOC profiles from breath samples and identification of crucial VOCs through our experimental approach paves the way forward for non-invasive lung cancer detection. Further, our experimental and analytical approach of VOC quantitative analysis in breath samples may be extended to other diseases, including COVID-19 detection.
Introduction Lung cancer is the most common kind of cancer globally due to poor lifestyle and environmental pollution. In the USA, lung cancer has an incidence of 235,760 new cases with 131,880 deaths in 2020 and is by far the leading cause of cancer deaths among both men and women, making up almost 25% of all cancer fatalities [1]. Every year, a larger number of people die due to lung cancer than colon, breast, and prostate cancers combined [2]. The 5-year survival rate for lung cancer patients is relatively low compared to other diseases. Early detection of lung cancer is crucial to improve the survival of the patients [2]. For this purpose, many screening methods, including chest radiography, sputum cytology, low-dose spiral computer tomography, fluorescence bronchoscopy, and positron emission tomography have been used [3]. However, these procedures are complicated, expensive, and time-consuming, thus making them difficult for the poor or low-income patient groups. Therefore, lung cancer detection through breath analysis using volatile organic compounds (VOCs) can be a vital tool for its early detection in order to increase the survival chance.
VOCs are organic chemicals that exist in air, exhaled breath, etc. and have high vapor pressure at ambient temperature [4]. The analysis of VOCs in exhaled breath plays a vital role in the early detection of lung cancer [4]. Earlier studies showed that there are several thousand(s) of VOCs in human breath, e.g., formaldehyde (CH 2 O), acetaldehyde (C 2 H 4 O), acetone (C 3 H 6 O), 2-butanone (C 4 H 8 O), to name a few. So far, many VOCs have been identified and reported in breath samples of normal humans and patients with lung cancer [5]. For instance, in 1999, Phillips et al. reported over 3400 different VOCs present in exhaled normal human breath [6].
The combinations of some VOCs reported in the literature can comfortably discriminate the lung cancer patients from the healthy ones [7]. For instance, a recent study showed higher sensitivity of lung cancer detection among patients using the carbonyl VOCs present in the exhaled breath samples [8]. In other words, the molecular concentration data on the VOCs present in exhaled breath samples were collected from the patients to classify them into several groups, i.e., Healthy Control, Cancer, and Benign Nodule. In this direction, Bousamra et al. (2014) developed one quantitative analytical approach to differentiate early lung cancer from benign pulmonary nodules based on the molecular concentration of carbonyl compounds in exhaled breath samples [9]. In the existing analytical approaches, statistical methods including the t-test and Wilcoxon test were used to select the significant VOCs [7,9]. These methods are univariate in nature and mostly ignore the inter-VOC relationships (i.e., relationship among the VOCs), and there is a chance of spurious association of VOC with the patient classes [16]. Further, Li et al. (2015) developed a technique utilizing quaternary amino-oxy coated silicon micro-reactors [4] for selective capture and quantification of the ketones and aldehydes in the air [10][11][12] and exhaled breath [7][8][9]. They used five classification models, including generalized partial least squares, support vector machines, random forests, linear and quadratic discriminant analyses to classify the patients into lung cancer and control groups based on exhaled breath data [4]. Sufficient studies in the literature indicated that the carbonyl compounds in exhaled breath play a significant role in the non-invasive detection of lung cancer [7][8][9][10][11][12]. Furthermore, the proper identification of key carbonyl compounds through statistical and machine learning techniques requires further advances.
In a typical breath sample study, the molecular concentration data on several hundred(s) of endogenous and exogenous VOCs are usually observed over patients. Sometimes, it may not be experimentally possible to monitor data on all the VOCs and further use them in lung cancer detection. In other words, among these hundred(s) of VOCs, all may not be required for the patient classification or the predictive model building process (i.e., training the machine learning models and later use them for class label predictions). Therefore, it is pertinent to select/identify a few metabolic VOCs related to lung cancer as key and significant features for cancer detection. The selection of important features (here metabolic VOCs) out of many VOCs is called feature selection in machine learning [13]. Further, it is essential to determine the number of significant VOCs (e.g., feature size or dimension of VOC data), which can be used in the training of the classification model to predict the class type of lung cancer patients. The selection of significant VOCs will save the precious time and cost of data generation for all VOCs present in the breath samples. In other words, the researchers can focus on few VOCs instead of generating data on all the VOCs present in breath samples of the patients.
Therefore, in this study, we endeavor to classify the lung cancer patients based on the VOC molecular concentration data. We present an experimental approach for lung cancer prediction using the carbonyl VOCs present in breath samples. The VOC molecular concentration data are generated from the breath samples of the 414 subjects (156: lung cancer; 65: benign and 193: healthy control) through the unique silicon microreactor technology [8]. The breath samples are collected following the experimental protocol approved by the Institutional Review Board (IRB) at the University of Louisville, USA. We also present an analytical approach involving relevant VOC selection and further used them in lung cancer patient classification model training. This approach of VOC selection is statistically sound, robust, and does not require any probability distributional assumptions about the VOC data (for VOCs testing and selection). Further, we identified several informative VOCs present in exhaled breath samples to detect lung cancer patients. For instance, the developed models provided sufficient classification accuracy for lung cancer detection with a minimum of three VOCs. Also, we studied the effect of the various VOC combinations on the classification of lung cancer patients. Moreover, our developed experimental approach can be applied to detect COVID-19 patients using VOC data from the exhaled breath samples.
The remainder of the paper is organized as follows: (i) the material and methods section deals with detail protocols for the data generation, description of methodology; (ii) the results and discussion section mainly deals with presentation of obtained results along with their discussion; and (iii) the conclusion section summarizes the manuscript along with its future scope.
Breath sampling and data generation
This study recruited 156 patients with untreated lung cancer, 65 patients with benign pulmonary nodules, and 193 healthy control subjects to provide exhaled breath samples. The detailed subject demographic characteristics, disease information, and breath analysis data have been published [8]. In brief, there were 103 patients with early stages (Stages 0, I, and II) of lung cancer and 53 patients with late stages of lung cancer. Most lung cancer patients were current or former smokers (149). The healthy controls included 113 current or former smokers and 80 never smokers. The average ages of the lung cancer patients, patients with benign pulmonary nodules, and healthy subjects were 65.1, 54.2, and 49.4 years, respectively. The male percentages of these three subgroups were 51.9%, 49.2%, and 55.7%, respectively.
The detailed research protocol for the collection of exhaled breath samples was approved by the IRB, University of Louisville, USA (IRB #15.0711). The healthy control subjects were recruited from patient family members who were free of lung cancer or other chronic pulmonary disease. All patients with pulmonary nodules were recruited in the James Graham Brown Cancer Center and Jewish Hospital at the University of Louisville, USA. The diagnostic predictions from these breath analyses were confirmed by clinical diagnoses using following-up the CT scans, positron emission tomography scans or pathology of biopsy or surgically resected specimens.
Exhaled breath samples were collected in one-liter Tedlar bags (Sigma-Aldrich, USA) through normal exhalation allowing for the collection of a mixture of alveolar and tidal breath in one exhaled breath. Ambient clinic exam room air samples (1 L) were also collected to serve as a control of background carbonyl compounds in the collection room. Our previous studies have examined the detailed method of breath sample collection, evacuation of breath samples through the micro-reactors, and analysis of the samples [4,[7][8][9]. In a brief description, the subjects directly exhaled the breath into Tedlar bags through the Teflon tube from the mouth to provide one liter exhaled breath samples, thus providing a non-invasive collection technique that the patients readily accepted. After the collection of exhaled breath, the Tedlar bags were directly connected to the silicon micro-reactors through silica capillary tubes and septa. A vacuum was applied to draw the collected VOCs from the Tedlar bags through the fabricated microreactor [10][11][12] at a flow rate of 5 mL/min. The microreactor has thousands of micropillars coated with 2-(aminooxy)-N, N, N-trimethyl-ethanammonium (ATM) iodide. After complete deflation of the sample bags, ATM and ATM adducts were eluted by flowing methanol (~100 μL) from a pressurized vial through the microreactor and into a collection vial [10]. The eluent methanol solutions were directly analyzed using a hybrid linear ion trap-Fourier transform-ion cyclotron mass spectrometry (FT-ICR-MS) instrument (Finnigan LTQ-FT, Thermo Electron, Bremen, Germany) equipped with a TriVersa NanoMate ion source (Advion BioSciences, Ithaca, NY) and a nano-electrospray chip (inner nozzle diameter 5.5 μm). A 5 μL methanol solution of a known amount of 5 nmol of ATM-acetone-d6 adduct was added to each eluted methanol sample as an internal reference of FT-ICR-MS. The amount of captured carbonyl compounds was then determined by comparing the FT-ICR-MS signal abundance of ATM−acetone-d6 with those of other ATM−carbonyl adducts. The concentration of each compound in exhaled breath detected by FT-ICR-MS was then calculated from the amount of the captured carbonyl compounds with in terms of nanomoles per liter (nmole/L). The microreactor's carbonyl capture efficiencies and validity of the analyses have been characterized in our previous studies [10][11][12]. A flow chart of the bioassay for generating data is displayed in Fig 1. Further, the workflow of the proposed experimental approach, including data generation, feature selection, and the classification model development is also illustrated in Fig 1. This study was approved by the IRB at the University of Louisville (IRB #15.0711). An informed written consent form was reviewed by the subjects for participation. A signed consent form was obtained from the subjects before they participated in the study. There was no minor recruited for the study.
Support Vector Machine-Recursive Feature Elimination
Support Vector Machine-Recursive Feature Elimination (SVM-RFE) can be used for the selection of relevant VOCs (in a two group case) from the lung cancer VOC data [14,15]. Let, {x m , y m } � R N × {−1, 1} be the input given to the Support Vector Machine (SVM) model. Here, we wish to find a hyperplane that divides the patients for lung cancer (y m = 1) from that of control class (y m = −1) in such a way that the distance between the hyperplane and the closest point is maximum (Supplementary Document S1 in S1 File). Then the hyperplane can be written as: where, k i and b are the weight of i th VOC and bias, respectively. Here, we assume that the patients for the two classes are linearly separable. In other words, we can select two parallel support hyperplanes that separate the lung cancer and control classes in such a way that the distance between these two planes is maximized (Supplementary Document S1 in S1 File). For the lung cancer class (y m = 1), the supporting hyperplane can be written as: Here, the Eq 2 only holds good for the x which are support vectors (i.e., points closest to the separating hyperplane, Eq 1).
For control class (y m = −1), the support hyperplane can be written as: Now, we assume that every point must lie on either side of the respective support hyperplanes (Eq 2 and Eq 3) (their distance to the separating hyperplane is at least same as the distance between the support vectors and the separating hyperplane), which can be expressed as: We wish to maximize the distance between the lung cancer and control support hyperplanes given in Eqs 2 and 3, respectively. Here, special care must be taken to prevent any data points from falling in between these two support hyperplanes.
To maximize the distance between the support hyperplanes (Supplementary Document S1 in S1 File), we need to minimize kkk 2 2 under the constraint of Eq 4. Mathematically, the objective function can be written as: where, φ m (� 0) are Lagrange multipliers. The constraint on φ m follows from the fact that the constraint is an inequality. Here, k i 's are obtained by minimizing the objective function in Eq 5. The objective function (Eq 5) was optimized with respect to k i , b and the following expressions are obtained.
The value of k can be obtained through solving the system of linear equations given in Eq 6 and is expressed as: Here, one also need to solve for φ m , but this cannot be done by solving for Eq 6 when its gradient is zero, thus one need to take into account the constraint that φ m �0. Therefore, SVMs cannot be solved via a linear system of equations. Rather, optimization algorithms (e.g., gradient descent) are commonly used in SVM-based tools. For this purpose, we executed the svm function implemented in e1071 R package.
The k i 2 (� 0) (i.e., square of the i th element of k in Eq 7) is used as a metric for the ranking of the VOCs in the data [15] to evaluate the impact of the i th VOC on patients' classification [16]. In the SVM-RFE technique, VOCs are eliminated with the smallest k i 2 iteratively in a backward elimination manner and ranked VOC list is prepared at the end [15,17]. Here, the backward elimination means training the SVM-based machine learning models iteratively after removing the least significant VOC at each step. Moreover, most feature selection methods, such as SVM-RFE, are sensitive to slight permutations of the class labels [18]. The ranking of VOCs may also lead to the selection of spuriously associated VOCs and make the selection process unreliable [13,19,20]. Therefore, it is essential to select VOCs based on statistical testing instead of their ranks. For this purpose, we used the Bootstrap SVM-RFE (Boot-SVM-RFE) technique developed by Das et al. (2017) to select the most relevant VOCs for patient classification [19]. The Boot-SVM-RFE method is briefly described in the following section.
Bootstrap SVM-RFE
In the usual supervised setting, the M patients/samples (as columns) in the X, data matrix, either belonging to lung cancer or control, can be considered subjects/units in a population model, as shown in Eq 8.
where, [15,19]. So, we set B = 500 as the literature showed that the number of bootstrap samples required for obtaining the distribution of the test statistic(s) must be sufficiently large [18,21] The B bootstrap data matrices are given as input to the SVM-RFE technique to compute the k i 2 scores (given in Eq 7), and subsequently, VOC ranking was performed on each of the B bootstrap data matrices. Let, P ib be a random variable (rv) that indicates the position of i th VOC (i.e., ranks obtained from the SVM-RFE) in the b th bootstrap data matrix. Then, another rv can be defined based on P ib (without loss of generality), given as: where, R ib in Eq 9 is the rank score of i th (i = 1, 2, . . ., N) VOC in the b th (b = 1, 2, . . ., B) bootstrap data matrix. Here, it may be noted that the distribution of the rank scores of VOCs, computed from a bootstrap data matrix, is symmetric around the median value, 0.5 (as rank scores are functions of ranks).
To decide whether i th VOC is relevant or not for the patient classification, the following null hypotheses are framed.
where, R i is the rank score for i th VOC over all possible bootstrap samples. To obtain the distribution of test statistic under H 0 , we defined another rv Z ib , as: ( Let r ib be another rv representing the rank assigned to (R ib −0.5) (after arranging in ascending order of their magnitudes). In other words, for each row (which denotes the VOC), (R ib −0.5) was computed and corresponding rank, r ib , was assigned to (R ib −0.5.
To test H 0 vs. H 1, the test statistic for i th VOC, W i , is developed and is given as: where, U ib = Z ib r ib . In other words, W i (Eq 11) is the sum of the ranks of positive (R ib −0.5) for i th VOC over B bootstrap samples. Further, U ib in Eq 11 is a Bernoulli rv, and its probability mass function can be given as: Here, the expected value and variance of W i in Eq 11 under H 0 can be obtained as: The variance of W i becomes: As B is sufficiently large, then under the central limit theorem, the distribution of W i , given in Eq 11, becomes: Through Eq 15, the p-value for i th (i = 1, 2, . . ., N) VOC was computed, and similarly, this testing procedure was repeated for the remaining N-1 VOCs. In other words, the above statistical test was repeated for N times to compute the statistical significance values for the VOCs.
Let, p 1 , p 2 ,. . .,p N be the corresponding p-values for all the VOCs, and α be the desired significance level. Hence, we employed Hochberg's procedure [1] to correct the multiple testing problem and computed the adjusted (adj.) p-values for the VOCs. The algorithm for Hochberg's procedure [22] is as follows: First, the p-values of the VOCs were sorted in increasing order of their magnitude, shown as: p (1) , p (2) ,. . .,p (N) , where, p (.) is the rank ordered p-value and (i) stands for the i th ordered value (i.e., p (1) : smallest p-value, p (2) : second smallest p-value and so on).
Step 1. If p (N) >α, then retain corresponding null hypothesis and go to the next step. Else reject it and stop.
Step i = 2,3,. . ., N−1. If p (N−i+1) >α/i, then retain the corresponding null hypothesis and go to the next step. Else reject all remaining hypotheses and stop.
Step N. If p (1) >α/N, then retain the corresponding null hypothesis. Else reject it. Now, the adj. p-values are given recursively beginning with the largest p-value [1]: ( Based on the computed adj. p-values, the relevant VOCs were selected from the data. In other words, a lesser value of adj. p-value indicates more relevance of the VOC for the patient classification and vice-versa. Similarly, this procedure was applied to select the significant VOC for the patient classification into classes, such as benign vs. control, (lung cancer + benign) vs. control, (control + benign) vs. lung cancer. The outline and key analytical steps of the VOC selection process are shown in Fig 2. The effects of the significant VOCs on the patient classification were studied through an SVM classifier (with linear basis function). Under this setting, the VOCs (and their molecular concentration data) were given as inputs to the SVM classifier to compute the classification-based performance metrics. Further, impacts of the VOCs on the classification of patients under five different cases, including Case I: Cancer vs. Control; Case II: Cancer vs. Benign; Case III: Benign vs. Control; Case IV: (Benign + Cancer) vs. Control; and Case V: (Control + Benign) vs. Cancer were assessed through performance metrics, such as mean classification accuracy (CA) and standard error (SE) in CA computed through a varying sliding window size technique [18,19]. Here, we used this technique to study the importance of rankings of VOCs (obtained from a feature selection method, e.g., Boot-SVM-RFE) through training a classification model. In other words, the sliding
PLOS ONE
windows are VOC intervals that literally "slide" across the whole VOC list, preferably by some constant distance and CA is computed for each sliding window. Sliding windows can overlap or mutually exclusive. A brief description about the varying sliding window size technique is given in Supplementary Document S2 in S1 File. Then, the mean CA and SE in CA were computed over the sliding windows. In other words, the VOC set (of size n (n � N)), which provides maximum discrimination between the subjects/patients of 2 groups through CA, will be considered as the optimal size of the VOC set. The expressions for mean CA and SE in CA computed through varying sliding window size technique are given in Eqs 17 and 18.
SE CA ¼ ffi ffi ffi ffi ffi ffi ffi ffi ffi ffi ffi ffi ffi ffi ffi ffi ffi ffi ffi ffi ffi ffi ffi ffi ffi ffi ffi ffi ffi ffi ffi ffi ffi ffi ffi ffi ffi ffi ffi ffi ffi ffi ffi ffi ffi ffi ffi ffi ffi ffi ffi ffi ffi ffi ffi ffiffi ffi ffi ffi ffi ffi ffi The total number of windows denoted as K in Eqs 17 and 18 can be defined in Eq 19.
where, n is the size of the VOC set, S is the size of the windows (i.e., size refers to the number of ranked VOCs), and L is the sliding length. The values of n, S, L, and K are given in Supplementary Document S2 in S1 File. The optimal size of the VOC set was computed through training the SVM-based classification model
Results and discussion
We observed the carbonyl VOCs having carbon atoms ranging from one (formaldehyde: Fig 1 showed the capturing of typical relative abundances of these VOCs in breath samples of lung cancer patients, benign, and healthy controls. Chemical structure-wise, isomeric ketones and aldehydes are indistinguishable by direct infusion of one-dimensional FTICR-MS. However, the measured molecular weight at a resolving power of 200,000 provides their accurate chemical formulas. Separation and structure identification of some important isometric ketones and aldehydes was done through FT-ICR-MS/MS and GC-MS technologies. Further, the summary statistic(s) of the 27 considered VOCs for three different patient classes, i.e., control, benign, and lung cancer, are given in S1 Table. The mean values of the VOCs, including C 3 H 6 O, C 2 H 4 O, etc., are higher than others across all the patient classes, which indicated their higher average concentrations in breath samples (S1 Table). All the 27 VOCs may not be considered as biomarkers for lung cancer detection; therefore, we used the Boot-SVM-RFE technique to identify the significant VOCs for various combinations of patient classes. Here, five different classes were used, i.e., Case I: Cancer (156) vs. (Fig 3). Through the Boot-SVM-RFE, the statistical significance values (p-values) for the VOCs were computed for five different classification problems and shown in Table 1 , were found to be statistically significant (at 1% level of significance) for all the cases of classification (Table 1). This finding indicated that these VOCs can be used as biomarkers for the patient classification. Broadly, we found 16 VOCs as statistically significant, at least in one case of patients' classification ( Table 1). The summary statistic(s) for these key VOCs for the three patients' classes are shown in (Fig 3, Table 2). Similarly, for cancer vs. benign, benign vs. control, and (benign + cancer) vs. control classifications, 15 VOCs were found to be statistically significant at the 1% level of significance (Fig 3, Table 1). Further, for (control + benign) vs. cancer classification, 13 VOCs were found to be statistically significant ( Table 1). The rankings of the VOCs for five different patient Table 3. For instance, the VOCs such as C 4 H 8 O and C 4 H 8 O 2 ranked 1 and 2 respectively for cancer vs. control classification (Table 3). These ranked VOCs can be used as biomarkers for cancer detection with respect to healthy controls. Similar interpretations about the ranking of the VOCs on other classifications can be made, as shown in Table 3. The empirical distributions of the significant VOCs are shown in Supplementary Document S4 in S1 File.
We also studied different combinations of the VOCs on classifying the patients into various classes, such as cancer vs. control, cancer vs. benign, benign vs. control, (benign + cancer) vs. control, and (benign + control) vs. cancer, through the SVM based classification model. Here, the classification accuracy was computed through a five-fold cross-validation technique for each classification problem. The cross-validations of the data were repeated 500 times by taking different combinations of VOCs (based on their ranks) for each classification problem. Then, the mean and standard error of the classification accuracies were computed over the 500 runs through a varying sliding window size technique [13,16,19]. The results are shown in (Table 3) were included in the data (Table 4). Similar interpretations can be made for other patients' classification, such as cancer vs. benign, benign vs. control, (benign + cancer) vs. control, and (benign + control) vs. cancer. However, we observed consistently better results when the top-ranked nine VOCs (as given in Table 3) were considered in all the five classification problems. We also performed similarity analysis among the key detected VOCs across all the patients, and the results are shown in Fig 4. For instance, the distance-based similarity analysis of the 16 VOCs over all the patients is shown in Fig 4A. The results indicated that the VOCs, such as (Fig 4A). These two VOCs have less similarity with others across all the patients (Fig 4A). The remaining VOCs are clustered together, which indicates their similarity over the samples irrespective of the cancer classes ( Fig 4A). The correlation among the VOCs over all the patients is shown in Fig 4B. (Fig 4B). Further, the remaining VOCs are somewhat positively correlated with others. This analysis indicated a similarity in the molecular concentrations of the VOCs across the samples/patients observed through FT-ICR-MS technology. This study demonstrates that few detected markers in exhaled breath samples can be used as marker signatures for distinguishing patients with lung cancer from patients with benign pulmonary nodules and healthy subjects (Supplementary Document S5 in S1 File). Here, the VOC markers for cancer detection are identified through the statistically sound Boot-SVM-RFE technique. Through this technique, a statistically meaningful measure, i.e., adjusted p-value or FDR, was computed after correcting the multiple hypothesis testing problems. Then the adjusted p-value or FDR was assigned to each VOC, and the significant VOCs were selected based on these computed values. This measure is easily interpretable by experimental biologists and lab users, as the values are well defined in [0, 1]. In other words, a lower p-value indicates a more informative VOC and vice-versa. The random resampling procedure, i.e., bootstrap method, used in the Boot-SVM-RFE can eliminate the spurious and arbitrary association among the VOCs while detecting marker signatures [13,16,19]. Further, the Boot-SVM-RFE is more robust and does not require any distributional assumptions of the VOC data to obtain the distribution of test statistic(s). After selecting a few VOC markers, we trained the machine learning (i.e., SVM) based classification models to establish their relevance in lung cancer patients' classification. Our study found that instead of using all the VOCs, one can focus on few (e.g., 3, 5, or 7) marker VOCs to detect lung cancer patients more robustly and accurately. This approach will be less time-consuming and require lesser resources to detect lung cancer based on exhaled breath samples using FT-ICR-MS technology. Here, we have narrowed down our search to a few VOCs instead of focusing on all the VOCs present in breath samples, which in turn will save the time and cost of the experiments. The major advantages of our experimental approach include: first, the microreactors are designed with thousands of micropillars to provide higher capture rates of carbonyl compounds (e.g., VOCs) in breath samples [10][11][12]. Second, chemo-selective capture of carbonyl compounds through amino-oxy reactions simplifies the spectrum of compounds to be quantitated. Both the steps are well established in the literature and can be further used to detect other diseases, including COVID19 using exhaled breath samples. Third, a statistically efficient technique, Boot-SVM-RFE [19], was used to detect the markers using the VOC molecular concentration data. Fourth, in-silico validation of the VOC signatures through training machine learning-based classification models. In other words, our experimental approach includes VOC molecular data generation through microreactors based FT-ICR-MS technology and statistical analysis of the data using efficient statistical and machine learning techniques.
Conclusion
Early diagnosis of lung cancer is a key factor for increasing its survival rates among the patients. The analysis of carbonyl compounds present in exhaled breath of the patients is a promising non-invasive tool for the diagnosis of lung cancer at the early stage. In other words, the presence of metabolic carbonyl organic compounds in exhaled breath can play a vital role in the early detection of lung cancer patients, which will surely enhance the survival of the patients. Hence, the identification and characterization of the key metabolic VOCs using proper analytical approach and further using them in developing the classification models will play an important role in the quick and non-invasive detection of lung cancer. Therefore, in this study, we proposed an experimental approach to identify the key VOCs through the Boot-SVM-RFE technique and used these key VOCs to distinguish the patients with lung cancer from the benign pulmonary disease and healthy control classes.
Our analytical findings indicated that fewer VOCs can be used for lung cancer detection with sufficient classification accuracy. For instance, seven common key VOCs, including C 4 In this study, we used linear basis function in Boot-SVM-RFE technique, it will be interesting to study other non-linear basis functions or tree based models (e.g., random forests) to capture non-linear association among the VOCs. Further, our experimental and analytical approach of VOC quantitative analysis in breath samples may be extended to other diseases, including COVID19 detection. Besides, the analytical method used in this study can be applied to high-throughput gene expression studies, including RNA-sequencing and single-cell RNA-sequencing to select gene/bio-markers for the identification of cancer patients or cell types. Also, the reported experimental approach can be applied to other urine, saliva, and blood bio-assays based genetic studies to predict the phenotypes by identifying the organic compound based bio-signatures.
Supporting information S1 File. Supplementary documents S1-S5. This file contains supporting documents from S1 to S5. Supplementary Document S1: SVM training for two class classification; Supplementary
|
v2
|
2022-12-01T06:42:23.036Z
|
2022-11-30T00:00:00.000Z
|
254096430
|
s2orc/train
|
Tumor containment for Norton-Simon models
Some clinical and pre-clinical data suggests that treating some tumors at a mild, patient-specific dose might delay resistance to treatment and increase survival time. A recent mathematical model with sensitive and resistant tumor cells identified conditions under which a treatment aiming at tumor containment rather than eradication is indeed optimal. This model however neglected mutations from sensitive to resistant cells, and assumed that the growth-rate of sensitive cells is non-increasing in the size of the resistant population. The latter is not true in standard models of chemotherapy. This article shows how to dispense with this assumption and allow for mutations from sensitive to resistant cells. This is achieved by a novel mathematical analysis comparing tumor sizes across treatments not as a function of time, but as a function of the resistant population size.
Introduction
The dominant paradigm in cancer therapy is to treat tumors aggressively. This makes sense if the tumor is curable, but might be counter-productive otherwise. Indeed, tumors contain a large number of cells, some of which may be resistant to treatment. By killing preferentially the most sensitive cells, an aggressive treatment could free resistant cells from competition with sensitive cells, allowing them to develop quickly: a phenomenon called competitive release in ecology (Gatenby 2009b [1], Enriquez-Navas et al., 2016 [2], Cunningham et al. 2019 [3]).
This led researchers to suggest that, at least for some tumors, treating at, or close to, the maximal tolerated dose should be replaced by treating at the minimal effective dose; that is, the minimal dose that allows to stabilize tumor size, subject to a sufficient quality of life of the patient. The aim is to slow down the growth of resistant cells, by maintaining competition with sensitive cells.
Viossat and Noble (2021) [25] recently analysed a more general model with two types of tumor cells: sensitive and fully resistant to treatment. The model takes the form: dS dt (t) = S(t)g S (S(t), R(t), L(t)) dR dt (t) = R(t)g R (S(t), R(t)) (Model 1) 1 The initial prostate cancer trial has been debated (Mistry 2021 [14], Zhang et al. 2021 [15]) where S(t) and R(t) are the total number of sensitive and resistant cells at time t, L(t) is the current dose or treatment level, and g S and g r are per-cell growth-rate functions. They identified qualitative assumptions under which, among other results, containing the tumor at its initial size maximizes the time at which the tumor becomes larger than at the beginning of treatment (for an idealized form of containment) or is close to maximizing it (for a more realistic form). Similarly, an idealized form of containment at a larger threshold size maximizes the time at which tumor size becomes larger than this threshold. By contrast, eliminating all sensitive cells at treatment initiation -an idealized form of an aggressive treatment -leads to the quickest time to progression beyond any threshold size, among all treatments that eliminate sensitive cells before this threshold size is crossed.
Some of the assumptions of Viossat and Noble are however debatable. In particular, they assume that the higher the number of resistant cells, the lower the growth rate of sensitive cells. Formally, function g S is nonincreasing in R. This assumption helps to compare the size of sensitive populations across treatments. To see why, assume that sensitive cells hamper the growth of resistant cells (that is, g R is non-increasing in S), and consider two constant dose treatments, with doses L 1 and L 2 > L 1 , respectively, and the same initial conditions. Since treatment 2 is more aggressive, it initially leads to a smaller sensitive population, hence a larger resistant population than treatment 1: for t > 0 small enough, S 2 (t) < S 1 (t) and R 2 (t) ≥ R 1 (t). If the growth-rate of sensitive cells g S is non-increasing in R, the fact that treatment 2 is more aggressive and leads to a larger resistant population both negatively affect the sensitive population under treatment 2, ensuring that the sensitive population remains smaller under treatment 2 than under treatment 1: S 2 < S 1 . This itself ensures that R 2 remains larger than R 1 . The inequalities S 2 < S 1 and R 2 ≥ R 1 thus propagate, and hold for all times t > 0. By contrast, if the growth-rate of sensitive cells g S increases with R, the fact that R 2 ≥ R 1 might boost the growth of sensitive cells under treatment 2, even though treatment 2 is more aggressive. But if the sensitive population becomes larger under treatment 2, the inequality R 2 ≥ R 1 might also cease to hold, and the whole argument of Viossat and Noble seems to break.
Unfortunately, assuming g S non-increasing in R, which may seem a natural consequence of competition between tumor cells, is actually problematic. Indeed, it is not satisfied in the Gompertzian model from Monro and Gaffney (2009) [17] that Viossat and Noble use for simulations: where N (t) = S(t) + R(t) is the total number of tumor cells. More precisely, in the absence of treatment (L(t) = 0), the growth-rate of sensitive cells is decreasing in N , hence in R; however, if the treatment level is high enough (L(t) > 1), the opposite happens, and a large resistant population slows down the regression of the sensitive population. This reflects the fact that chemotherapy typically attacks cells that are actively dividing. For various reasons (e.g., boundary growth), a larger tumor size is thought to be associated with a lower growth-fraction, i.e., a lower proportion of cells actively dividing (Laird 1964 [26]; Norton and Simon 1977 [27]; Gerlee 2013 [28]). Thus the presence of additional resistant cells, by making the tumor larger, makes more sensitive cells quiescent, and shields them against the effect of treatment. As a result, the growth rate of sensitive cells is not always decreasing in R, and the assumptions of Viossat and Noble are not satisfied. The problem occurs for all Norton-Simon models (Norton and Simon 1977 [27]), where the growth of the sensitive population takes the form: for some per-cell growth rate function g. It also occurs for birth-death models with a Norton-Simon treatment kill-rate (Strobl et al. 2020 [9]): where b(N ) and d(N ) are birth-and death-rates in the absence of treatment. Another issue is that Model 1 does not consider mutations from sensitive to resistant cells. This is problematic because one of the theoretical motivations for aggressive treatments is to decrease tumor size in order to limit the number of reproduction events, hence of possible appearance of resistant cells by mutation. Key-contributions to the tumor containment literature analyzed the trade-off between increasing competition (by allowing many sensitive cells to survive) and decreasing the number of mutations from sensitive to resistant cells (Martin et al. 1992[16], Hansen et al. 2017[19]) The purpose of our work is to generalize the results of Viossat and Noble to models that encompass Norton and Simon models, and, at least to a certain extent, allow for mutations from sensitive to resistant cells. Mathematically, this is achieved by formulating the model in terms of absolute growth-rates and, more importantly, by replacing a direct analysis of the evolution through time of the number of sensitive and resistant cells, S(t) and R(t), by an analysis of the induced trajectory in what we call the R − N plane, where N = S + R describes the total tumor size. These trajectories describe the evolution of the total size N of the tumor as a function of the size R of the resistant population. This turns out to be an efficient technique, allowing to generalize essentially all results of Viossat and Noble, including the optimality or near-optimality of containment treatments.
The remainder of this article is organized as follows: the model is described in the next section. Results are presented in Section 3, proved in Section 4 and discussed in Section 5. The Appendix elaborates on the extent to which our model allows for mutations from sensitive to resistant cells, and derives the comparison principle on which our results are based.
Model
We consider a model with two types of tumors cells: sensitive to treatment, and fully resistant. Their growth is described by differential equations of the form: where φ S and φ r are continuously differentiable absolute growth-rate functions. The quantities φ S (0, R, L) and φ R (S, 0, L) are assumed non-negative to ensure that population sizes cannot become negative. Let N (t) = S(t) + R(t) and N 0 = S 0 + R 0 . We make the following assumptions: • The patient dies when tumor size reaches a critical size N crit > N 0 . 2 • The size of an untreated tumor increases: • The higher the treatment level, the lower the growth-rate of sensitive cells: φ S is non-increasing in L.
• The resistant population keeps growing: φ R (S, R) > 0 whenever R > 0 and N ≤ N crit , so that the tumor is incurable if, as we assume, resistant cells are initially present.
• If R ≥ R 0 and N ≤ N crit , for a given number of resistant cells, the larger the sensitive population, the lower the growth-rate of resistant cells: φ R is non-increasing in S.
This last assumption models competition for resources (space, glucose, oxygen) or some other form of inhibition of resistant cells by sensitive cells (Bondarenko et al, 2021 [10]). It neither forbids nor implies a cost of resistance, i.e., that in the absence of treatment, resistant cells grow slower than sensitive cells. In particular, we do not specify whether resistant cells compete more strongly with sensitive cells or with other resistant cells.
The difference with Viossat and Noble (2021) [25] is two-fold: first, the model is formulated in terms of absolute growth-rates, allowing for mutations from sensitive to resistant cells and back.
Second, we make no assumption on how the growth-rate of sensitive cells depends on the number of resistant cells. In particular, φ S is not assumed non-increasing in R. This model encompasses many previous models (Silva et al. 2012 [5], Carrère, 2017 [18], Bacevic and Noble et al. 2017 [7], Hansen et al. 2017 [19], Strobl et al. 2020 [9]), including Model 2, its original formulation with mutations (Monro and Gaffney, 2009 [17]), or explicit birth-death models with or without a Norton and Simon treatment effect (Strobl et al. 2020 [9]).
To analyse Model 3, it is useful to rewrite it in the equivalent form: Our main assumptions are then that, on the domain R 0 ≤ R ≤ N ≤ N crit , f N is non-increasing in L, positive if L = 0, and f R is positive and non-increasing in N . We also assume that the treatment level cannot be larger than a constant L max (the treatment level corresponding to the maximal tolerated dose). Other assumptions are technical: • f N and f R are continuously differentiable (on a neighborhood of the relevant domain: R 0 ≤ R ≤ N ≤ N crit and 0 ≤ L ≤ L max ).
• R(t) remains smaller than N (t) (this must be biologically, and follows from our assumption on Model 3 that φ S (0, R, L) is nonnegative).
• The treatment function L(·) is strongly piecewise continuously differentiable (our vocabulary) in the following sense: there exists a positive integer m and times t 0 = 0 < t 1 < ... < t m such that, on each interval [t k , t k+1 ), k ∈ {0, ..., m − 1}, and on [t m , +∞), L coincides with a continuously differentiable function defined on a neighborhood of this interval.
This ensures among other things that, for a given initial condition and treatment, there is a unique solution to Model 4. To fix ideas, we assume that the solutions R(t) and N (t) are defined for all times (though they have no clear interpretation once N (t) > N crit ), and that they remain bounded. Both properties can be ensured by modifying growth-rate functions f N and f R on the domain N > N crit . This is without loss of generality since patients are then assumed already deceased.
Outcomes and treatments.
We compare the effect of various treatments on the time at which tumor size becomes larger than a given threshold. Depending on this threshold, this may correspond to: • time to progression, defined as the time at which tumor size progresses beyond its initial size N 0 . 3 • time to treatment failure: the time at which tumor size progresses beyond an hypothetical maximal tolerable tumor size N tol ≥ N 0 , after which the life of the patient is considered at risk or side-effects of the disease are too strong. 4 • survival time, defined as the time at which tumor size becomes larger than a critical size N crit ≥ N tol .
Mathematically, results on time to progression and survival time may be obtained through results on time to treatment failure by taking N tol = N 0 , or N tol = N crit , respectively. For this reason, we focus on time to treatment failure. We consider the following treatments: • Constant dose treatments, including No treatment (noTreat): L(t) = 0, and Maximal Tolerated Dose (MTD): L(t) = L max throughout.
• Delayed MTD (del-MTD): do not treat until N = N tol for the first time, then treat at L max for ever.
• Containment at N tol (Cont): do not treat until N = N tol and then stabilize tumor size at N tol , as long as possible with a treatment level L(t) ≤ L max . Finally, treat at L max when N > N tol . Formally, during the stabilization phase, the treatment level is chosen so that dN/dt = 0 (e.g., Model 2). Containment treatments are illustrated in The times to treatment failure under these treatments will be denoted by t noT reat , t M T D , t delM T D , t Cont , t Int , and t alt , respectively.
Following (Martin et al. 2012 [29], Hansen et al. 2017 [19], Viossat and Noble 2021 [25]), we also consider idealized treatments, which assume that the sensitive population may be reduced arbitrarily quickly. These treatments are not realistic but are useful theoretical references. Ideal MTD(idMTD) eliminates all sensitive cells instantaneously at the beginning of treatment. Delayed ideal MTD (del-idMTD) lets tumor grow to N tol and then eliminates all sensitive cells. Ideal containment (idCont) lets tumor size grow to N tol , and then stabilizes it as long as some sensitive cells remain. Finally, Ideal intermittent containment (idInt) lets tumor size grow to N tol and then maintains it between N min ≤ N tol and N tol as long as some sensitive cells remain. 7 5 If, after crossing N tol , tumor size comes back to N tol , then the containment treatment stabilizes tumor size at N tol again, as long as possible. Similar remarks apply to intermittent containment or other variants of containment. 6 The above description is to fix ideas: our results are still valid for any other way of maintaining tumor size between Nmin and N tol , as long as this may be done with a dose L(t) ≤ Lmax. 7 Viossat and Noble assumed to fixed ideas and for simulations that, each time tumor size reaches N tol , it drops instantaneously to Nmin, or to R(t) if R(t) > Nmin, but this is not needed. Under these idealized treatments, treatment fails (i.e. tumor size progresses beyond N tol ) when the resistant population reaches size N tol . Sensitive cells have then been fully eliminated. Times to treatment failure are denoted by t idM T D , t del−idM T D , t idCont , and t idInt , respectively. 8 To make our life easy, we assume that all treatments we consider may be implemented through a piecewise continuously differentiable treatment level function L(t) (up to possible downward jumps in the sensitive population for idealized treatments), instead of deriving this result from the implicit function theorem and appropriate regularity assumptions.
Results
We show that, up to natural additional assumptions for comparisons of sensitive cell populations, all results of Viossat and Noble on Model 1 still hold on Model 3 (or equivalently Model 4), in spite of our less restrictive assumptions. The results are described below and proved in the next section.
The key point is that if treatment level is never larger than a given constant for treatment 1, and never smaller than the same constant for treatment 2, then the resistant population is no larger under treatment 1 than under treatment 2.
Proposition 1. Consider solutions of Model 4 associated to two treatments L 1 (t) and L 2 (t). 9 If there exists a constantL such that for all t ≥ 0, It follows that for constant dose treatments, lowering the dose or delaying treatment leads to a lower resistant population: Proposition 1 also implies that not treating minimizes the resistant population while MTD maximizes it: Of course, not treating is typically not an option, as the number of sensitive cells would explode, but containment is. One of our main results is that containment minimizes the resistant population among all treatments treating at L max after failing.
It follows that N Cont ≤ N alt +(S Cont −S alt ). Thus, assuming that the tumor is eventually mostly resistant under the containment treatment, tumor size should eventually be smaller, or at least not substantially larger under the containment treatment than under any alternative one. This suggests that, under our assumptions, among treatments that treat at L max when N > N tol , containment should be close to maximizing survival time. Similarly, the fact that the resistant population is larger under MTD that under any alternative treatment suggests that most alternative treatments should eventually lead to a lower tumor size and a longer survival time than MTD.
More precise statements may be made for idealized versions of containment and MTD: ideal containment maximizes time to treatment failure, while ideal MTD minimizes it among all treatments eliminating sensitive cells before failing. Moreover, ideal containment eventually leads to a lower tumor size and ideal MTD to a larger tumor size than any such alternative treatment.
Proposition 5. (comparison with ideal MTD and ideal containment) a) t alt ≤ t idCont . b) Consider an alternative treatment eliminating sensitive cells before failing, that is, such that S alt (t alt ) = 0. Then: In particular, survival time is larger with ideal containment and lower with ideal MTD than with any alternative treatment such that S alt (t alt ) = 0.
The next result shows that intermittent containment between N min and N tol > N min leads to outcomes that are intermediate between those of containment at the larger threshold N tol and those of containment at the lower threshold N min (ContNmin). The latter lets tumor size grow until N = N min (or treats at L max until N = N min if N 0 > N min ), and then stabilizes tumor size at N min as long as possible with a treatment level L(t) ≤ L max . In the idealized form, ideal containment at N min , tumor size is stabilized at N min as long as some sensitive cells remain (and initially instantly reduced to the maximum of N min and R 0 , if N min > N 0 ).
This result suggests that, if the lower threshold N min is close to the larger threshold N tol , there should be little difference between outcomes of containment and intermittent containment, that is, between a continuous low dose treatment based on dose modulation and an intermittent high dose treatment based on treatment vacation. Of course, this disregards many possible differences between these two approaches. For instance, dosemodulation might lead to a more regular vascularization of the tumor, which might be key for an efficient drug delivery (Enriquez-Navas et al., 2016 [2]).
We now compare all reference treatments.
Proposition 7.
(comparison between all reference treatments) a) For all t ≥ 0: Sensitive population sizes may also be compared under two mild additional assumptions: (A1) Not treating maximizes the sensitive population.
(A2) The sensitive population decreases if the tumor is treated at L max . These assumptions hold for Model 2, assuming L max ≥ 1, and for most models we are aware of. They lead to the same comparison for sensitive population sizes as in Viossat and Noble, that is, the opposite as for resistant population sizes.
Proofs
Viossat and Noble's proofs build on their Proposition 1, which gives conditions allowing them to compare the resistant populations or the sensitive populations under two different treatments. The following part of this result is still true in our framework, with the same proof: Consider two solutions (S 1 , R 1 ) and (S 2 , R 2 ) of Model 3, associated to treatment functions L 1 and L 2 , respectively. Assume What is no longer true is that the same conclusions hold if iiia) or iiib) is replaced by iiic): L 1 (t) ≤ L 2 (t) for all t. For instance, in Model 2, if L 1 (t 0 ) = L 2 (t 0 ) > 1, R 1 (t 0 ) < R 2 (t 0 ) and S 1 (t 0 ) = S 2 (t 0 ), then S 2 becomes immediately larger than S 1 . This will slow down the growth of the resistant population under treatment 2. Thus, conceivably, R 2 could later on become smaller than R 1 .
We thus use a new proof technique. Instead of studying directly the evolution of the resistant population R, the sensitive population S, or the total tumor size N as a function of time, we first study, and compare across treatments, the evolution of tumor size N as a function of the number of resistant cells. In other words, we compare trajectories in the R − N plane, that is, the sets of points (R(t), N (t)) for all t ≥ 0.
To be more formal, fix a treatment L, and let R ∞ = lim t→+∞ R(t). Since the resistant population increases continuously, for any r ∈ [R 0 , R ∞ ), there exists a unique time t(r) at which the resistant population has size r, that it, R(t(r)) = r. Denote byS(r),Ñ (r) =S(r) + r, andL(r), the number of sensitive cells, the total number of tumor cells, and the treatment level at time t(r), that is, when the resistant population reaches size r. All these functions may be shown to be piecewise continuously differentiable, andS 12 The only inequality that uses (A1) is S alt ≤ SCont.
andÑ are also continuous. The graph of functionÑ coincides with the trajectory of the solution in the R − N plane. It may be analyzed by noting that functionÑ satisfies the differential equation:
Key lemmata
Our first result shows that if, for any resistant population level r, tumor size is larger under treatment 1 than under treatment 2, then at any time t, the resistant population is smaller under treatment 1 than under treatment 2.
The intuition is the following: at the time t i (r) when the resistant population reaches size r under treatment i, the speed at which the resistant population increases is given by: Since f R is non-increasing in N , it follows that if N 1 (r) ≥ N 2 (r), the resistant population will increase quicker from r to r + dr under treatment 2 than under treatment 1 (dr is a small positive increment). If this holds for all resistant population sizes r, then R 2 will remain no-smaller than R 1 at all times t ≥ 0.
Assume now that for any resistant population level r, the treatment level when the resistant population reaches size r is lower for treatment 1 than for treatment 2. Our second result shows that the tumor size when the resistant population reaches size r is then always larger for treatment 1 than for treatment 2. By the previous lemma, this implies that the resistant population is always smaller under treatment 1 than under treatment 2.
Proof of propositions 1 to 8
Proposition 1 follows from Lemma 11, and Propositions 2 and 3 from Proposition 1.
Proof of Proposition 4. For later purposes, let us prove a more general result: This follows from Lemma 10 and the fact that, whenever these comparisons make sense: To prove (2), note that for any alternative treatment,Ñ idM T D (r) = r ≤ N alt (r), in particular,Ñ idM T D (r) ≤Ñ M T D (r), and by Lemma 11 withL = 0,Ñ alt (r) ≤Ñ noT reat (r), in particularÑ Cont (r) ≤Ñ noT reat (r). Moreover, under the constraint L alt (t) ≤ L max , it follows from Lemma 11 withL = L max thatÑ M T D (r) ≤Ñ alt (r). It remains to prove thatÑ alt (r) ≤Ñ Cont (r) for all r ∈ [R 0 , R * ), where R * = min{R ∞ alt , R ∞ Cont }. The notation we introduce is illustrated in Fig. 4. Let r 1 = min{r ≥ R 0 ,Ñ Cont (r) = N tol }. When r ≤ r 1 ,Ñ Cont (r) = N noT reat (r) ≥Ñ alt (r) as explained above. Moreover, for all r ≥ r 1 ,Ñ Cont (r) ≥ N tol . Thus, assuming by contradiction that there exists r 2 ≥ r 1 such that N Cont (r 2 ) <Ñ alt (r 2 ), it follows thatÑ alt (r 2 ) > N tol . Let Note that sinceÑ alt (r 1 ) <Ñ Cont (r 1 ) = N tol , we must have r max ≥ r 1 . Therefore,Ñ alt (r max ) = N tol ≤Ñ Cont (r max ). Moreover, on (r max , r 2 ), N alt (r) > N tol , henceL alt (r) = L max ≥L Cont (r). By a variant of Lemma 11 (comparing treatments starting when the initial resistant population size is r max rather than R 0 ), it follows thatÑ alt (r 2 ) ≤Ñ Cont (r 2 ), a contradiction. Proof of Proposition 5. Proof of a): Let t 1 = min{t ≥ 0, N Cont (t) = N tol }. For t ≤ t 1 , R idCont (t) = R noT reat (t) ≤ R alt (t) (the inequality follows from Proposition 3). If t alt ≥ t 1 then, as in Viossat and Noble, on [t 1 , t alt ], Proof of b): assume now that S alt (t alt ) = 0 (which only makes sense for idealized alternative treatments). Then R alt (t alt ) = N alt (t alt ) = N tol . Thus, as in Viossat and Noble: so t idM T D ≤ t alt . This proves b1). Let us prove the remaining results on ideal MTD. The inequality R alt ≤ R idM T D was shown in the proof of Proposition 4 (see Eq. 1). Moreover, on This proves parts of b2) and b3).
We now prove the results on ideal containment. On [t alt , t idCont ], where the last inequality comes from the fact that for all t ≥ t alt , S alt (t) = 0. Moreover, after treatment failure, R alt and R idCont both satisfy the autonomous equation dR/dt = f R (0, R). By invariance of solutions of autonomous equations through translation in time, this implies that for all . This completes the proof.
Proof of Proposition 6. Proof of a): The inequalities R Cont ≤ R Int and R idCont ≤ R idInt follow from the proof of Proposition 4 (see Eq. (1)) and from Proposition 5. The fact that R Int ≤ R ContN min follows from Lemma 10 and the fact that, as shown below: for all r,Ñ ContN min (r) ≤Ñ Int (r).
To prove this, note that for r ≤ r min := min{r ≥ R 0 ,Ñ noT reat (r) = N tol }, both treatments coincide soÑ ContN min (r) =Ñ Int (r). For r ≥ r min , the argument is as in the proof ofÑ Cont (r) ≥Ñ alt (r) for r ≥ r 1 in Proposition 4. Similarly, it is easily seen thatÑ idContN min (r) ≤Ñ idInt (r) for all r, so R idInt ≤ R idContN min by Lemma 10.
The second inequality follows from item a) of Proposition 5.
Proof of c): Using a), for t ≥ t idInt , N idInt = R idInt ≤ R idContM in = N idContM in , and the first inequality follows from item b3) of Proposition 5.
Proof of Proposition 7. Proof of a1): to see that R Int (t) ≤ R del−M T D (t), note that as long as tumor size is lower than N tol , both treatments coincide, then apply Proposition 3 from that point on. The other inequalities have already been proved. The proof of a2) is similar.
Proofs of b) and c): in b), the inequality t del−idM T D ≤ t idInt follows from item b1) of Proposition 5, applied from the (common) time when tumor size reaches N tol under both treatments, other inequalities were shown already. The proof of c) is as in Viossat and Noble.
Proof of Proposition 8. We first need a lemma. b) Under containment (respectively, containment at N min ), once tumor size reaches N tol for the first time (respectively, N min ), the sensitive population is non-increasing.
Proof. a) The idea is that when N > N * , S is non-increasing by assumption, and when N (t) ≤ N * for t >t, the sensitive population must have decreased since timet because the resistant population increased (by assumption) and total tumor size did not. Formally, let t ≥t. If for all τ in (t, t), N (τ ) > N * , hence L(τ ) = L max , then S is non-increasing on [t, t] by assumption, therefore S(t) ≤ S(t). Otherwise, let t max = max{τ ≤ t, N (τ ) ≤ N * }. The previous argument implies that S(t) ≤ S(t max ). Moreover, since R is increasing, Therefore, S(t) ≤ S(t). Finally, if for any t 1 ≥t, N (t 1 ) ≥ N * , then the previous result applied from t 1 on shows that for any t 2 ≥ t 1 , S(t 2 ) ≤ S(t 1 ), hence S is non-increasing on [t, ∞). b) For containment, this follows from a) with N * = N tol and the fact that once tumor size reaches N tol under containment, it never becomes smaller. The proof for containment at N min is the same with N min replacing N tol .
We now prove Proposition 8. Proof of a): the first inequality is trivial since S idM T D = 0 (we only mentioned it to show that all inequalities from Eq. 1 are reversed). The inequality S M T D (t) ≤ S alt (t) follows from Lemma 10, the fact thatÑ M T D (r) ≤Ñ alt (r) (see Eq. (2)), and the fact that S M T D (r) is non-increasing by Assumption (A2). The last inequality follows from Assumption (A1), or, independently of (A1), from Lemma 10, the fact thatÑ Cont (r) ≤Ñ noT reat (r) (see Eq. (2)), and that once Containment starts treating, S Cont is non-increasing (Lemma 12, item b)).
Let us now prove that S alt (t) ≤ S Cont (t). Let , it follows from Lemma 12 that S Cont is non-increasing on [t(r 1 ), +∞[, so S Cont (t) ≥ S ∞ Cont . Thus, it suffices to show that S alt (t) ≤ S ∞ Cont . There are two cases. Case 1: IfÑ alt (R ∞ Cont ) ≥ N tol , then by Lemma 12, for all t ≥ t alt (R ∞ Cont ), where the last inequality follows from the fact that for r < R ∞ Cont ,S alt (r) ≤ S Cont (r) due to Eq. (1), so that Moreover, if at some timet, N alt (t) = N tol (which must indeed happen), then S alt (t) ≤ S ∞ Cont by the previous argument, and for all t ≥t, by Lemma 12, S alt (t) ≤ S alt (t) ≤ S ∞ Cont . This concludes the proof of a). Proof of b): The inequality S ContN min (t) ≤ S Int (t) follows from Lemma 10, the fact thatÑ contN min (r) ≤Ñ Int (r), and the fact that once tumor size reaches N min , S ContN min is non-increasing (Lemma 12, item b)). The proof of S Int (t) ≤ S Cont (t) is as the proof of S alt (t) ≤ S Cont (t) (except that Assumption (A1) is not needed). Finally, the inequality S del−M T D ≤ S Int follows from S M T D ≤ S alt applied from the time at which tumor size reaches N tol .
Proof of c): we first prove S idContN min ≤ S idInt . Before tumor size reaches N min , both treatments coincide, then until t idContN min , Proof of d): the first two inequalities are trivial, the third one was proved in c). The last inequality follows from (A1) but also, independently of (A1), from the following argument: for t ≤ t idCont , N idCont ≤ N noT reat while R idCont ≥ R noT reat by Proposition 7, so S idCont ≤ S noT reat , and for t ≥ t idCont , S idCont = 0.
Discussion
Viossat and Noble [25] provided qualitative conditions ensuring that a strategy aiming at containment, not elimination, minimizes resistance to treatment and is close to maximizing time to treatment failure. Some of these conditions were however debatable. In particular, their analysis did not allow for mutations from sensitive to resistant cells, a major concern of some key contributions to the field (Martin et al. 1992 [16], Hansen et al. 2017 [19]), and did not apply to Norton-Simon models [27], which are standard to model chemotherapy. We showed how a refined analysis allows to handle these two issues. This suggests that containment strategies are likely to perform well in more general situations than was previously known.
While Viossat and Noble compared across treatments the values of resistant and sensitive populations as a function of time, we first compare the induced trajectories in the R-N plane, that is, tumor sizes not at a given time, but when the resistant population reaches a given size. We made the additional assumption that the resistant population keeps increasing. This is consistent with the assumption that in the presence of fully resistant cells, the tumor is incurable, and is technically helpful (as the trajectory in the R-N plane is then the graph of a function), but we conjecture that our results hold without this assumption.
What is crucial is that, all else being equal, a larger sensitive population leads to a lower resistant population growth-rate. For this reason, our analysis only allows for mutations from sensitive to resistant cells if an increase in the sensitive population size is more detrimental to the growth of the resistant population (through competition, or some other form of inhibition of resistant cells by sensitive cells) than it is beneficial (through mutations from sensitive to resistant cells). We show in Appendix A that this is typically the case for Gompertzian growth, or power-law models, at least in the absence of a strong resistance cost. 13 There are however many other concerns with containment. Mutations, or phenotypic switching, could be modeled in other ways, and the fact that maintaining a relatively large tumor burden may lead to an accumulation of driver mutations remains a concern. Modeling patient death as occurring when the tumor reaches a critical size favors containment, and models in which the probability of death increases continuously with tumor size may lead to the conclusion that the expected survival time is lower under containment strategies than under more aggressive treatments (Mistry 2020 [30]). Considering only two types of tumors cells is restrictive, and even with only two types, if resistant cells are only partially resistant, the logic changes, as the growth of resistant cells may be slowed down not only indirectly, through competition with sensitive cells, but also directly, through treatment effect. The impact of a containment strategy on the development of new metastases is also unclear. On the other hand, we did not consider additional benefits of containment, such as reduced treatment toxicity, less drug-induced mutations (Kuosmanen et al. 2021 [31]) or a possible stabilization of tumor vasculature that could increase the efficiency of drug delivery (Enriquez-Navas et al. 2016 [2]).
This article should not be seen as providing unambiguous support for containment strategies, but as part of a wider research program aiming at clarifying the conditions under which a strategy aiming at tumor stabilization is likely to perform better than a more aggressive treatment. Data allowing to fine-tune models is still scarce, but as new competition experiments are run, and new clinical trials open (NCT05393791, ACTOv/NCT05080556), more data should become available, allowing the community to reach more definite conclusions.
Acknowledgments
This program has received funding from the European Union's Horizon 2020 research and innovation programme under the Marie Sk lodowska-Curie grant agreement No 754362.
A Mutations from sensitive to resistant cells
The analysis in this appendix is related to the work of [16] and Hansen et al. (2017) [19]. Consider a basic Norton-Simon model with mutations (Norton and Simon 1977 [27], Goldie and Coldman 1979[32], Monro and Gaffney 2009 [17]): where τ 1 and τ 2 are mutation and backmutation rates. Taking g(N ) = ρ ln(K/N ) leads to a version of Model 2 with mutations: the original Monro and Gaffney model (Monro and Gaffney, 2009 [17]). If the growth-rate function g is decreasing in N , an increase in the size of the sensitive population leads to two opposite effects: it slows down the development of existing resistant cells (the competition effect), but usually increases the number of mutations from sensitive to resistant cells (the mutation effect). This trade-off has been studied by Martin et al. (1992[16]) and Hansen et al. (2017[19]). Here, we study whether such a model is compatible with our assumption that, during treatment, a larger sensitive population leads globally to a lower growth-rate of resistant cells. To do so, let φ R denote the growth-rate function of resistant cells: Denoting by x r = R/N the resistant fraction, it is easily checked that ∂φ R /∂S ≤ 0 if and only if: Since the resistant fraction increases during treatment, this condition is bound to be hardest to satisfy at treatment initiation. The resistant fraction obtained from Model 5 for the initial condition S = 1, R = 0 is then (Goldie and Coldman, 1979[32]): where we used the approximation N −τ 1 − τ ln N for τ small. Injecting (4) into (3) and using that τ 1 and τ 2 are much smaller than 1 leads to: Let us now consider various growth-models. Case 1 (power-law model): g(N ) = ρN −γ with 0 < γ < 1. Eq. (5) becomes: ln N 0 + 1 ≥ 1/γ.
Typical choices for γ are γ = 1/3 or γ = 1/4 (Gerlee, 2013 [28]; Benzekry et al., 2014 [33]; our γ corresponds to 1 − γ in these references). The condition then holds by a huge margin for any detectable tumor size. Case 2 (Gompertzian growth): g(N ) = ρ ln(K/N ). Eq (5) becomes: Standard values of the carrying capacity in Gompertzian models are in the range 10 12 − 10 13 (e.g., K = 2 × 10 12 in Monro and Gaffney (2009) [17]). Eq. (5) is then satisfied for any detectable tumor size. Case 3 (logistic growth) : g(N ) = ρ(1 − K/N ). Eq (5) becomes: This condition need not be satisfied, depending on the interpretation of the model and parameter choices. For instance, Monro and Gaffney (2009) [17] take N 0 = 10 10 . Then ln N 0 23 and the condition is roughly K ≤ 2.5 × 10 11 , which is not satisfied for standard values of the carrying capacity K. 14 The condition would however be satisfied for larger initial tumor sizes, modeling late-stage treatments. Actually, when logistic growth models are used in the adaptive therapy literature, the initial tumor size is often assumed to be a large fraction of the carrying capacity (e.g., Zhang et al. 2017 [6], Strobl et al. 2020 [9], Mistry 2020 [30]). This may be interpreted as modeling late-stage treatments, or as a model of local growth. In the latter case, the carrying capacity should be seen as the maximal number of cells for the current tumor volume (or equivalently, the variables N , S, R, K should be interpreted as densities). Assuming 10 10 tumor cells at tumor initiation, the estimate x r /τ 1 23 would still be valid, and Eq. (3) would become K/N ≤ 25, which is bound to be satisfied in a model of local growth.
Let us now consider three variants of Model 5. Variant 1: birth-death model. In Model 5, the number of mutations is assumed proportional to the net growth-rate of the tumor. It would be natural to assume that the number of mutations is proportional to the net birth-rate. This would increase the effective mutation rate (that is, the average number of mutations relative to a given increase of tumor size). 15 However, since the condition we found is insensitive to the precise mutation rates τ 1 and τ 2 , this is unlikely to affect the previous analysis.
Variant 2: late-stage treatment. The previous analysis is better suited for a first line treatment than a second or third line treatment, especially if resistance to the first treatment may be associated with resistance to ulterior ones. However, in such a situation (late-stage treatment), the initial resistant population is likely to be larger than the one given by (4), and so condition (3) is more likely to be satisfied. The condition for ∂φ R /∂S to be nonpositive becomes: Moreover, if ρ r is substantially smaller than ρ s , then the resistant fraction at treatment initiation is no longer given by (4) but approximately by (see Viossat and Noble, 2020[34], Section 7): x r = τ 1 1 − ρ r /ρ s .
With logistic growth, the right-hand side is K/N − 1 and the condition may be written as ρ r /ρ s ≥ (K − 2N )/(K − N ). 16 Assuming for instance ρ r /ρ s = 4/5, this boils down to K ≤ 6N . This would not be satisfied at treatment initiation if N and K represent total numbers of cells in the whole tumor (except possibly for a late-stage treatment), but seems likely to be satisfied in a model of local growth.
We conclude that in the absence of resistance costs, our analysis applies to several standard models of tumor growth with mutations, such as Power-law models or Gompertzian growth, and possibly to logistic growth, at least when it models local growth. However, if the baseline growth-rate of resistant cells is substantially smaller than the baseline growth-rate of sensitive cells, our assumptions become more restrictive and might fail even for Gompertzian growth. This is in line with Hansen et al.'s (2017) [19] finding that, contrary to common wisdom, a resistance cost in the baseline growth rate may make it less likely that containment strategies outperform more aggressive treatments. Note however that the fact that we can no longer prove that containment outperforms MTD does not mean that it would not do so. Moreover, the analysis of Viossat and Noble (2020) [34], Section 7 of the supplementary material, suggests that the mutation effect could only make MTD marginally superior to containment.
We thus need variants of Proposition 13 where f is slightly less regular. The proof of these variants consists in repeated applications of Proposition 13.
Proposition 14. The conclusion u(t) ≤ v(t) on [t 0 , t 1 ] of Proposition 13 still holds in the following cases: a) if f takes the form f (t, x) = ψ(t, x, φ(t)), where ψ is continuously differentiable and φ is strongly piecewise C 1 .
b) if f is a function of x only (f : I → R, where I is a nonempty interval) which is strongly piecewise C 1 , and u and v are strictly increasing.
increasing, there exists an integer q ≤ 2(n + 1) and a sequence of times τ 0 = t 0 < τ 1 < ... < τ q = t 1 such that on (τ j , τ j+1 ), u(t) and v(t) are never equal to one of the x k . Assuming u(τ j ) ≤ v(τ j ), then either: for all t in [τ j , τ j+1 ), u(t) and v(t) belong to the same interval [x k , x k+1 ) and Proposition 13 implies that u(t) ≤ v(t) on [τ j , τ j+1 ); or there exists k such that for all t in [τ j , τ j+1 ), u(t) ≤ x k ≤ v(t) and the same inequality holds trivially. In both cases, u(τ k+1 ) ≤ v(τ k+1 ) by continuity of u and v. An induction argument then gives the result.
|
v2
|
2022-12-01T15:08:29.545Z
|
2022-11-30T00:00:00.000Z
|
254099204
|
s2orc/train
|
Analyzing PKC Gamma (+ 19,506 A/G) polymorphism as a promising genetic marker for HCV-induced hepatocellular carcinoma
Background HCC is a major health concern worldwide. PKC gamma, a member of the conventional PKC subclass, is involved in many cancer types, but the protein has received little attention in the context of single nucleotide polymorphisms and HCC. Therefore, the study aims to investigate the association of PKC gamma missense SNP with HCV-induced hepatocellular carcinoma. Methods The PKC gamma nsSNPs were retrieved from the ENSEMBL genome browser and the deleterious nsSNPs were filtered out through involvingPredictSNP2, CADD, DANN, FATHMM, FunSeq2 and GWAVA. Among the filtered nsSNPs, nsSNP rs1331262028 was identified to be the most pathogenic one. Through involving I-TASSER, ProjectHOPE, I-Mutant, MUpro, mCSM, SDM, DynaMut and MutPred, the influence of SNP rs1331262028 on protein structure, function and stability was estimated. A molecular Dynamic simulation was run to determine the conformational changes in mutant protein structure compared to wild. The blood samples were collected for genotyping analysis and for assessing ALT levels in the blood. Results The study identified for the first time an SNP (rs1331262028) of PRKCG to strongly decrease protein stability and induce HCC. The RMSD, RMSF, and Rg values of mutant and wild types found were significantly different. Based on OR and RR values of 5.194 and 2.287, respectively, genotype analysis revealed a higher correlation between the SNP homozygous wild Typeform, AA, and the disease while patients with genotype AG have higher viral load. Conclusion Outcomes of the current study delineated PKC gamma SNP rs1331262028 as a genetic marker for HCV-induced HCC that could facilitate disease management after further validation. Supplementary Information The online version contains supplementary material available at 10.1186/s40364-022-00437-6.
Background
The human genome possesses various types of variation, and most abundant among these variations are SNPs (Single Nucleotide Polymorphisms). There are roughly 3-11 million SNPs, which compose almost 1% of the whole genomeCite ESM [1]. nsSNPs (non-synonymous SNPs) reside in the coding region and cause a change in the amino acid sequence, which may have neutral or deleterious effect on the protein [2][3][4]. Alteration in protein hydrophobicity, protein charge disturbance, change in protein geometry [5], altered stability, dynamics, translation and protein-protein interactions are as a result of nsSNPs [6][7][8]. GWAS(Genome Wide Association Studies) have identified thousands of SNPs in different genes including IL-28B, PNPLA3, KIF1B, PGD, UBE4B, MICA, and MDM2 that were associated with HCC (Hepaocellular Carcinoma) [9][10][11][12]. Poor prognosis in HCC is largely due to late diagnosis that renders traditional chemotherapy ineffective [13][14][15][16]. The SNPs and genetic variations have been identified as biomarkers [17]. Additionally, a lot of HCC-related biomarkers discovered so far are not sufficient to detect HCC at early stages and the detection is often missed, highlighting the need for novel biomarkers.
The protein kinase C gamma isoform belongs to the large family of PKC (Protein Kinase C) proteins. This enzyme is a serine/threonine-specific protein kinase, encoded by the PRKCG (Protein Kinase C Gamma type) gene located on chromosome 19 at position 19q13.2-q13.4 [18][19][20][21]. Moreover, the role of PKC gamma in the development and progression of cancer is well established [19]. Several studies have reported that PKC gamma is associated with cancer at different stages, i.e., glioma, kidney cancer, colon cancer and liver cancer [19]. However, all those studies established the role of PKC gamma in cancer progression and development. Its differential expression in various cancers does not provide sufficient information about the role of genetic polymorphism and its association with carcinogenesis. Missense SNPs in the PRKCG potentially affect its protein structure and function and thus may increase the likelihood or susceptibility of hepatocellular carcinoma development or progression. Moreover, knowing SNPs association with disease might improve the effectiveness of screening programs.
The aim of the study was to find the most deleterious variant in PRKCG gene through bioinformatics approach and determine the influence of that variant on the structure and function of the PKCγ protein.
The study further aimed to determine the association between PRKCG variant (rs1331262028) and HCVinduced HCC. This research study has for the first time found a novel nsSNP (rs1331262028) within the family of cPKCs and proposes that the identified nsSNP can serve as a promising genetic marker mainly for HCV (Hepatitis C Virus)-induced HCC.
Data retrieval and structure prediction
The protein sequence of PKC gamma (ENST00000263431.4) was retrieved from ENSEMBL Genome Browser and missense SNPs were selected and retrieved from the variant table. These missense SNPs were then subjected to different toolsi.e, PredictSNP2, CADD, DANN, FATHMM, Fun-Seq2 and GWAVA to classify them as neutral or deleterious [22]. After further filtering, SNPs were sorted out that were predicted deleterious by all the six tools. Furthermore, Inter-Pro [23] was used to determine the PKC gamma domains and their function. The selected nsSNPs were further analyzed to establish the impact of residue change on protein stability, structure and function. The amino acid sequence of the protein PKC gamma was submitted to I-TASSER [22] for structure remodeling and prediction. Among the five predicted model via I-TASSER, model 3 was selected based on C-score and InterPro analysis. The schematic representation of the study plan is shown in Fig. 1.
Stability and structural analysis
Altered amino acid sequence may affect the stability of the protein. To analyze the effect of nsSNP on protein stability, five different web-based tools were used; i.e., I-Mutant [24], MUpro [25], DynaMut [26], mCSM [27] and SDM [27].The amino acid sequence in FASTA format was used as input for both I-Mutant and MUpro. ProjectHOPE [25] was also used, with the amino acid sequence of PKC gamma used as input. Substitution and amino acid positions were selected in the subsequent steps. A comprehensive report was generated at the end that provided information regarding impact of amino acid change on protein structure and hence its function. MutPred [25] was also used to predict the impact of amino acid change on protein structure and function.
Molecular dynamic (MD) simulations
Molecular dynamic simulation for both wild type and mutated proteins was carried out via GROMACS software [24] to analyze the impact of residue change at different time scale in dynamic environment. Wild and mutated protein's PDB (Program Database) were used as initial input in the simulation. The cubic box was generated and the system was solvated using water molecules and then neutralized with Na + /Cl ions.The original MD simulation's energy was minimized using steepest descent with a total of 50 000 steps, and then NVT and NPT equilibrium was achieved. After the simulation was run for both wild and mutated protein, the trajectory analyses command was entered (gmx_trjconv) followed by gmx_rms (for Root mean square deviations (RMSD) calculation), gmx_rmsf (for Root mean square fluctuations (RMSF) calculation),gmx_gyrate (for radius of gyration (Rg) calculation) and gmx_hbond (for number of hydrogen bonds calculation). The results obtained were then plotted graphically.
Primer designing
The PCR (Polymerase Chain Reaction) primers were designed computationally via Primer1 [28]. The genome sequence mapped from chromosomal assembly 38. p13. was used as input in Primer1. SNP position and allele difference was selected, and the remaining options were kept as default.
Genotyping and DNA Extraction
The collection of blood sample was approved from IRB (Institute Review Board), ASAB, NUSTand was conducted with the consent of the patients. The samples from a total of 100 HCV-induced HCC patients and 100 HCV negative controls were collected for genotyping analysis. For the inclusion criteria, only those patients that were HCV positive with confirmed HCC were included, while the controls that were HCV positive were excluded and only HCV negative patients i.e. healthy individuals were made the part of the study. All the HCV induced HCC patients were diagnosed at early stages. The information regarding the age and gender of patients and controls have been provided in Supplementary File 1, Table 1.
The genomic DNA was extracted from all the samples using phenol-chloroform/organic method [29] and the DNA was then visualized through gel documentation system. Furthermore, ARMS-PCR (Amplification Refractory Mutation System-Polymerase Chain Reaction) was performed to detect single nucleotide change in PRKCG. Two sets of primers, 2 outer (forward with sequence 5' GGT AGG AGG GTG GCCA3' and reverse with sequence 5' CCG TCC CCT CAA GGAG 3') and 2 inner (forward with sequence 5' TTC CTC ATG GTT CTA GGC AG 3' and reverse with sequence 5' ACC TTC CCA AAA CTG CAT T 3') were used. The inner primers were SNP specific and used for detection. The product size of the two outer primers was 476 and the product size of forward inner primer (G allele) was 224, while the product size for reverse inner primer (A allele) was 291.
ALT (Alanine Aminotransferease) Test
The ALT test was performed for both patients and control samples to evaluate the effect of viral induced HCC on liver. The ALT kit was purchased from Merck (Darmstadt, Germany). Blood samples of both patients and control were collected in EDTA (Ethylene diamine tetraacetic acid)-vacationers' tubes that were purchased from Becton, Dickinson and Company, USA. The manufacturer's Table 1 List of different computational tools that were used to predict pathogenicity of nsSNP, their scoring criteria and classification
Tools
Score Range Classification
Neutral Deleterious
PredictSNP2 protocol of ALT kit was followed. The ALT concentration was checked through Microlab 300 semi-automated spectrophotometer at 340 nm.
Viral RNA Extraction
To analyze the viral load in patient sample, viral RNA was extracted from the blood viaFavorPrep ™ Viral DNA/ RNA Kit (catalog no.FAVNK 001-1). 200 µl of blood was placed in an eppendorf tube and 500 µl of VEN buffer was added and vortexed for 5-7 s. 500 µl of 75% ethanol was added to the tube and again vortex was done for at least 5-7 s.The sample was transferred to the spin column and centrifuged at 8000 rpm for 1 min. The collecting tube was discarded, and the filter tube was put in a new tube. 500 µl of wash buffer 1 was then added and again centrifuged at 8000 rpm for 1 min. The collecting tube was changed and 750 µl of wash buffer 2 was added and centrifuged at 14000 rpm for 1 min. This step was repeated twice so the filter gets dried. Filter tube was transferred to Eppendorf tube and 50 µl of RNAase free water was added at the end and centrifuged again at 8000 rpm for 1 min. The RNA sample was transferredto tube and kept at -20 °C.
Quantitative Reverse Transcriptase Polymerase Chain Reaction (qRT-PCR)
Real time qRT-PCR using SYBR green dye was used to simultaneously amplify and quantify viral RNA. For cDNA preparation, FIREScript ® RT cDNA synthesis KIT was used that was purchased from SOLIS BIODYNE (Catalog number 06-15-0000S)0.6 µl of each viral sample, 43 µl of master mix and 1.2 µl of reverse transcriptase enzyme was mixed in single PCR tube. Two standards of known concentration, one lower and one upper limit, were used to determine the viral load of the samples. A plot was generated after the viral concentration was compared with standard curve, which provided the starting quantity of the template molecule on x-axis against the CT (Cycle Threshold) on Y-axis. The PCR conditions included initial denaturation at 95 °C for 5 min, annealing at 65 °C for 60 min, and extension at 72 °C for 10 min.
Data processing and filtration
The ENSEMBL genome browser provided a total of 429 non-synonymous SNPs, which were then subjected to six different tools (PredictSNP2, CADD, DANN, FATHMM, FunSeq2 and GWAVA) to analyze their impact on protein structure and function. The nsSNPs were filtered that were predicted as pathogenic/deleterious by at least 3 to 4 bioinformatics tools based on scores (Table 1, Supplementary File 2, Table S2). After final filtering, 5 SNPs were sorted out that were predicted deleterious by all the six tools (Supplementary File 3, Table S3). rs1331262028 with genomic coordinates, + 19,506 A/Gwas selected because it has high pathogenicity scores, also it caused the change in the kinase domain of PKC gamma (K359R). The kinase domain of protein performs catalytic functions [17]. It has been known that SNPs located in kinase domain tends to increase the likelihood of cancer development [17]. Table 2 and Fig. 2 show changes in the stability, energy, and alteration of other protein functions upon mutation.
PKC gamma three-dimensional (3D) Structure Prediction
The 3-dimensional structure of PKC gamma was predicted via I-TASSER, which is advanced and reliable tool to predict protein structure based on multiple threading approach. I-TASSER predicted 5 different models. Among the five models, model 3 was selected because it has the lowest C-score (-2.53). The protein folding was then visualized through PyMol. The protein structure was computationally validated via InterPro, an online tool, by categorizing proteins in families and predicting different domains in the proteins. InterPro predicted four domains and other regions in the PKC gamma (Fig. 3). Moreover, the Wild PKC gamma structure and mutated structure of PKC gamma structure (K359R) was aligned using PyMol (Fig. 3).
Molecular Dynamics of PKC gamma
After the simulations were run for both wild type and mutated PKC gamma structure, files were generated and data from those files were plotted on graphs to interpret simulation results. Four parameters were considered, i.e., RMSD, RMSF, radius of gyration and number of hydrogen bonds to analyze the difference in wild type and mutated protein. RMSD analysis revealed that the mutated protein deviates significantly from its reference position compared to wild type. When compared to the wild-type structure, the mutant protein displayed a gradually rising RMSD value with fluctuations (Fig. 4a). The highest RMSD value for mutant structure was recorded at 1.39 nm when the time had reached 19 ns. RMSF analysis showed the difference in the fluctuation of wild type and mutated protein residues. The region from 170-267 and 448-656 residues of the mutated protein had significant fluctuation from its mean point, which indicated that the protein structure expands over time. The comparison between wild type and mutated protein residue fluctuation is shown in Fig. 4b. The evaluation of radius of gyration calculated for both proteins showed a sharp increase in mutated protein peak up to 3.49 nm at 2.3 ns and gradual decrease to 3.3 nm as simulation run for 3.9 ns. From 6.8 to 12.9 nm, the gyration of mutated protein seemed to be at a steady phase, followed by gradual decrease to 3.1 nm as the simulation reached 13.3 ns. The radius of gyration of mutated protein remained stable to 19.2 ns, but at the end a significant decrease was shown. This data showed that the mutated protein loss its compactness at the start of simulation and became more compacted at the end. The significant difference in the two proteins Rg is represented in Fig. 4c. The hydrogen bonds number in mutated and wild type PKC gamma shows no significant difference as only a single amino acid was changed. The lines of both wild type and mutated proteins are overlapped over each other as shown in Fig. 4d that show there is no marked difference.
Association of PRKCG SNP rs1331262028 with HCV associated HCC
For the analysis of the HCV associated HCC genotype data, the results showed high association of the SNP homozygous wildtype form (AA) with the disease as Fig. 4 Graphical representation of MD simulation data. a RMSD graph representing the significance difference in the deviation pattern between wild type and mutated protein over time, b Amino acid residues of both wild type and mutated protein were plotted on x-axis against RMSF values on y-axis to analyze the difference in the fluctuation of both proteins from the reference point, c Radius of gyration of both wild type and mutated protein shows the compactness of protein in a dynamic setting as the simulation proceeds and d Represents the difference in the number of hydrogen bonds between wild type and mutated protein as simulation proceeds compared to homozygous GG and heterozygous AG genotypes based on OR and RR of 5.194 and 2.287, respectively, (P-value < 0.0001). The polymorphism in this allele may reduce the risk of disease occurrence. Table 3 shows the genotype data of patients and control.
Association of PRKCG SNP rs1331262028 with gender in HCV associated HCC
The comparison of male and female patients with the controls replicate the results described in Table 2.
The homozygous allele AA in both males and females was found to be associated with HCC. The OR (Odds Ratio) and RR (Relative Risk) for males was 6.021 and 2.310, respectively, and that of females was 4.737 (OR) and 2.291 (RR). The P-value for male and female having allele AA was < 0.0001 and 0.0002, respectively, emphasizing the significance of the results. The allelic data for gender is represented in Table 4.
ALT enzyme level in Patient Vs Control
The mean ALT levels of HCC patients were significantly higher when compared with the control samples. The average concentration of ALT in patients was 107 U/L, which was considerably higher from the normal ALT range of 7-40 U/L. The control sample showed mean ALT levels; under 40U/L. Figure 5a represents the comparison of ALT concentration in patient vs controls.
Interplay of viral load with alleles of PKC gamma SNP rs1331262028 towards pathogenesis
Viral load was determined in HCC patient and control samples by qRT-PCR. The analysis of viral load against genotype showed a significant difference. The average viral load for genotypes AA, GG and AG was analyzed; and indicated that patients with AG allele had significantly high (819,438,471 copies/ml) viral load compared to patients with AA and GG alleles (Fig. 5b). These results suggest a potential correlation of viral load and genotype.
Discussion
HCC is caused by several genetic and environmental factors. Among these, large proportion of HCC cases occurred because of viral infection [11]. HCV-mediated HCC prevalence is increasing globally specifically in developing countries [11]. The major problem in most cancers is the early detection. The SNPs affect different clinical parameters including staging, metastatic potential and treatment outcome [30,31]. The studies indicate that the focal lesions (size and number) and portal vein invasion also correlate with gene polymorphisms [30]. So, the genotype association of PKC gamma with HCV induced HCC can be used as prognostic marker and studying SNPs can help indicate the detection of the disease in early stages and HCC is no more different. Therefore, the aim of this study was to investigate the association of PKC gamma missense SNP with HCV induced Hepatocellular carcinoma pathogenesis. PRKCG protein model predicted via I-TASSER belong to conventional PKC (cPKC) class that comprise of PKC alpha, PKC beta1 & 2 and PKC Gamma. The genotype association of PKC gamma with HCV induced HCC can be used as prognostic marker for the early diagnosis of the disease. The mutation in PKC gamma at position 359 from lysine to arginine falls within the kinase domain, which is present in all the members of conventional PKC [32]. As the two residues differ in size and charge, so it was estimated by Project HOPE that it might disturb the function of kinase domain of the protein considering the steric hindrance in that region. Additionally, protein mass and charge variations influence the spatiotemporal dynamics of interactions between proteins [17]. From MutPred, it was predicted that the mutation may cause loss of ubiquitination at K359 (P = 0.027); Gain of methylation at K359 (P = 0.0351); Gain of sheet (P = 0.0827); Gain of phosphorylation at S361 (P = 0.0876); Gain of MoRF binding (P = 0.1603). Moreover, it can be deduced that these changes could perturb the interactions with ATP as well. ATP interacts with the binding cleft/pocket of catalytic domain and mutation at that region notably affects and disconnects the favorable interactions [17]. Overall, all the predictions made by ProjectHOPE, I-Mutant, MUpro, mCSM SDM, DynaMut and MutPred in the study implicated that these changes expectedly lead to loss of thermodynamic stability. The I-TASSER model we chose was based on the C-score and InterPro prediction. It has been previously established that there is 40% similarity in protein sequence between cPKC and protein kinase A. I-TASSER has also been previously used in different studies to predict protein 3D model i.e., TAGAP, CCR6 and TOX3 [33][34][35]. The selection of I-TASSER was based on automated assessment of protein 3D structure prediction in CASP, which considered various parameters to confer accuracy of the predictor. Molecular dynamic simulations also concluded the similar result that mutation at kinase domain is likely to make the protein less stable structurally. Also, higher fluctuations compared to wild structure were observed through RMSD, RMSF, Rg and hydrogen bond analysis. When compared to the original protein structure, our molecular dynamics technique revealed a shift of deviation in significant sections of the mutant structures that directly affects the secondary structure stability.
As the in-silico analysis estimated that mutation in PRKCG (K359R) may alter the structure and hence the function of the protein; so, to validate these prediction two sets of primers (two outer and two inner) were designed via Primer1 against rs1331262028 to find the correlation between allele change and association with hepatocellular carcinoma. The analysis of ARMS PCR results revealed that the wild type allele AA has strong correlation, OD (5.194), relative risk (2.287) and P-value > 0.0001, with HCC compared to homozygous GG and Heterozygous AG. The results analyzed based on gender and age group shows difference in OD and relative risk in male and female and suggest that a male with allele AA may have at higher risk compared to female, but no clear results were achieved from analysis based on age group because of the sample size. The association of polymorphism with genetic disease gave us an idea about susceptibility and can also be used for early diagnosis as the study of the osteoarthritis in Pakistani population revealed that polymorphisms in IL-6, TGFbeta-1 and CALM 1 genes were associated with the disease [36]. It has been established that high ALT) levels are linked with HCV induced HCC) and can lead to the disease rapidly [37]. So, the ALT test was performed as a confirmatory test to differentiate patients and controls and the significant difference in ALT levels were detected in both the groups. The association of viral load with genotype was performed to analyze the link of genotype with viral load. Our results demonstrated that patients with genotype AG have high viral load followed by AA and then GG. Literature shows clearance of HCV viral RNA in patients co-infected with HCV/HIV having rs12979860 polymorphism CC genotype [38]. Further analysis of the PKC gamma in context of single nucleotide polymorphism requires investigating more nsSNPs and their association with HCV-induced HCC. The alteration in PKC gamma expression both at transcriptomic and proteomic level is also needed, which can be helpful regarding targeted therapy for HCC.
Conclusion
In conclusion, the SNP identified may be used as a genetic marker, which can help us in the early diagnosis of the hepatocellular carcinoma. The expression profile of the PKC gamma upon this mutation needs to be explored, which may open new ways in the cancer therapeutic field and targeted drug therapy. The study findings emphasize the need for genome association studies and extensive clinical trial-based investigations on a broad population, so that the effect of the studied SNP could be studied extensively.
|
v2
|
2022-12-01T15:08:55.098Z
|
2022-11-30T00:00:00.000Z
|
254100315
|
s2orc/train
|
DEM-TACE as the initial treatment could improve the clinical efficacy of the hepatocellular carcinoma with portal vein tumor thrombus: a retrospective controlled study
Background Conventional-transarterial chemoembolization (C-TACE) was proven to improve overall survival (OS) in hepatocellular carcinoma (HCC) patients with portal vein tumor thrombus (PVTT), drug-eluting microsphere-TACE (DEM-TACE) was supposed to provide more benefit than C-TACE in this respect. Purpose To compare the safety and efficacy between DEM-TACE and C-TACE as the initial treatment in HCC patients with PVTT and to identify prognostic factors of OS. Methods The medical records of advanced HCC patients with PVTT who underwent DEM-TACE or C-TACE as the initial thearpy from September 2015 with mean follow-up time 14.9 ± 1.2 (95% CI 12.6–17.2) months were retrospectively evaluated. A total of 97 patients were included, 49 patients in the DEM-TACE group and 48 in the C-TACE group. Adverse events (AEs) related to TACE were compared. Tumor and PVTT radiologic response, time to tumor progression (TTP) and OS were calculated and compared in both groups. Results Patients in DEM-TACE group had a better radiologic response (Tumr response: 89.8% vs. 75.0%; PVTT response: 85.7% vs. 70.8%; overall response: 79.6% vs. 58.3%, P = 0.024) and longer TTP (7.0 months vs. 4.0 months, P = 0.040) than patients in C-TACE group. A lower incidence of abdominal pain was found in the DEM-TACE group than in C-TACE group (21 vs. 31, P = 0.032), but there were no significant differences between DEM-TACE and C-TACE patients in any other AEs reported. When compared to C-TACE, DEM-TACE also showed significant OS benefits (12.0 months vs. 9.0 months, P = 0.027). DEM-TACE treatment, the absence of arterioportal shunt (APS), lower AFP value and better PVTT radiologic response were the independent prognostic factors for OS in univariate/multivariate analyses, which provided us with a guide for better patient selection. Conclusions Based on our retrospective study, DEM-TACE can be performed safely and might be superior to C-TACE as the initial treatment for HCC patients with PVTT. Trial registration Retrospectively registered.
Introduction
Hepatocellular carcinoma (HCC) is one of the most common cancers with poor survival outcomes worldwide [1,2]. Portal vein tumor thrombus (PVTT) occurs in up to 44% of patients with HCC at the time of death and approximately 10%-40% of patients at the time of diagnosis [3,4]. The presence of PVTT has a strong association with prognosis with a short median survival time (2-4 months) [4]. Furthermore, PVTT also limits treatment options, including radical treatments, such as liver transplantation and curative resection, and the optimal treatment for advanced HCC patients with PVTT remains largely controversial [1].
The Barcelona Clinic Liver Cancer (BCLC) group recommended system therapy (include tyrosine kinase inhibitor-TKI and immune checkpoint inhibitors-ICIs) as a standard therapy for patients with advanced HCC (BCLC stage C), including patients with PVTT [1,5,6]. However, survival benefits from systemic therapy among patients with advanced-stage HCC patients with PVTT are poor [7,8]. Several studies have demonstrated that conventional transarterial chemoembolization (C-TACE) is a palliative treatment for advanced HCC patients and that it could improve survival compared to sorafenib therapy [9,10]. However, repeating C-TACE is limited due to decreased liver function and the resulting diminished efficacy.
The advent of drug-eluting microsphere-TACE (DEM-TACE) represents an advanced technology, as these delivery systems slowly release chemotherapeutic drugs into HCC tissues, consequently improving safety and efficacy compared with C-TACE [11][12][13]. Some studies indicated that DEM-TACE could decrease the number of TACE cycles and improve the early tumor response rate compared with C-TACE [14,15]. The survival benefit of DEM-TACE has also been reported in previous study [11]. However, the significance of DEM-TACE in HCC patients with PVTT has not been reported. Therefore, this retrospective study was conducted to evaluate the safety and efficacy of DEM-TACE in advanced HCC with first-, second-or lower-order portal vein tumor thrombus compared with C-TACE.
Study design and population
This retrospective study was approved by the ethics committee of the third affiliated hospital of Sun Yat-Sen University, and it conformed to the standards of the Declaration of Helsinki ([2021]02-288-01). Due to the retrospective nature of the study, the Institutional Review Board of the third affiliated hospital of Sun Yat-Sen University waived the need for written informed consent. We reviewed the electronic medical records of 372 advanced HCC patients with PVTT who accepted DEM-TACE or C-TACE as the initial therapy from September 2015 to August 2017 at the third Affiliated Hospital of Sun Yatsen University, Guangzhou, China. The choice of TACE has been made on a case-to-case basis by the multi-disciplinary treatment board (consisting of interventional radiologists, medical oncologists and liver surgeons), and after in-depth discussion with the patient himself/herself. Before the initial TACE, the interventional radiologists would ask patients to choose from either DEM-TACE or C-TACE after detailed introduction of each technique and informed consent forms for DEM-TACE or C-TACE would be required to be signed. The diagnosis of HCC was based on the criteria of the European Association for the Study of the Liver (EASL) [1]. The presence of PVTT was confirmed that the detection of the enhancement of an intraluminal mass expanding portal vein (first-, second-or lower-order portal vein) on the arterial phase and a low-attenuation, intraluminal mass on the portal phase on three-phase dynamic CT/MR images.
The eligibility criteria were as follows: (a) imaging or pathological diagnosis of unresectable hepatocellular carcinoma; (b) Child-Pugh class A or B, and Eastern Cooperative Oncology Group (ECOG) performance status of 0-2; (c) presence of PVTT within 7 days before TACE; (e) no previous treatment. The exclusion criteria were as follows: (a) PVTT invade the main portal vein; (b) acceptance of surgery, liver transplantation or localregional therapies (radiofrequency ablation, radioactive seed implantation, etc.); (c) acceptance of intra-arterial chemoinfusion; (d) other serious medical comorbidities; and (e) contraindications to lobaplatin, doxorubicin, lipiodol or TACE procedures. Based on our retrospective study, DEM-TACE can be performed safely and might be superior to C-TACE as the initial treatment for HCC patients with PVTT. Trial registration: Retrospectively registered. Keywords: Transarterial chemoembolization, Drug-eluting microsphere, Hepatocellular carcinoma, Portal vein tumor thrombosis C-TACE and DEM-TACE procedures TACE was performed using a 5-F RH catheter (Cook, Bloomington, USA) or a Cobra catheter (Cook, Bloomington, USA) and a 2.4F microcatheter (Renegade, Boston Scientific, USA; Master PARKWAY HF, Asahi, Japan; Merit Maestro Microcatheter, Merit Medical, USA) superselectively towards the tumor-feeding arteries, depending on the tumor distribution and hepatic functional reserve. Lobaplatin at a concentration of 0.5 mg/ mL was infused into the tumor feeding arteries superselectively at a rate of 5 mL/min, and the total amount of lobaplatin (20 to 50 mg) depended on the patient's body weight in the C-TACE group and DEM-TACE group. In patients with arterioportal shunt (APS), embolization using 300-700 µm Embosphere microspheres (Merit Medical, USA), which were diluted two times with contrast medium, was performed superselectively to occlude the shunt before chemoinfusion in both the C-TACE group and DEM-TACE group.
Conclusions:
For the DEM-TACE group, 30-60 µm or 50-100 µm HepaSphere microspheres (Merit Medical, USA) loaded with 30-50 mg doxorubicin hydrochloride was injected into the tumor-feeding artery superselectively. For the C-TACE group, an emulsion of 2-20 mL lipiodol (Lipiodol Ultrafluide, Guerbet, Aulnay-Sous-Bois, France) with 20-60 mg doxorubicin hydrochloride (Pfizer, New York, USA) was also injected superselectively and the dosage of lipiodol and doxorubicin was determined by tumor size, vascularity, presence of, APS and underlying liver function. The embolization endpoint was defined as stasis of blood flow in the tumor-feeding artery, and repeated hepatic arteriography was performed to assess the devascularization after DEM-TACE. If the embolization endpoint was not reached, gelatin sponge particles (Cook, Bloomington, USA), which were mixed with contrast material, were administered into the feeder vessels until stasis in both the DEM-TACE and C-TACE groups.
Safety assessment of DEM-TACE in PVTT patients
Adverse events (AEs) within 1 months after TACE were performed and reported according to the Society of Interventional Radiology guidelines [16,17]. Liver function tests after first DEM-TACE were also recorded, such as aspartate aminotransferase, alanine aminotransferase, total bilirubin, serum albumin and prothrombin time, were measured 1 month after the initial TACE procedure to evaluate the safety of DEM-TACE in HCC patients with PVTT.
Follow-up and re-treatment schedules
All HCC patients in this study were undergone regular follow-up visits after the initial DEM-TACE or C-TACE procedure every 4-8 weeks. Each follow-up visit included a detailed history and physical examination, laboratory tests, and abdominal contrast-enhanced three-phase dynamic spiral CT or MR imaging. Followup TACE was repeated when the recurrent or residual tumor was detected by enhanced CT/MR in both groups. And DEM-TACE/C-TACE procedures could be performed in DEM-TACE group and C-TACE group, which depended on tumor burden, prior treatment history and patients's decision. TKI (sorafenib 400 mg bid) was recommended and administered as per institutional protocol if it was agreed by the patient during the follow-up period, especially in patients diagnosed with PD after the initial TACE procedure. Patients who refused TKI underwent TACE or conservative treatment. Patients were followed up every 2-3 months thereafter. Time to tumor progression (TTP) was defined as the time from the first TACE treatment to progressive disease (PD) according to the modified Response Evaluation Criteria in Solid Tumors (mRECIST) criteria [18]. Overall survival (OS) was defined as the time from the first TACE treatment to death, and patients alive at the end of follow-up were recorded as censored.
Radiologic response evaluations
Tumor radiologic response was evaluated separately by two radiologist ( both with 10 years of experience in liver imaging) within 4-8 weeks after the initial TACE procedure with contrast-enhanced CT or MR imaging according to the mRECIST criteria: complete response (CR) was defined as the absence of enhanced tumor reflecting complete tissue necrosis in all target lesions; partial response (PR) was defined as at least a 30% decrease in the sum of the diameters of the viable target tumor, reflecting partial tissue necrosis; PD was defined as ≥ 20% increase in the sum of the diameters of viable target tumor or the appearance of any new malignant lesions; and stable disease (SD) was defined as a tumor response between PR and PD [18]. It was also suggested in the mRECIST criteria that the presence of PVTT should be considered as a non-target lesion, and criteria of PVTT radiologic responses include: CR: disappearance of all nontarget lesions; non-CR-non-PD: the persistence of one or more nontarget lesions; and PD is the appearance of one or more new lesions and/or unequivocal progression of existing nontarget lesions [18]. The PVTT radiologic response was thus defined as the percentage of patients who had the tumor response rating of CR, and non-CR-non-PD. Overall response was also evaluated according to the mRECIST criteria [18]. And radiologic response rate was defined as the percentage of patients who showed tumor response level of CR, PR, or SD.
Statistical analysis
SPSS Statistics ® , version 19 (IBM, Armonk, United States), for statistical analysis was used for all analyses. Quantitative data are reported as the mean ± SD and were compared between these two groups using Student's t-test. Categorical data were compared using the χ2 test. TTP and OS were analyzed using a Kaplan-Meier curve and Breslow test. The Cox proportional hazard model was used for univariate and multivariate analyses to determine prognostic factors. Differences were deemed significant when p < 0.05.
Study population
From September 2015 to August 2017, 372 consecutive patients with HCC fulfilling the eligibility criteria were included in this study, 275 patients were excluded: 49 patients were in the DEM-TACE group, and 48 were in the C-TACE group (shown in Fig. 1). The mean follow-up time was 14.9 ± 1.2 (95% CI 12.6-17.2) months ending in May 2019. Table 1 summarizes the baseline characteristics of the study subjects, and there were no significant differences between these two groups for any of the variables. All patients enrolled had BCLC-C with PVTT and large tumors, and 13.4% (14/97) of them had extrahepatic spread at baseline. All TACE procedures were technically successful, with a mean of 3.2 ± 2.1 TACE cycles (DEM-TACE cycles: 1.4 + 0.5; C-TACE cycles: 1.8 + 1.9) in DEM-TACE group and a mean of 3.5 ± 1.7 cycles in C-TACE group (P = 0.368). 36 patients in DEM-TACE group had a subsequent C-TACE.
Safety of DEM-TACE vs C-TACE
There was a total of 68 AEs in DEM-TACE group and 86 in C-TACE group without any 30-days mortality nor treatment-related mortality. AEs after the first TACE procedure in both groups are shown in Table 2. DEM-TACE showed a significantly lower incidence of abdominal pain than C-TACE (P = 0.032), all other AEs were comparable between the 2 groups (P > 0.05). Liver function changes within 1 month after initial DEM-TACE procedures are described in Table 3 and no significant deterioration in liver function in DEM-TACE group.
Assessment of radiologic response
The tumor and PVTT radiologic response within 4-8 weeks after inital TACE procedure was recorded (Table 4). In brief, the tumor radiologic response was
TTP and OS and analysis of factors affecting OS
Both median TTP and OS were found to be superior in the DEM-TACE group compared to the C-TACE group (shown in Fig. 3). The median TTP was calculated to be 7.0 months (95% CI 3.66-10.34) in the DEM-TACE group and 4.0 months (95% CI 2.96-5.04) in the C-TACE group (P = 0.040). The median OS was 12.0 months (95% CI 6.32-17.69) in the DEM-TACE group and 9.0 months (95% CI 6.51-11.49) in the C-TACE group (P = 0.027). Fifteen (30.6%) patients in the DEM-TACE group and 2 (4.2%) in the C-TACE group were still alive when the analysis was performed (case shown in Fig. 2 f ).
The univariate Cox proportional hazards regression model was used to analyze the factors that affect OS. In the univariate analysis, treatment using DEM-TACE, PVTT invading second-or lower-order portal vein branches, absence of APS, encapsulated HCC, smaller tumor diameter, fewer tumor number, AFP value < 400 ng/ml, better tumor radiologic response and PVTT radiologic response were identified as significant factors. All factors with P-values less than 0.1 were further included in the multivariate Cox proportional hazards regression analysis, and the results showed that DEM-TACE (P = 0.034), absence of APS (P = 0.005), AFP value < 400 ng/ml (P = 0.019) and better PVTT radiologic response (P < 0.001) were independent predictive factors for longer OS. Details are described in Table 5.
Discussion
Advanced HCC patients with PVTT are not an absolute contraindication to C-TACE according to the consensus-based clinical practice guidelines [20,21], and several studies suggested that C-TACE could prolong OS in HCC patients with PVTT [22,23]. However, the tumor response of C-TACE might be unsatisfactory, which might be due to (1) tumor burden and lipiodol retention in large tumor(s) with PVTT and (2) the presence of APS (28.8% to 63.2% in HCC cases) in PVTT patients, which might cause the oil emulsion used in C-TACE to enter the portal vein through the shunt, resulting in hepatic infarction [24,25]. DEM-TACE is a relatively new technology commonly used in BCLC-B HCC treatment, but its significance in advanced stage HCC with PVTT has not yet been reported. Several reports suggested that DEM-TACE was well tolerated in HCC treatment, and it was reported that it could be safely performed in advanced HCC patients [26]. Our study reported a comparable complication rate in both C-TACE and DEM-TACE, except for abdominal pain incidence (DEM-TACE: 21 vs. C-TACE: 31, P = 0.032). Both treatments could be safely performed in the treatment of advanced HCC without 30-day mortality.
It has been previously suggested that DEM-TACE has better tumor response than C-TACE in several studies [27,28]. Seki et al. used HepaSphere microspheres and achieved a CR of 12.6% and a PR of 43.7%, which are similar to our results (CR: 16.3% and PR 46.9%) [29]. Our data were consistent with previous studies showing that the overall radiologic response in the DEM-TACE group was better than that in the C-TACE group, which was indicated to be an independent predictive factor for longer OS in other study [30]. Meanwhile, PVTT radiologic response after DEM-TACE have been first reported in this study, which was also better than that in C-TACE group (85.7% vs. 70.8%, P = 0.022), which was indicated to be an independent predictive factor for longer OS in our multivariate analysis (P < 0.001). Furthermore, in the current study, DEM-TACE was proven to prolong the TTP (7.0 months (95% CI 3.66-10.34) vs 4.0 months (95% CI 2.96-5.04), P = 0.040). Our study group inferred the following from the current findings contributing to the superior efficacy of DEM-TACE: first, the feature of DEM-TACE in terms of its conformity allows deeper penetration into the feeding artery of the tumor and PVTT, which might lead to occludes vessels effectively [31]. Previous histologic examination also shown that HepaSphere microspheres could be found in the PVTT without recanalization [32]. Second, the slow release of anticancer drugs from DEM-TACE in HCC enables a sustained anti-tumor effect [33]. These data suggested that initial DEM-TACE might induce extensive intrahepatic tumor/PVTT necrosis compared with C-TACE, which may improve local tumor control and prolong the TTP.
In the present study, DEM-TACE was shown to prolong the OS compared to C-TACE in advanced HCC patients with PVTT (12.0 months (95% CI 6.32-17.69) vs 9.0 months (95% CI 6.51-11.49), P = 0.027), which has been rarely reported in previous study. Additionally, our comparison data along with our multivariate analysis suggested that treatment with initial DEM-TACE was an independent predictive factor for longer OS, which has seldom been reported. This might be due to patient Patient selection is key to optimal cancer treatment, and in our study, we demonstrated the significance of DEM-TACE for BCLC-C patients with PVTT. Fifteen (30.6%) patients treated with DEM-TACE were still alive at the end of the study, meaning that the OS of some patients was over 2 years. These data also echoed a recent retrospective subgroup analysis [28]. Further study should explore prospectively in a multi-center setting to confirm the importance of this advanced disease and compare it with TKI therapy alone, which is widely recommended for BCLC-C patients with PVTT.
Other independent predictive factors for better OS shown in our multivariate analysis are the absence of APS and lower AFP value. APS had previously been reported to be correlated with the poor response of TACE in advanced HCC patients because embolic lipiodol of C-TACE may be diverted into the portal vein branches and delivered to nontumor hepatic tissue instead of being deposited intratumorally as reported in several studies [22,34]. However, subgroup analysis showed that there was no significant difference in OS between DEM-TACE and C-TACE patients with APS in this study (7.0 months vs 7.0 months, P = 0.095). We assumed that there might be two reasons: first,patients with severe APS (classification 1-3: 11 patients in DEM-TACE group and 14 patients in C-TACE group) might be not suitable for TACE procedure, even when using the HepaSphere microspheres, which might pass through the shunt during TACE [35]. Meanwhile the number of patients with APS (17/49 in DEM-TACE group and 16/48 in C-TACE group) was limited which could also have led to this result in subgroup analysis. Meanwhile, DEM-TACE was proven to gain longer OS compared to C-TACE with better PVTT response in (CR + non-CR-non-PD) subgroup analysis. These data indicated that despite not hereby directly supported we cannot rule out the possibility that APS management with DEM-TACE could potentially achieve superior radiologic response, which is essential to achieve better outcomes [36]. AFP value is thought to be associated with tumor activity and to play an important role in the degree of HCC malignancy in cytologic studies [37]. This study showed that higher AFP level was a poor prognostic factor for OS, which was also proven in our previous study [38]. Our data also align with previous findings and provide a guide for better patient selection for DEM-TACE treatment in advanced HCC patients. Limitations of this study include the following: first, retrospective, and therapeutic options (DEM-TACE vs. C-TACE) in advanced HCC patients with PVTT were individually determined by the patients' preference, which likely led to selection bias in our population. However, the bias was limited by similar baseline characteristics between these two groups. Second, the number of patients was relatively small (49 patients in DEM-TACE and 48 patients in C-TACE), but it was sufficient to demonstrate the significance in terms of radiologic response, TTP and OS, as shown in our statistical analysis and sample size estimation. Third, most HCC tumors were not histopathologically confirmed but were diagnosed based on imaging and AFP level as per the EASL guidelines. Fourth, TKIs are recommended as the standard of care for advanced HCC patients [19], and it was proven that the combination with TACE could improve OS in advanced HCC patients with PVTT in our previous study [39]. However, only a small number of patients (5 in the DEM-TACE group and 8 in the C-TACE group, P = 0.350) had TKIs in this study. TKI combined with DEM-TACE is worth further exploration. Fifth, in the patients' baseline characteristics, higher percentage of 1st order PVTT (66.7%) and multiple tumors (58.3%) reported in C-TACE group as compared to 51.0% and 49.0% in DEM-TACE group, respectively. Although there was no statistical significance, it might affect clinical outcomes. Lastly, this result was only reported from a single center, and a multicenter clinical trial is suggested for further verification.
Conclusion
DEM-TACE yielded promising efficacy outcomes in HCC patients with PVTT and is a potential option for this advanced disease. Patients treated with initial DEM-TACE showed better response and longer TTP/OS than patients treated with initial C-TACE. A multicenter prospective randomized controlled trial is suggested to show differences in local tumor control and survival of advanced HCC patients.
|
v2
|
2022-12-02T06:17:19.822Z
|
2022-11-30T00:00:00.000Z
|
254124260
|
s2ag/train
|
Survival outcomes, digital TILs and on-treatment PET/CT during neoadjuvant therapy for HER2-positive breast cancer: results from the randomized PREDIX HER2 trial.
PURPOSE
PREDIX HER2 is a randomized phase 2 trial that compared neoadjuvant docetaxel, trastuzumab, pertuzumab (THP) with trastuzumab emtansine (T-DM1) for HER2-positive breast cancer. Rates of pathologic complete response (pCR) did not differ between the two groups. Here, we present the survival outcomes from PREDIX HER2 and investigate metabolic response and tumor infiltrating lymphocytes (TILs) as prognostic factors.
PATIENTS AND METHODS
In total, 202 patients with HER2-positive breast cancer were enrolled and 197 patients received six cycles of either THP or T-DM1. Secondary endpoints included event-free (EFS), recurrence-free (RFS) and overall survival (OS). Assessment with PET-CT was performed at baseline, after 2 and 6 treatment cycles. TILs were assessed manually at baseline biopsies, while image-based evaluation of TILs (DTILs) was performed in digitized full-face sections.
RESULTS
After a median follow-up of 5.21 years, there was no difference between the two treatment groups in terms of EFS (HR=1.26, 95% CI 0.54 - 2.91), RFS (HR=0.69, 95% CI 0.24 - 1.93) or OS (HR=0.52, 95% CI 0.09 - 2.82). Higher SUVmax at cycle 2 predicted lower pCR (ORadj=0.65, 95% CI 0.48-0.87, p=0.005) and worse EFS (HRadj=1.27, 95% CI 1.12-1.41, p<0.001). Baseline TILs and DTILs provided additional prognostic information to clinical parameters and C2 SUVmax.
CONCLUSIONS
Long-term outcomes following neoadjuvant T-DM1 were similar to neoadjuvant THP. SUVmax after two cycles of neoadjuvant therapy for HER2-positive breast cancer may be an independent predictor of both short- and long-term outcomes. Combined assessment with TILs may facilitate early selection of poor responders for alternative treatment strategies.
|
v2
|
2022-12-02T06:17:19.987Z
|
2022-11-30T00:00:00.000Z
|
254123543
|
s2ag/train
|
How We Manage Newly Diagnosed Multiple Myeloma With Circulating Tumor Cells.
The Oncology Grand Rounds series is designed to place original reports published in the Journal into clinical context. A case presentation is followed by a description of diagnostic and management challenges, a review of the relevant literature, and a summary of the authors' suggested management approaches. The goal of this series is to help readers better understand how to apply the results of key studies, including those published in Journal of Clinical Oncology, to patients seen in their own clinical practice.Careful evaluation of peripheral blood for the presence of circulating plasma cells by morphologic assessment or by flow cytometric analysis is an essential component of the diagnostic workup in all patients with newly diagnosed multiple myeloma (MM) to timely differentiate between MM and primary plasma cell leukemia (pPCL), which is the most aggressive plasma cell dyscrasia. The improvement in survival over time is more modest in pPCL, compared with what has been achieved in MM. pPCL is currently defined by the presence of ≥ 5% circulating plasma cells. However, this cutoff is now challenged by new data, from three large cohorts of patients with newly diagnosed MM, showing that a threshold of 2% circulating tumor cells (CTCs) by flow cytometry can be used to identify a subset of patients with ultra-high-risk MM with comparable prognosis as patients with pPCL. These patients may benefit from more intensified first-line therapies, or from enrollment into specific clinical trials, designed for ultra-high-risk MM and pPCL. Apart from differentiating MM from pPCL, the quantification of CTCs is also useful for risk stratification in MM. The detection of CTCs above a threshold of 0.01%-0.07% (much lower than the threshold to define pPCL) appears to be an independent predictor of poor clinical outcomes in newly diagnosed MM. Additional studies, including transplant-ineligible patients or with incorporation of novel immunotherapies, are needed to identify a definitive prognostic CTC cutoff. The next step will be the incorporation of CTC detection into existing staging systems to improve risk stratification and treatment personalization.
|
v2
|
2022-12-02T14:33:20.824Z
|
2022-11-30T00:00:00.000Z
|
254129187
|
s2orc/train
|
Aberrant metabolic processes promote the immunosuppressive microenvironment in multiple myeloma
Introduction Multiple myeloma (MM) is still an incurable plasma cell malignancy. The efficacy of immunotherapy on MM remains unsatisfactory, and the underlying molecular mechanisms still are not fully understood. Methods In this study, we delineated the dynamic features of immune cell in MM bone marrow (BM) along with elevated tumor cell infiltration by single-cell RNA sequencing (scRNA-seq), and investigated the underlying mechanisms on dysfunction of immune cells associated with myelomagenesis. Results We found that immune cells were activated in those patients with low infiltration of tumor cells, meanwhile suppressed with elevated infiltration of MM cells, which facilitated MM escaping from immune surveillance. Besides PD-1, abnormal expression of PIM kinases, KLRB1 and KLRC1 were involved in the defect of immune cells in MM patients. Importantly, we found aberrant metabolic processes were associated with the immunosuppressive microenvironment in MM patients. Disordered amino acid metabolism promoted the dysfunction of cytotoxicity CD8 T cells as well as lipid metabolism disorder was associated with the dysregulation of NK and DCs in MM. As metabolic checkpoints, PIM kinases would be potential effective strategies for MM immunotherapy. Discussion In summary, redressing the disordered metabolism should be the key points to get promising effects in immune-based therapies.
cells was then assessed based on four metrics step by step: (1) the number of detected genes per cell; (2) the number of detected UMI per cell; (3) the proportion of mitochondrial gene counts; and (4) the proportion of rRNA genes counts (RNA18S5 or RNA28S5). The following criteria were then applied to filter low-quality cells: gene number < 200 or > 6,000, UMI > 1000, ribosomal gene proportion > 0.4 or mitochondrial gene proportion > 0.3. Finally, a total of 42,936 cells were incorporated into further analysis. For the integration of the cells from different samples, the Gene-cell matrix of all samples was integrated with Seurat to remove batch effects across different samples. In parameter settings, the first 30 dimensions of canonical correlation analysis (CCA) and principal component analysis (PCA) were used.
Dimensionality reduction, clustering of cells, and visualization
The filtered gene-cell matrix was first normalized using "LogNormalize" methods in Seurat v.3 with default parameters. The top 2,000 variable genes were then identified using the "vst" method in the Seurat Find Variable Features function. PCA was performed using the top 2,000 variable genes. Graph-based clustering was performed on the PCA-reduced data for clustering analysis with Seurat v.3. The resolution was set to 0.5 to obtain a more refined result. Briefly, the first 50 PCs of the integrated gene-cell matrix were used to construct a shared nearest-neighbor graph (SNN; FindNeighbors() in Seurat), and this SNN was used to cluster the dataset (FindClusters()) using a graph-based modularityoptimization algorithm of the Louvain method for community detection. Then UMAP was performed on the top 30 principal components for visualizing the cells.
Cell cluster annotation with specific maker genes expression Find All Markers in Seurat (Wilcoxon rank-sum test) was used to perform differential gene expression analysis. For each cluster, marker genes were generated relative to all other cells. Cellular identity was determined by comparing cluster-specific markers of each cluster to known cell-type-specific genes from previous studies. Cluster annotation was confirmed using the R package SingleR, which compares the transcriptome of every single cell to reference datasets to determine cellular identity. DEGs identification and functional enrichment analysis Differential expression genes (DEGs) among different sample groups within a cluster were identified using FindMarkers in Seurat (wilcox.test), with default parameters. A gene was considered significantly differentially expressed if the false discovery rate (FDR) < 0.05 and expression fold change (FC) > 1.3. The heat map was then generated using the pheatmap R package for filtered DEGs. The gene set variation analysis (GSVA) was applied to the scRNA-seq data, and average GSVA scores were calculated for each cell using the GSVA function in the GSVA software package. Differential pathway analysis between clusters was done with the limma R software package. Significantly enriched pathways were identified with an FDR value < 0.05. Gene ontology (GO) enrichment analysis on DEGs was performed using cluster profiler4.
Cell function analysis based on scRNA-seq
The cytotoxic score and exhausted score for T cells and active score for dendritic cells (DCs) were defined by AddModuleScore. CellPhoneDB were used to analyze cell-cell interactions among immune cells. The interaction strength refers to the total average of the mean expression value of a single ligand-receptor partner in the corresponding interacting cell type. The expression of any complex output by CellPhoneDB was calculated as the sum of the expression of the component genes. Mouse model and flow cytometry analysis C57BL/KaLwRij mice (purchased from Harlan Laboratories Inc., Netherlands) and housed in our lab were utilized in the present study, according to the protocol reported by our previous study. 1×10 6 5TGM1-GFP cells were injected into C57BL/KaLwRij mouse (female) via tail vein. Control mice received the PBS injection of equal volume. Bone marrow cells were collected 5 weeks after MM cell injection, and FACS was performed to analyze the composition in bone marrow cells. Fresh bone marrow aspirates obtained from MM patients after informed consent were placed in ethylenediaminetetraacetic acid (EDTA)-containing tubes and immediately transported to the lab. Fresh BMMCs were isolated by Ficoll density-gradient centrifugation and stained with fluorochrome-conjugated antibodies for 15 minutes at room temperature. Flow cytometry was performed on CantoⅡ flow cytom eter (BD Biosciences), and the data were analyzed by Flowjo V10 software (Treestar). The detailed information with the antibodies utilized is listed in suppl. Table 1.
Supplemental Figure 3. NK cell sub-clusters in MM patients
A. Heatmap shows the expression profile of top 10 signature genes for the definition of NK/NKT sub-clusters. The top bars label the cluster numbers corresponding to the subcluster number in Fig.4A. B. Bar charts show the proportions of NK/NKT cell sub-clusters from each HD and MM patients. The sub-cluster numbers in right correspond to the ones in Fig. 4A. C. GO Enrichment of DEGs in NK-S100A8 between high and low tumor burden groups of MM patients. Each dot in the graphs represents a single gene from DEGs. Upregulated genes are indicated as red dots and downregulated genes are indicated as blue dots. The color bar indicates the z-score of each pathway.
Supplemental Figure 4. Myeloid sub-clusters in MM patients
A. Heatmap shows the expression profile of top 10 signature genes for the definition of myeloid cell sub-clusters. The top bars label the cluster numbers corresponding to the sub-cluster number in Fig.5A. B. Heatmap shows the DEGs in macro-IL1B among HD and MM patients in different infiltration groups (HD: n=6; Low: n=6; High: n=6). C. Heatmap shows the DEGs in mono-FCGR3A among HD and MM patients in different infiltration groups (HD: n=6; Low: n=6; High: n=6).
|
v2
|
2022-12-04T05:11:43.295Z
|
2022-11-30T00:00:00.000Z
|
254179182
|
s2orc/train
|
Selective depletion of polymorphonuclear myeloid derived suppressor cells in tumor beds with near infrared photoimmunotherapy enhances host immune response
ABSTRACT The immune system is recognized as an important factor in regulating the development, progression, and metastasis of cancer. Myeloid-derived suppressor cells (MDSCs) are a major immune-suppressive cell type by interfering with T cell activation, promoting effector T cell apoptosis, and inducing regulatory T cell expansion. Consequently, reducing or eliminating MDSCs has become a goal of some systemic immunotherapies. However, by systemically reducing MDSCs, unwanted side effects can occur. Near-infrared photoimmunotherapy (NIR-PIT) is a newly developed treatment that selectively kills targeted cells without damaging adjacent normal cells. The aim of this study is to evaluate the antitumor efficacy of MDSC-directed NIR-PIT utilizing anti-Ly6G antibodies to specifically destroy polymorphonuclear (PMN)-MDSCs in the tumor microenvironment (TME) in syngeneic mouse models. PMN-MDSCs were selectively eliminated within tumors by Ly6G-targeted NIR-PIT. There was significant tumor growth suppression and prolonged survival in three treated tumor models. In the early phase after NIR-PIT, dendritic cell maturation/activation and CD8+ T cell activation were enhanced in both intratumoral tissues and tumor-draining lymph nodes, and NK cells demonstrated increased expression of cytotoxic molecules. Host immunity remained activated in the TME for at least one week after NIR-PIT. Abscopal effects in bilateral tumor models were observed. Furthermore, the combination of NIR-PIT targeting cancer cells and PMN-MDSCs yielded synergistic effects and demonstrated highly activated host tumor immunity. In conclusion, we demonstrated that selective local PMN-MDSCs depletion by NIR-PIT could be a promising new cancer immunotherapy.
Introduction
Myeloid-derived suppressor cells (MDSCs) have a well characterized immunosuppressive function and are commonly found in the tumor microenvironment (TME) in many cancers. [1][2][3] The presence of MDSCs in tumor tissue is associated with a decrease in mature dendritic cells (DCs) in many murine tumor models. 4,5 This is because the differentiation of bone marrow progenitor cells into granulocytes, macrophages, and DCs is disturbed by an immunosuppressive TME, resulting from the accumulation of MDSCs. Furthermore, MDSCs are implicated primarily in the suppression of T cells and other cell types in the immune system. 6 The predominant cytokines and other mediators involved in MDSC-mediated immunosuppression are arginase-1, inducible nitric oxide synthase (iNOS), interleukin (IL)-10, and reactive oxygen specimen among others. 2,6 These substances prevent T cell activation and promote effector T cell apoptosis. 7 Furthermore, MDSCs induce regulatory T cell (Treg) expansion in the presence of IFNγ and IL-10, and disrupt innate immunity by interacting with macrophages, NK cells, and NK T cells. 2,8 Thus, MDSCs act on multiple immune cell populations to promote immunosuppression and tumor progression.
In diseases such as cancer or chronic inflammation, the bone marrow and spleen increase the production of mature and immature myeloid cells comprising a spectrum of cell types from monocytes to neutrophils. Thus, there are two major subsets of MDSCs based on their phenotype and morphology: polymorphonuclear (PMN)-MDSCs representing the neutrophilic end of the spectrum and monocytic (M)-MDSCs representing the monocytic end of the spectrum. 5,9,10 M-MDSCs suppress T cell responses both in an antigenspecific and antigen-nonspecific manner, while PMN-MDSCs suppress immune responses primarily in an antigen-specific manner. Induction of antigen-specific T-cell tolerance is one of the major hallmarks of these cells. 11,12 In most solid malignant tumors, PMN-MDSCs were reported to be the predominant subpopulation of MDSCs infiltrating the TME or circulating in the body. 13,14 In the clinical setting, intratumoral PMN-MDSCs are significantly correlated with poor prognosis in a variety of malignancies. 13,[15][16][17] Therefore, it could be logical to selectively target intratumoral PMN-MDSCs. MDSC subpopulations can be distinguished with surface markers such as Ly6G and Ly6C in mice, unlike CD14, CD15, CD66b, and HLA-DR markers used in humans. 10 Nearinfrared photoimmunotherapy (NIR-PIT) is a novel cancer therapy which utilizes antibody-photoabsorber conjugate (APC) and near infrared (NIR) light and induces selective cell death against targeted cells without damaging adjacent normal cells. 18 With the application of NIR light, rapid cellspecific, necrotic, and highly immunogenic cell death (ICD) is seen in targeted cells. [18][19][20] Currently, in Japan, NIR-PIT utilizing human epidermal growth factor receptor (hEGFR) has been used in clinical practice since January 2021.
NIR-PIT was initially developed to target cancer cells, yet it can be applied to other types of cells, such as immunosuppressive cells. For instance, we previously developed NIR-PIT targeting Treg using the surface marker of CD25 or CTLA4, and have shown that intratumoral Tregs are killed, resulting in an antitumor immune activation and tumor growth suppression. 21,22 Applying the same logic to Ly6G, a surface marker specifically expressed on PMN-MDSCs in mouse models, it was hypothesized that Ly6G-targeted NIR-PIT could selectively deplete PMN-MDSCs thus, activate their host antitumor immunity. Hence, we evaluated the local depletion of PMN-MDSCs in the tumor bed and subsequent antitumor effects of NIR-PIT targeting Ly6G in mouse tumor models.
Materials and methods
Detailed materials and methods are described in the Supplemental online material.
NIR-PIT utilizing Ly6G-IR700 selectively killed PMN-MDSCs
The successful conjugation of anti-Ly6G monoclonal antibody (mAb) and IR700 was demonstrated ( Figure S1). In this study, we confirmed that Ly6G positive cells could be distinguished using Gr-1 and Ly6C antibodies and defined Gr-1 hi Ly6C int myeloid cells as PMN-MDSCs and Gr-1 int Ly6C hi myeloid cells as M-MDSCs (Figure 1(a) and Figure S2). As shown in Figure S3, Gr-1 signal was slightly lower in Ly6G-IR700 i.v. injection only (APC-I.V.) group, suggesting that anti-Gr-1 clone RB6-8C5 may bind the common epitope as Ly6G-IR700 and competed for the binding. However, the signal reduction of Gr-1 was small and did not interfere with the gating on flowcytometric analysis. To verify the ex vivo binding of Ly6G-IR700 to PMN-and M-MDSCs, myeloid cells isolated from the spleen were incubated with Ly6G-IR700 (Figure 1 (b)). PMN-MDSCs had high IR700 signal, and excess unconjugated anti-Ly6G mAbs neutralized this signal, suggesting that PMN-MDSCs expressed Ly6G, and this binding was specific. However, no signal was observed for M-MDSCs. We quantitatively assessed the cytotoxicity of Ly6G-targeted NIR-PIT against splenocytes (Figure 1(c,d)). PMN-MDSCs were decreased in a NIR light-dose dependent manner. Moreover, the cytotoxicity of NIR-PIT was not seen in M-MDSCs. No direct cytotoxicity against cancer cells was detected ( Figure S4). Additionally, microscopic analysis showed that IR700-bound cells were damaged after NIR-PIT, while non-IR700-bound cells had no apparent changes ( Figure 1(e)). Next, we assessed the expression of Ly6G and Ly6C in splenocytes (figure 1(f) and Figure S5). Ly6G was expressed on the surface of PMN-MDSCs alone, while Ly6C was expressed on PMN-MDSCs, M-MDSCs, T cells, NK cells, DCs, and macrophages. To confirm which cells in tumors were depleted, ex vivo cell viability after Ly6G-targeted NIR-PIT was assessed via flow cytometry (Figure 1(g)). Consistent with Ly6G expression, only PMN-MDSCs were significantly depleted by this treatment. Thus, these results demonstrated that Ly6G-targeted NIR-PIT could selectively destroy PMN-MDSCs without damaging adjacent cells representing other subtypes.
Distribution of MDSCs and specific binding of Ly6G-IR700 in allograft tumor models
The number of PMN-MDSCs and M-MDSCs were calculated and compared in four syngeneic tumor models. In mEERL-hEGFR, MOC2-luc, and MOC1 tumors, the number of tumor-infiltrated PMN-MDSCs in CD45 + cells were significantly higher compared to MC38-luc tumor, while the number of tumor-infiltrated M-MDSCs was significantly higher in MC38-luc tumors compared to other tumors ( Figure 2(a)). In the spleen, no significant differences were found in either MDSC ( Figure 2(b)). These results demonstrated that the type and number of tumor infiltrating MDSCs varied by tumor models. In this study, mEERL-hEGFR, MOC2-luc, and MOC1 were used as PMN-MDSCs-rich models and MC38-luc as an M-MDSCrich model. Next, to evaluate the delivery and specific binding of anti-Ly6G mAbs, multiplex immunohistochemistory (IHC) was performed 1 day after administration of digoxigenin-labeled anti-Ly6G mAb (Ly6G-DIG, Figure 2 (c)). Ly6G-DIG was detected on the surface of Ly6G-positive cells, while the DIG signals were not observed on CD3positive cells. Under the same schedule, in vivo Ly6Gtargeted NIR-PIT was performed to assess specific cytotoxicity ( Figure 2(d,e)). The results showed that only PMN-MDSCs were decreased after NIR-PIT. Thus, Ly6G-IR700 was successfully delivered and bound to target cells within the tumors, and the selective cytotoxicity of Ly6G-targeted NIR-PIT was effective.
Ly6G-targeted NIR-PIT suppressed tumor growth
We confirmed that the optimal time for NIR light irradiation was approximately 1 day after Ly6G-IR700 administration by the biodistribution of Ly6G-IR700 injection ( Figure S6). Next, in vivo therapeutic effects of Ly6G-targeted NIR-PIT were assessed in the three PMN-MDSC-rich allograft models. The treatment regimen and schema are shown in Figure 3(a). All mice injected with Ly6G-IR700 showed an intense 700 nm fluorescence signal within the tumors, and the signal was attenuated immediately after NIR light irradiation, suggesting the photobleaching of Ly6G-IR700 (Figure 3(b)). In all allograft models, the tumor growth was significantly inhibited in the NIR-PIT group compared with the other two groups (Figure 3(c)). Furthermore, the survival of the NIR-PIT group was also significantly prolonged compared with the other two groups in all allograft models (Figure 3(d)). The efficacy of NIR-PIT against MC38-luc tumor, which contained the least amount of PMN-MDSCs, was also evaluated. Although tumor growth was significantly suppressed, the effect was minimal, and no significant difference in survival was observed (Figure 3(e,f)). Thus, these results demonstrated that Ly6G-targeted NIR-PIT inhibited tumor growth, significantly prolonged survival, and was more effective against PMN-MDSC-rich tumors.
Anti-tumor host immunity was triggered by Ly6G-targeted NIR-PIT soon after the treatment
First, we confirmed that Ly6G-targeted NIR-PIT did not induce obvious damage to cancer cells in mEERL-hEGFR tumors ( Figure S7). Additionally, to test the T-cell dependency of antitumor response of Ly6G-targeted NIR-PIT, mEERL-hEGFR tumor growth was evaluated using T-cell deficient athymic mice ( Figure S8). No significant difference was observed between the control group and the NIR-PIT group, suggesting the antitumor effect of Ly6G-targeted NIR-PIT was T-cell dependent. Next, to assess how the host tumor immunity was stimulated after NIR-PIT, DC maturation and activation in tumors and tumor-draining lymph nodes (TDLNs) were examined 2 days after NIR-PIT. The markers of DC maturation/activation in TDLNs and tumors were significantly increased in the NIR-PIT groups compared to the control groups (Figure 4(a,b)). We also evaluated CD8 + T cell activation in TDLNs 2 days after NIR-PIT. Up-regulation of CD69 and CD25 and higher Ki67 positivity were observed in NIR-PIT groups, suggesting CD8 + T cells in TDLNs were activated and were proliferating (Figure 4(c)). Although the number of NK cells was not significantly changed, expressions of CD107a and klrg1 and intracellular IFNγ production were increased, suggesting that NK cell activation was promoted (Figure 4(d,e)). Quantitative analyses showed the phenotype of PMN-MDSCs 2 days after NIR-PIT.
Although the number of PMN-MDSCs in the tumor was higher in the NIR-PIT group (figure 4(f)), the intracellular expression of arginase-1, iNOS, and IL-10, which indicates T cell suppressive activity, was significantly decreased in the NIR-PIT groups (Figure 4(g,h)). These results suggested that Ly6G-targeted NIR-PIT eliminated highly immunosuppressive PMN-MDSCs perturbing the balance in the TME between immunosuppressive and immune-activating cells.
Acquired antitumor immunity by NIR-PIT remained energized in the tumor
We next assessed whether the balance between CD8 + T cells and Tregs was improved by Ly6G-targeted NIR-PIT. Tumors were harvested 7 days after each treatment, and tumor-infiltrating lymphocytes (TILs) were analyzed by multiplex IHC (Figure 5(a)). The quantification of CD8 + T cell density was significantly higher in the NIR-PIT group than in the other two groups ( Figure 5(b)). Furthermore, the ratio of CD8 + T cells to Tregs, which is a well-known index of strong antitumor immunity, 23 was significantly higher compared with other groups. Additionally, we further assessed the cytotoxic potential of CD8 + T cells in the tumor 7 days after NIR-PIT. In the NIR-PIT group, not only was the number of CD8 + T cells increased but they displayed elevated expression of cytotoxic markers, including IFNγ, Perforin, and GranzymeB ( Figure 5(c)). Also in TDLNs, Ki67 expression in CD8 + T cells remained at higher levels, while no significant difference in Tregs was observed ( Figure 5(d)). Thus, these results confirmed that Ly6G-targeted NIR-PIT elicited a potent T cell-mediated antitumor immune reaction.
Abscopal effects of PMN-MDSC-targeted NIR-PIT
To evaluate the systemic antitumor immunity induced by NIR-PIT, Ly6G-targeted NIR-PIT was performed unilaterally in a bilateral mEERL-hEGFR tumor model. The treatment schema is shown in Figure 6(a). After NIR light administration, the 700 nm fluorescence signal was significantly decreased in the NIR light irradiated side tumor, while it was unchanged in the contralateral tumor ( Figure 6(b,c)). However, tumor growth was significantly suppressed not only in the treated tumors but also in untreated tumors (Figure 6(d)). Also, animals in the NIR-PIT group demonstrated significantly prolonged survival compared to the control group (Figure 6(e)). We then evaluated TILs in the tumors 7 days after unilateral Ly6Gtargeted NIR-PIT. The number of CD8 + T cells in the untreated and treated tumors after NIR-PIT was significantly higher than in the control groups (figure 6(f)). No significant changes in helper T cells and Tregs were observed.
Immunogenic memory acquired after Ly6G-targeted NIR-PIT
To test for immune memory, mice with mEERL-hEGFR tumors that had undergone Ly6G-targeted NIR-PIT were reinoculated with mEERL-hEGFR cells on the contralateral dorsum approximately 12 weeks after the initial NIR-PIT ( Figure S9). All mice in the re-inoculation group rejected the newly injected mEERL-hEGFR cancer cells definitively. This result indicated the acquisition of an anti-tumor immune memory after Ly6G-targeted NIR-PIT.
Simultaneous NIR-PIT-targeting of cancer cells and PMN-MDSCs resulted in more effective tumor suppression than targeting either alone
To evaluate the synergistic effect of NIR-PIT targeting cancer cells and PMN-MDSCs, we performed dual-targeted NIR-PIT in two allograft models. As a cancer cell-targeting agent, panitumumab was used for mEERL-hEGFR tumors, and anti-PDPN mAb was used for MOC1 tumors. The treatment schedule is shown in Figure S10. The tumor growth in monotargeted NIR-PIT was suppressed compared with the control group; however, the dual NIR-PIT group inhibited tumor progression more effectively in both allograft models (Figure 7(a)). Furthermore, the survival of animals in the dual NIR-PIT group was significantly prolonged compared to other groups (Figure 7(b)). Therefore, we concluded that Ly6G-targeted NIR-PIT had a synergistic effect on cancer cell-targeted NIR-PIT to suppress tumor growth.
Discussion
The immunosuppressive role played by MDSCs has made them a target for several therapies. Low-dose gemcitabine and 5-fluorouracil are known to reduce MDSCs in tumors. 3,24,25 However, these treatments also damage other cells, including effector cells in the immune system, thus, causing counterproductive effects. 26 New therapeutic approaches using all-trans retinoic acid, 1-methyltryptophan, colony stimulating factor-1 receptor, and phosphodiesterase-5 (PDE-5) inhibitor have been considered as MDSC-targeted treatment but are still under investigation and have not been deployed clinically. [26][27][28][29][30] In this study, we demonstrated that Ly6G-targeted NIR-PIT could trigger an anti-tumor effect by local elimination of PMN-MDSCs within the tumor. Unlike systemic depletion by continuous antibody administration, Ly6G-targeted NIR-PIT does not affect adjacent normal cells or uninvolved organs outside the NIR light-irradiated area and, therefore, would preserve the host immune system. The depletion of PMN-MDSC by Ly6G-IR700 injection alone was not substantial enough to exert a therapeutic effect because the dose of Ly6G-IR700 used in this study was relatively small and administrated as a single injection. 31 Thus, we propose Ly6G-targeted NIR-PIT as a new therapeutic approach to deplete PMN-MDSCs locally. This study showed that host-acquired immunity was activated after Ly6G-targeted NIR-PIT. It is well-known that PMN-MDSCs suppress T cell proliferation while promoting antigen-specific T cell suppression/tolerance and T cell apoptosis, resulting in suppressed tumor immunity. 9,14 Based on this finding, NIR-PIT was used to selectively kill MDSCs, resulting in almost completely MDSC reduction of pretreatment. Despite this treatment, PMN-MDSC counts 2 days after NIR-PIT doubled compared to pre-treatment. However, the percentage of immunosuppressive MDSCs, such as arginase-1 positive cells, decreased. This is probably because less mature MDSC populations migrated into the TME after inhibitory PMN-MDSCs were selectively depleted by Ly6G-targeted NIR-PIT. Depletion of PMN-MDSCs triggered both innate and acquired immune responses, resulting in the migration of highly cytotoxic CD8 + T cells into the tumor. Meanwhile, the results of the bilateral tumor experiment in which only one tumor was treated, but the contralateral tumor also responded, suggested that the activation of the immune system was systemic and not limited to the treated tumor.
There is considerable variability in the distribution and subtypes of MDSCs within cancers. This can be seen even among the models used in this study. Unsurprisingly, the PMN-MDSCdominant tumors responded well to Ly6G-targeted NIR-PIT, while M-MDSC-dominant tumors were much less responsive. In the latter case, targeting Ly6C for NIR-PIT might be more effective. Similar restrictions apply to previously developed Tregtargeted NIR-PIT which was effective in Treg-rich environments but limited in effectiveness in poorly immunogenic tumors because of the smaller number of Tregs. 32,33 In MDSCdominant tumors with smaller Treg content, Ly6G-targeted NIR-PIT is predicted to be more valuable as NIR-PIT targeting immune cells rather than NIR-PIT targeting Tregs (e.g., NIR-PIT targeting Tregs had minimal effect for mEERL-hEGFR tumors). 33 Therefore, when contemplating future uses of this treatment, the selection of the most appropriate NIR-PIT targeting immune cells (PMN-MDSC or Treg) rests with the determination of the relative dominance of these cell types in the TME.
There are some limitations in this study. First, Ly6G and Ly6C are murine-specific surface antigens used for distinguishing MDSCs and may not be relevant to human MDSCs. In humans, several surface markers such as CD15, LOX-1, and S100A9 have been used to refine the identification of PMN-MDSCs and M-MDSCs. 14,34 Additionally, the C-X-C chemokine receptor 2 (CXCR2) is expressed on MDSCs, and the CXCR2-axis plays an essential role in the migration of immunosuppressed MDSCs into the TME. 35 These molecules may be alternative candidates to Ly6Gtargeted NIR-PIT to eliminate PMN-MDSCs in the context of human tumors, but further investigation will be required. Second, Ly6G-expressing myeloid cells were defined as PMN-MDSCs. We could not exclude the possibility that Ly6G-positive neutrophils were admixed with other myeloid cells despite being classified as PMN-MDSCs. Furthermore, orthotopic models may be more appropriate to evaluate the immune response by NIR-PIT because of organ-specific TME changes. 36 In conclusion, we demonstrated that local PMN-MDSC depletion in the tumor using Ly6G-targeted NIR-PIT enhanced the host antitumor immune system, resulting in suppression of tumor progression not only in directly irradiated tumors but also in non-irradiated tumors in the same animal. This systemic or abscopal effect was augmented when combined with cancer cell-targeted NIR-PIT. Finally, NIR-PIT targeting PMN-MDSCs may be effective in poorly immunogenic tumors that are difficult to treat by Treg-targeted NIR-PIT and will expand the number of applications of immunosuppressive cell-targeted NIR-PIT.
Disclosure statement
No potential conflict of interest was reported by the author(s).
Funding
This work was supported by the Intramural Research Program of the National Institutes of Health, National Cancer Institute, Center for Cancer Research [ZIA BC 011513].
|
v2
|
2022-12-07T17:41:18.821Z
|
2022-11-30T00:00:00.000Z
|
254324554
|
s2ag/train
|
KARAKTERISTIK SOFT TISSUE TUMOR EKSTREMITAS BERDASARKAN TIME INTENSITY CURVE PADA DYNAMIC CONTRAST ENHANCEMENT - MRI
ABSTRACT
Background: Perfusion MRI such as Dynamic Contrast Enhancement (DCE) sequences are able to provide detailed structural and metabolic information about tumor tissue, so the diagnostic imaging results can approach histologic diagnosis non-invasively. The purpose of this study was to analyze the relationship between the Time intensity curve (TIC) and the characteristics of soft tissue tumors in the extremities, and also to determine the sensitivity and specificity values.
Methods: This research is a descriptive quantitative study using retrospective data. The samples of this study were all patients with soft tissue tumors of the extremities who underwent MRI examination of the extremities at the RIR Installation of Prof. RSUP. Dr. IGNG Ngoerah Denpasar and histopathological examinations were implemented during the period of June 2021-July 2022. Types I-II were associated with benign tumors. Meanwhile, the type of III-V as malignant tumors were compared with the histopathological characteristics of soft tissue tumors.
Results: From 30 samples, it was found the result of the spearman rank test was about the relationship between TIC and soft tissue tumor characteristics. It was shown that the p value was 0.014 (p<0.05), and the result of diagnostics test with a 2x2 table obtained a sensitivity value of 89.47% and a specificity of 9.09%
Conclusion: Time intensity curve on DCE MRI is able to distinguish the characteristics of soft tissue tumors of the extremities, especially malignancies.
|
v2
|
2022-12-07T18:58:15.443Z
|
2022-11-30T00:00:00.000Z
|
254312872
|
s2orc/train
|
Development of Radiomic-Based Model to Predict Clinical Outcomes in Non-Small Cell Lung Cancer Patients Treated with Immunotherapy
Simple Summary In locally advanced or metastatic non-small cell lung cancer (NSCLC), immunotherapy has become a standard as it can improve overall survival and progression-free survival. However, a durable clinical benefit (DCB) is only achieved in 20–50% of patients. Early identification of patients likely to benefit from this treatment is not only challenging but also crucial to avoid immune-related toxicities in patients unlikely to achieve DCB. The aim of our retrospective study was to assess the value of baseline and serial FDG-PET/CT radiomics for the prediction of response and survival in NSCLC patients undergoing immunotherapy. In a group of 83 patients, multimodality radiomics and delta-radiomics models provided added predictive value compared to conventional clinical parameters. Multimodality radiomics-based models developed using appropriate machine learning processes were able to predict progression, DCB, Overall Survival and Progression Free Survival with high confidence. Abstract Purpose: We aimed to assess the ability of radiomics features extracted from baseline (PET/CT0) and follow-up PET/CT scans, as well as their evolution (delta-radiomics), to predict clinical outcome (durable clinical benefit (DCB), progression, response to therapy, OS and PFS) in non-small cell lung cancer (NSCLC) patients treated with immunotherapy. Methods: 83 NSCLC patients treated with immunotherapy who underwent a baseline PET/CT were retrospectively included. Response was assessed at 6–8 weeks (PET/CT1) using PERCIST criteria and at 3 months with iPERCIST (PET/CT2) or RECIST 1.1 criteria using CT. The predictive performance of clinical parameters (CP), standard PET metrics (SUV, Metabolic Tumor volume, Total Lesion Glycolysis), delta-radiomics and PET and CT radiomics features extracted at baseline and during follow-up were studied. Seven multivariate models with different combinations of CP and radiomics were trained on a subset of patients (75%) using least absolute shrinkage, selection operator (LASSO) and random forest classification with 10-fold cross-validation to predict outcome. Model validation was performed on the remaining patients (25%). Overall and progression-free survival was also performed by Kaplan–Meier survival analysis. Results: Numerous radiomics and delta-radiomics parameters had a high individual predictive value of patient outcome with areas under receiver operating characteristics curves (AUCs) >0.80. Their performance was superior to that of CP and standard PET metrics. Several multivariate models were also promising, especially for the prediction of progression (AUCs of 1 and 0.96 for the training and testing subsets with the PET-CT model (PET/CT0)) or DCB (AUCs of 0.85 and 0.83 with the PET-CT-CP model (PET/CT0)). Conclusions: Delta-radiomics and radiomics features extracted from baseline and follow-up PET/CT images could predict outcome in NSCLC patients treated with immunotherapy and identify patients who would benefit from this new standard. These data reinforce the rationale for the use of advanced image analysis of PET/CT scans to further improve personalized treatment management in advanced NSCLC.
Introduction
Lung cancer is the leading cause of cancer-related death worldwide [1]. Non-small cell lung cancer (NSCLC) accounts for 80-90% of primary lung cancers, and is mostly diagnosed at an advanced stage with prognosis remaining poor despite recent therapeutic advances [2]. The introduction of immunotherapy for the treatment of locally advanced or metastatic non-small cell lung cancer (NSCLC) has shown an improvement in terms of overall survival and progression-free survival. However, a durable clinical benefit (DCB) (>6 months) is only achieved in 20-50% of patients [3]. Early identification of patients likely to benefit from this treatment is therefore crucial. In addition, newly described response patterns (pseudo-progression, hyper-progression) make response assessment even more challenging [4]. Therefore, robust response-predictive biomarkers at baseline are crucial to avoid immune-related toxicities in patients unlikely to achieve DCB.
PD-L1 status has been an important element in treatment decision making until now. However, approximately 10% of patients whose tumors do not express PD-L1 respond to treatment, and response is also not certain in cases of high expression of this biomarker [3,[5][6][7][8]. Alternative biomarker identification is an active research domain in which medical imaging plays an increasingly important role.
18F-FDG PET/CT is commonly used for characterization and staging of lung cancers. Medical images are easy to repeat over time, non-invasive and promising for personalized patient management by reflecting tumor heterogeneity, which seems to be a major cause of the disparity between response and prognosis. However, for such applications, quantitative analysis is required.
Radiomics is an approach that allows a finer characterization of tumor lesions by extracting numerous quantitative parameters from medical images (CT, PET/CT and MRI, for example) [9]. These features can be used to build complex mathematical models for lesion characterization (benign versus malignant lesions [7,8,[10][11][12], histology [13] and for the prediction of patient outcome [14,15]. In the majority of these studies, hand-crafted features extracted from the segmented functional or fused image tumor volumes have been considered. More recently, some studies have also considered the use of deep learning models in order to directly classify lung cancer patients in terms of overall survival without explicitly extracting radiomics features [16]. All these studies have shown some promising results, but in both cases, there are no specific investigations addressing the use of PET/CT radiomics for patients undergoing immunotherapy treatment. The changes in these features over time (delta-radiomics) have also been suggested to obtain a more accurate evaluation of tumor response [17]. While single time-point radiomics and delta-radiomics showed promising results in helping clinicians to choose the most appropriate treatment in various cancer models, there are still only limited data on the potential value of using these features in the evaluation of NSCLC patients undergoing immunotherapy using CT [18]. Mu et al. were recently the first to test a multiparametric radiomic model combining baseline PET and CT features to predict tumor response and survival [19]. Using advanced statistical analyses, they reported more heterogeneous tumors to have a greater probability of reaching DCB, but they did not investigate the potential additional value of serial examinations.
In this study we aim to assess the ability of radiomics features extracted from baseline and follow-up 18F-FDG PET/CT scans, as well as their changes during treatment, to predict response to immunotherapy, DCB, overall survival and progression-free survival.
Patient Population
In this retrospective study, data were retrieved from a total of 83 patients treated at Poitiers University Hospital (France) between September 2016 and December 2020. Inclusion criteria were as follows: Eastern Cooperative Oncology Group (ECOG) performance status (PS) ≤ 2, histologically proven NSCLC treated with anti-PD-L1 immunotherapy (nivolumab, pembrolizumab or atezolizumab, as monotherapy or associated with chemotherapy) and available baseline 18F-FDG PET/CT (PET/CT0) performed within 3 months before the initiation of immunotherapy.
Treatment was chosen depending on histology, PD-L1 expression, ECOG PS and risk factors and approved by the multidisciplinary oncological board. Immunotherapy was introduced as a first-line therapy in 23 patients (28%). Ten patients had PD-L1 expression higher than 50% and received pembrolizumab alone (n = 8) or combined with chemotherapy (n = 2). Thirteen patients were treated with pembrolizumab associated with platinum-based chemotherapy (cisplatin or carboplatin) and pemetrexed. Two patients received atezolizumab, either alone (n = 1) or associated with carboplatin and etoposide (PD-L1 expression not performed). Sixty patients (72%) received immunotherapy for recurrence or failure after at least one line of chemotherapy. Seventeen of them had PD-L1 expression ≥ 1% and received pembrolizumab, 41 received nivolumab and 3 received atezolizumab. Five patients were treated with a combination of pembrolizumab, carboplatin and pemetrexed. Immunotherapy administration followed the recommendations for each molecule at the time of treatment.
Baseline clinical, demographic and biological data were retrieved from medical records (age, sex, performance status, smoking history, histological subtype, stage (8th TNM classification of the International Association for the Study of Lung Cancer [20]), presence of brain metastasis or not, previous treatments and PD-L1 status (if available).
All patients gave their informed consent for the use of their personal and clinical data. No ethical committee approval was required, given the retrospective nature of this study of previously anonymized data.
Image Acquisition, Segmentation, Pre-Processing and Feature Extraction
Eighteen F-FDG PET/CT scans were performed following EANM guidelines. Acquisition parameters are described in Supplementary Materials. The largest lung lesion was semi-automatically segmented using the Fuzzy Locally Adaptive Bayesian (FLAB) algorithm [20], and the obtained volume of interest was adjusted manually by an experienced clinician, if needed. The performance of this algorithm has been extensively evaluated for functional tumor segmentation, demonstrating high reproducibility and robustness for different cancer models [21][22][23]. Tumor segmentation on CT images was performed by applying the PET VOI on CT images using 3D Slicer [24].
Prior to feature extraction, pre-processing operations were applied on PET and CT images, as described in Supplementary Materials, to take into account the variability of image acquisition (PET/CT scanners, acquisition protocols).
Metabolic and conventional volumetric parameters were extracted from CT and metabolic VOIs (including SUVmax, SUVmin, SUVmean, Metabolic Tumor Volume (MTV) and Total Lesion Glycolysis (TLG)). In addition, a total of 2430 radiomic features were extracted from both CT and PET VOIs using Pyradiomics [25], 107 were derived from original images and 2323 were derived from preprocessed images (using different combinations of interpolation, resampling and filtering), including: 2D and 3D shape parameters, first-order (histogram-based characteristics) and second-order (texture parameters) features. Detailed parameter definitions are available at the Pyradiomics website, and the list is presented in Table S1 [25].
Follow-Up and Response Assessment
Patient follow-up was based on clinical examination every 12 weeks until disease progression or death occurred. Metabolic response was assessed using PERCIST criteria on follow-up PET/CT performed 6 to 8 weeks (PET/CT1) after treatment initiation [26]. Response was defined as: complete metabolic response (CMR), partial metabolic response (PMR), stable metabolic disease (SMD) or progressive metabolic disease (PMD), considering the most hypermetabolic lesion on each scan.
In cases of new lesions on PET/CT1 without clinical worsening, the response was qualified as unconfirmed progression (UPMD). Then, discrimination between true progressive disease and pseudo-progression was carried out using a second follow-up PET/CT (PET/CT2) performed after an additional month of treatment [27].
Response was also determined on follow-up CT performed at 8 to 12 weeks according to Response Evaluation Criteria in Solid Tumors version 1.1 (RECIST) [28]. When patients had no follow-up PET/CT, response was only assessed using RECIST. Patients were classified as responders if response was defined as either complete response (CR), partial response (PR) or stable disease (SD). Patients with progressive disease were considered as non-responders. Patients were treated until clinical worsening, confirmed progression or unacceptable toxicity.
Survival and Durable Clinical Benefit (DCB)
Overall survival (OS) was calculated as the time from initiation of immunotherapy to death, censored at the date of last follow-up for survivors. Progression-free survival (PFS) was determined as the time from treatment initiation to disease progression or death, censored at the date of last follow-up for survivors without progression. Durable clinical benefit (DCB) to immunotherapy was defined as alive and without disease progression at 6 months.
Statistical Analysis
We evaluated the discriminative power of clinical parameters (age, sex, smoking, ECOG PS, histology, PDL1, stage, previous treatment, immunotherapy line and molecule, tumor response) to predict the studied endpoints (OS, PFS, response, DCB) using chisquare and Mann-Whitney tests for quantitative and qualitative variables, respectively, with p-values < 0.05 considered to be statistically significant.
The Kaplan-Meier analyses with log-rank tests were performed for PFS and OS (Tables S5-S9).
To avoid overfitting, we discarded highly correlated features using Spearman's rank correlation, followed by a feature selection using Least Absolute Shrinkage and Selection Operator (LASSO) [29]. Area under the receiver operating characteristic curve (AUC) analysis, estimated using univariate logistic regression with Bootstrap, was then performed to evaluate the predictive value of each parameter (clinical parameters (CP), standard PET metrics and radiomics features from baseline and follow-up PET/CT) for the different endpoints.
In the multivariate analysis, 7 models (CP, PET, CT, PET-CP, CT-CP, PET-CT-CP) were built with the most promising selected features using the Random Forest classification method, with 10-fold cross validation repeated 10 times on the training set (75% of the initial data) for hyperparameters tuning with randomized patients split (100 iterations for sample bias correction). The number of variables selected was part of the model tuning process. Number of features varied between 3 and 8, with an increment of 1 for each. So, for each model, this number was unique, selected upon the best training results. Subsequently, the selected model (set of hyperparameters and selected features) was applied on the test sample (25% of the initial data). The performance of each model in predicting outcome was measured by AUC analysis.
The delta-radiomics features were defined as the relative net change between two images: relative Net Change = (FeatureT1−FeatureT0)/FeatureT0. Here, FeatureT0 was the value of a feature before the treatment and FeatureT1 was the value of the feature at the 2-month evaluation of the treatment. The delta-radiomics predictive power was also tested using the same methodology. All the analyses were performed with standard Python modules, including Sklearn, pandas and Matplotlib.
Patients Characteristics
Clinical and demographic characteristics of the 83 patients enrolled in this study are summarized in Table 1. No patient was lost at follow-up. Clinical parameters were not significantly different in responders and non-responders. Considering demographic data, ECOG performance status (PS) was associated with significant differences in OS and PFS. PFS and OS were significantly shorter in patients with PS ≥ 1 (p = 0.0005 and p = 0.003, respectively). PS and stage before immunotherapy were also significantly lower in patients who obtained DCB (p = 0.00009 and p = 0.03, respectively) (Table S3).
Survival tended to be longer in patients more than 63 years old ( Figure S1A).
Patient Outcomes
The median follow-up was 865 days (931 ± 569, range 98-1759 days). At the last followup, 40 patients (48%) were still alive and 18 (22%) were still receiving immunotherapy. Nine patients (11%) experienced immunotherapy-induced adverse effects (five with thyroiditis, one with rising liver enzymes, one with pneumonitis, one with Raynaud's syndrome and one with sensitive neuropathy).
Immunotherapy was stopped in 65 patients for various reasons: progression or clinical worsening in 49 patients (75%); unacceptable adverse event in four patients (6%); introduction of a high dose of corticosteroids (because of brain metastasis with edema) in four patients (6%); second cancer requiring the introduction of another chemotherapy in one patient (2%); 2 years of clinical benefit with immunotherapy in seven patients (11%).
Metabolic response was studied using PET/CT1 in 71 patients (85%), and 34 of them underwent a second PET/CT one month later (PET/CT2). According to iPER-CIST criteria, metabolic response after 3 months of treatment was as follows: CMR in three patients (4%), PMR in 29 patients (41%), SMD in eight patients (11%) and PMD in 31 patients (44%). Responder rate was 56% (40 patients). Out of the 40 responders, four were first assessed as PMD based on PET/CT1 and reclassified as either PMR (n = 3) or SMD (n = 1) using PET/CT2. In these cases of pseudo-progression, the patients ultimately obtained a durable clinical benefit (DCB). Response was evaluated using only RECIST 1.1 in 12 patients (PET/CT1 was not performed) and was as follows: 5 PR, 4 SD and 3 PD. A total of 49 patients were considered as responders (59%) and 34 as non-responders (41%) after three months of therapy. DCB was then obtained in 35 patients (42%).
Univariate Analysis
Best results of radiomics features extracted from the largest lung lesion at baseline (PET/CT0) and 2 months (PET/CT1) after treatment initiation are presented in Tables S2-S4 and Figures S1 and S2. Predictive value of parameters derived from follow-up PET/CT scns performed at month 3 will not be described in this paper as the sample size (34 patients) was too small to obtain reliable results. The performance of radiomics parameters in predicting response at month 2 (PET/CT using PERCIST) and month 3 (using iPERCIST for PET/CT and RECIST for CT) were studied but will not be detailed further in the following sections, given that they were similar to those predicting other primary endpoints. Therefore, only progression, DCB and survival results are considered in the results below.
At Baseline (PET/CT0) Standard PET-based features (SUVs, MTV, TLG) were not able to significantly discriminate between patients in terms of progression, DCB or survival (p = 0.44). Predictive performance of clinical parameters and standard PET/CT metrics were lower. The predictive power of ECOG PS and age were moderate with AUC of 0.70 for DCB and OS. AUC for volume and TLG did not exceed 0.67 to predict progression. SUV and all the other clinical features had low predictive power.
Advanced image analysis provided better results. For example, longer PFS and OS were observed in cases of high PET0_GLCM_Clustershade (p = 0.0007), low CT0_kurtosis (p = 0.001) and low CT0_GLSZM_GLNUN (p = 0.00003).
Moreover, PET-and CT-based radiomics features were able to predict outcomes with AUC up to 0.85 for progression and 0.80 for OS. Texture-based features had better performance than first-order and shape parameters. The highest predictive power was obtained with texture-based parameters representing regional or local heterogeneity characterization (such as CT0_GLRLM_LRLGLE (AUC 0.85) and PET0_GLCM_Imc1 (AUC 0.85) for progression, CT0_GLDM_SDE (AUC 0.80) and CT0_GLSZM_ ZonePercentage (AUC 0.80) for OS). Radiomics predictive power was moderate for PFS and DCB (AUC up to 0.74 for the best parameters).
Performance of clinical parameters and standard PET/CT metrics to predict outcome remained low, similarly to those at baseline. A higher number of radiomics features demonstrated a high predictive value (as demonstrated by an AUC ≥ 0.80), especially for progression, with AUC up to 0.91 (Variance for CT1) and 0.88 (PET1_Maximum), for example. After 2 months of treatment and unlike at baseline, first-order parameters (extracted from filtered images) managed to perform equally to shape-based and some more complex texture-based features. Radiomics overall predictive performances at month 2 were higher than at baseline, except for the prediction of DCB.
Delta-Radiomics
Baseline and follow-up PET/CT studies were used to determine radiomics features variation during treatment (delta-radiomics). None of these features achieved higher predictive performance than parameters at month 2 (PET/CT1). Increasing size of the lesion (as reflected by the least axis length (p = 0.00006) and mesh volume (p = 0.0008)) was associated with non-response. We also observed that non-responder tumors tended to lose the roundness of their shape, with a decrease in sphericity (p = 0.1) and flatness (p = 0.16), but these changes were not statistically significant.
DeltaPET parameters demonstrated an equally high predictive power for PFS and OS (AUC = 0.81 for deltaPET_GLDM_LGLE and AUC = 0.83 for deltaPET GLRLM_RunEntropy, respectively) compared with PET/CT1 features (AUC = 0.83 with PET1_GLCM_ClusterTendency, AUC = 0.84 with CT1_GLCM_Imc2 for PFS, and AUC = 0.82 for PET1_GLRLM_SRLGLE for OS). DeltaCT features had a slightly lower predictive power for OS compared with PET/CT1 features (AUC = 0.73 for deltaCT_GLRLM_LRLGLE and AUC = 0.81 for CT1_GLSZM_SZNU). The performance of delta-radiomics features were better than baseline parameters in predicting PFS (AUC of 0.84 for deltaCT, 0.81 for deltaPET and 0.74 and 0.73 for TEP0 and CT0, respectively). They did not perform better than single time-point features for DCB (AUC of 0.77 and 0.73 for deltaPET and deltaCT and AUC of 0.74 and 0.75 for PET0 and CT0, respectively) or for progression (AUC = 0.82 for deltaCT_flatness and 0.74 for deltaPET_GLCM_Correlation).
Multivariate Analysis
Seven multivariate prediction models were composed of a variable number of selected features (from 3 to 18): clinical parameters alone (CP), PET-and CT-derived parameters alone or combined with CP. The results are presented in Figure 1 (training) and Figure 2 (testing). The radiomics-based models consisted only of single-time point features (TEP/CT0 or TEP/CT1), given that delta-radiomics did not show higher performances. The metabolic response determined using PERCIST on PET/CT1 was integrated into the models established at month 2. The performances in predicting response to immunotherapy (assessed with PERCIST, iPERCIST and RECIST) of each model were also investigated and were similar to those of other outcomes (DCB, progression, survival) and therefore will not be further detailed. We observed a similar trend compared with the results obtained at baseline ( Figures 1B and 2B). The CP model was less efficient than models including radiomics features. (Figures 1A and 2A). Among available clinical parameters, only ECOG PS was selected for DCB and PFS and only age for OS in the process of model building. Models including radiomics features had a high predictive value outcome with AUCs over 0.80, except for the CT-CP model (AUC of 0.75 for the prediction of DCB in the testing subset). The PET radiomics model outperformed the CT model in predicting DCB, progression and PFS. Combining PET and CT features further improved performance for the prediction of DCB, progression and OS, compared to PET or CT features-only models. The most contributing radiomic features to the models were first-order parameters extracted from filtered CT images and texture features extracted from PET and CT images (such as skewness, median, NGTDM_Complexity, GLCM_Autocorrelation and GLCM_imc1). During the building process, AUC varied greatly for some models, with standard deviation up to 15% for the PET-CT-CP model predicting PFS (Figure 1). Highest stability (SD = 3%) was obtained predicting progression using PET-CT (AUC of 0.96 and 1 for the training and validation subsets, respectively), DCB using PET (AUC of 0.82 and 1) and PET-CP (AUC of 0.78 and 1), PFS using PET-CT (AUC of 0.65 and 1) and PET-CT-CP (AUC of 0.74 and 1) and OS using PET-CP (AUC of 0.83 and 1).
At Month 2 (PET/CT1)
We observed a similar trend compared with the results obtained at baseline (Figures 1B and 2B). The CP model was less efficient than models including radiomics features. There was an overall increase of prediction performances for most of the multivariate models for progression, PFS and OS, in addition to more consistent results between the training and testing subsets, especially for progression and PFS. The models that appeared to be the most promising for the different outcomes were The most contributing features to the models were textural features, first-order parameters extracted from filtered images (PET and CT), age, ECOG PS and response assessed with PERCIST on PET/CT.
We have performed an analysis of the radiomics quality, according to which our study scores19 points (out of 36, Table S10) [30].
Discussion
The action of anti-PD-1 and anti-PD-L1 antibodies differs from conventional chemotherapies and has induced new evolution patterns, making imaging-based response assessment more challenging. Response may be delayed, and early tumor infiltration by immune cells may induce an initial increase in lesion size. In order to take into account these atypical patterns, we chose to evaluate patients according to iPERCIST criteria, as proposed by Goldfarb et al. in 2019 [27]. We identified four patients (5%) with pseudo-progressions, which is consistent with previous studies in relation to a temporary increase in tumor burden to transient immune-cell infiltrate followed by tumor regression [31]. All of these patients subsequently obtained a lasting clinical benefit. This is again in agreement with previous studies reporting the occurrence of pseudo-progression being a good prognostic factor [32][33][34]. It is therefore important to be able to identify these response patterns to avoid stopping a potentially effective treatment too early.
We investigated the ability of clinical parameters and standard baseline PET/CT metrics (SUV, MTV, TLG) to discriminate between patients in terms of response (according to PERCIST at the first restaging, iPERCIST and RECIST1.1 after 3 months of treatment), DCB and survival. Low ECOG PS (PS = 0) and tumor stage (stage III vs. IV) were associated with DCB. These results are consistent with those of Seban et al. [35] and Nardone et al. [36]. In addition, OS was longer in patients with smoking history, in agreement with immunotherapy having been found to have a greater benefit in NSCLC patients with a smoking history than in those who had never smoked [37]. None of the considered clinical parameters was able to discriminate responders from non-responders.
Some authors previously reported a relationship between large MTV, high TLG and progression during immunotherapy, suggesting a potential predictive value of these parameters to predict response and survival [38,39]. In our study, these easily calculated features were not statistically different according to response or outcome, and therefore they did not reach a high level of predictive power, probably because of a narrower distribution of their values in our selected population.
On the contrary, a large number of PET and CT radiomics features were correlated with therapeutic response, DCB and survival and had a high predictive value (AUC ≥ 0.80). The best-performing parameters at baseline were texture parameters. First-order and shape features also demonstrated a high predictive value, especially at the first restaging (PET1).
Overall, PET and CT parameters extracted from PET/CT1 were greater predictors than those at baseline (with a gain ranging from 5 to 10% for the AUC of the best parameters for progression and PFS). Moreover, features at 4 months (PET2) showed AUCs up to 1 for the prediction of DCB and OS. This gain in predictive power should be taken with caution as there were fewer patients in the group studied at month 2 (71 segmented tumors) and month 3 (n = 34) compared with baseline, which could result in a higher risk of overfitting.
OS and PFS were significantly longer in patients with more homogeneous tumors at baseline and at the first restaging. These results are in agreement with previous studies [36,38,40]. Nardone et al. [36] reported that high entropy related to tumor aggressiveness in the literature [41] and low correlation were both associated with poor prognosis. Ahn et al. also found that contrast and busyness were able to predict recurrence in surgically treated patients [42]. A low value of coarseness was an independent prognostic biomarker associated with a high risk of recurrence in our study. This finding is in contrast with Mu et al. [19] reporting patients with more heterogeneous tumors to have a higher probability of obtaining DCB.
In terms of shape, Mu et al. reported that patients with more convex tumors had a greater chance to achieve DCB [19]. Indeed, sphericity is thought to reflect PD-L1 expression and thus potential response to treatment, as PD-L1 cells could form rounder lesions according to Saeed-vafa et al. [43]. In our study, tumor shape also appeared to be significant for outcome, with longer PFS and OS in patients with more rounded but spiculated lesions on the first follow-up PET/CT, reflected by high sphericity and high Surface Volume Ratio, respectively. An increasing size of the lesion during the first 2 months was associated with non-response, as expected. Regarding tumor boundaries, Dercle et al. demonstrated that early regularization of tumor margins was strongly associated with response to nivolumab and gefitinib [44]. Complex tumor boundaries are indeed conventionally associated with tumor aggressiveness and worse outcome [45,46]. In our study, while non-responder tumors tended to lose the roundness of their shape, an increase in the smoothness of tumor contours (decrease in surface-to-volume ratio) was surprisingly associated with non-response. This atypical finding could result from the sensitivity of shape features to segmentation and respiratory motion. Deep learning used for feature extraction without the need for an intermediate segmentation step may be useful in the future to overcome such limitations [47].
Using PET-based multivariate modeling was more efficient in predicting DCB, progression and PFS, while CT remained a better predictor of OS. Those results underlined the complementarity of both imaging techniques. This was confirmed by an improvement of combined PET/CT models in predicting DCB, progression and OS. Unsurprisingly, the addition of low-performing clinical parameters did not further improvethe outcome prediction. It has been shown in prior studies that combined multi-modality models could perform better than single-modality approaches (clinical, radiomics or genomic data) for outcome prediction [48]. Overall, all multimodality models including radiomics features in the testing subset achieved a high predictive power (AUC ≥ 0.80) for all outcomes. The most significant radiomics features included in the models were texture features extracted from PET and CT images and first-order parameters extracted from filtered CT images. The results of the models whose performance varied the most between the training and testing subsets should be taken with caution. The models that appeared the most promising were therefore PET-CT-CP for DCB, PET-CT for progression and PET for PFS. The lowest variability of performance estimates (AUCs) was obtained for the prediction of progression, which is consistent with the highest predictive performance during the univariate analysis. The performances of these models are similar to those obtained by Mu et al. [19] in developing a radiomic signature to predict DCB in NSCLC patients treated with immunotherapy. They combined radiomics features extracted from PET, CT images and the fused PET and CT images (KLD), ECOG PS and histology with an AUC of 0.89 for the training dataset and AUCs of 0.86 in both the retrospective and prospective tests cohorts.
Our study had some limitations, including its retrospective design and the small sample size. The interval of time between baseline PET/CT and the introduction of immunotherapy in patients treated in our institution was variable, and we chose to only include patients with a maximum delay of 3 months (from a few days to 3 months maximum) to take into account the natural history of lung cancer and avoid non-representative baseline PET/CT results in a rapidly evolving pathology. This meaningful choice reduced our inclusion potential. However, in this study we applied a highly appropriate methodology to overcome the risk of overfitting, considering the large number of features extracted and the small size of the population. Indeed, to address this issue, we selected features using two steps. First, over-correlated parameters using Spearman rank coefficients were discarded. Then, the LASSO algorithm was used to select the most promising parameters as it is known to be a robust statistical method for data reduction [49]. In addition, we performed a cross-validation to build our models, which has been shown to be an efficient method to provide an unbiased estimation on survival prediction [50]. This rigorous methodology allowed us to consider a very large number of parameters to start with, and to avoid missing potentially important ones. Radiomics features extraction and analysis is complex and involves many steps that can affect the reproducibility of studies based on this approach [51]. After acquisition, segmentation is the first critical step for which we used a valid and robust method (FLAB) on PET images. Using a low-dose CT performed for PET attenuation correction, tumor segmentation on CT images was facilitated by automated alignment of the datasets from the acquisition system (PET/CT). Various filtering and quantization were applied to original datasets since no pre-processing consensus has yet been achieved, despite harmonization efforts from the scientific community. We partly addressed the issue of reproducibility and validation following image biomarker standardization and consensus-based definitions and guidelines for generating radiomics [52].
In this study, the median predicted value was used as a cut-off point to dichotomize highand low-risk patients. It is likely that different values would yield different results. However, testing multiple cutoffs to find the best one without an independent validation dataset in which to test it has been repeatedly shown to yield overly optimistic results [49,50]. By using the median, this source of bias is avoided, and the conclusions remain conservative.
The fact that patient recruitment was carried out over several years (2016 to 2020) explained the heterogeneity of our population reflecting the gradual appearance of the various immunotherapy molecules and their combination with chemotherapy. Rapidly evolving practice resulted in immunotherapy being introduced in our population either in the first or second line with different treatment regimens. This resulting population heterogeneity is representative of that observed in clinical routine. The predictive value of PD-L1 status could not be investigated since it was not available for a third of our population, given that it was not necessarily requested for immunotherapy prescription, especially before 2019.
Only 34 patients had a second follow-up PET/CT scan, given that this exam is not systematically recommended in routine for the follow-up of lung cancers. As demonstrated, it was found useful to better characterize initial progression, but it may be interesting to also suggest its use in a larger study based on our promising results for the prediction of DCB and OS.
Validation is always a crucial point in radiomics studies. To validate our predictive models, we divided our population into training and validation datasets. This choice necessarily led to a small-size validation group in which individual variability could explain slightly lower performance.
Conclusions
The introduction of immunotherapy in the management of locally advanced and metastatic lung cancer has improved patient survival but only achieves a lasting clinical benefit in 20 to 50% of patients. The search for biomarkers that can successfully identify patients likely to benefit from this treatment is therefore a major challenge. Our study showed that radiomics parameters extracted from baseline and follow-up PET/CT scans, as well as their evolution during treatment, could play an important role in evaluating the risk of progression during treatment and in predicting response to therapy, DCB and survival of NSCLC patients treated with immunotherapy. As demonstrated in this realclinical-conditions cohort, these parameters seemed to provide a real added value for outcome prediction compared with clinical or standard PET/CT metrics alone, which could be beneficial for personalized patient management. Although promising, these results provide the rationale for an external validation in a large prospective cohort to ensure their clinical significance.
Supplementary Materials: The following supporting information can be downloaded at: https: //www.mdpi.com/article/10.3390/cancers14235931/s1. Table S1: Acquisition, reconstruction et preprocessing parameters; Table S2: List of radiomics parameters; Table S3: Results of descriptive analysis for OS, PFS and DCB; Table S4: Results of univariate analysis with bootstrap for durable clinical benefit (DCB) (mean AUC with standard deviation and confidence intervals); Table S5: Kaplan-Meier and Cox analysis scores for clinical parameters: (A) Progression-Free Survival, (B) Overall survival; Table S6: Progression-Free Survival Kaplan-Meier and Cox analysis scores for PET radiomics; Table S7: Overall Survival Kaplan-Meier and Cox analysis scores for PET radiomics; Table S8: Progression-Free Survival Kaplan-Meier and Cox analysis scores for CT; Table S9: Overall Survival Kaplan-Meier and Cox analysis scores for CT radiomics; Table S10: Radiomics Quality Score; Figure S1: OS and PFS (Kaplan-Meier and log rank test) related to (A) age, (B) performance status, (C) histology, (D) smoking history, (E) baseline metabolic tumor volume, (F) baseline total lesion glycolysis; Figure S2: Prediction of outcome: Best clinical, PET and CT parameters performance at (A) baseline and (B,C) during treatment: best AUC value obtained for the considered parameters using univariate analysis with bootstrap. Informed Consent Statement: Ethical review and approval were waived for this study, due to the retrospective nature of this study of previously anonymized data.
Data Availability Statement:
The data presented in this study are available on request from the corresponding author.
Conflicts of Interest:
The authors declare no conflict of interest.
|
v2
|
2022-12-07T19:09:34.010Z
|
2022-11-30T00:00:00.000Z
|
254303391
|
s2orc/train
|
Management and Prognosis of Cardiac Metastatic Merkel Cell Carcinoma: A Case–Control Study and Literature Review
Simple Summary Approximately 20% of patients with Merkel cell carcinoma (MCC) will develop distant metastasis. Rarely, MCC metastases may involve the heart; there are limited data on management and prognosis of cardiac metastasis of MCC. Among a prospective registry of 582 patients with metastatic MCC (mMCC), we identified 9 patients (1.5%) with cardiac involvement. We found that cardiac mMCC most commonly involves the right heart (8 of 9; 89%) and occurs relatively late in the disease process (median 925 days from the initial diagnosis to cardiac involvement). In our cohort, cardiac mMCC frequently responds to immunotherapy and cardiac radiotherapy, which can both be delivered with minimal cardiac toxicity. Cardiac involvement was not associated with worse survival compared to MCC patients with non-cardiac distant disease. These results are timely as cardiac mMCC may be increasingly encountered in the era of immunotherapy as patients with metastatic MCC live longer. Abstract Merkel cell carcinoma (MCC), an aggressive neuroendocrine skin cancer, has a high rate (20%) of distant metastasis. Within a prospective registry of 582 patients with metastatic MCC (mMCC) diagnosed between 2003–2021, we identified 9 (1.5%) patients who developed cardiac metastatic MCC (mMCC). We compared overall survival (OS) between patients with cardiac and non-cardiac metastases in a matched case–control study. Cardiac metastasis was a late event (median 925 days from initial MCC diagnosis). The right heart was predominantly involved (8 of 9; 89%). Among 7 patients treated with immunotherapy, 6 achieved a complete or partial response of the cardiac lesion. Among these 6 responders, 5 received concurrent cardiac radiotherapy (median 20 Gray) with immunotherapy; 4 of 5 did not have local disease progression or recurrence in the treated cardiac lesion. One-year OS was 44%, which was not significantly different from non-cardiac mMCC patients (45%, p = 0.96). Though it occurs relatively late in the disease course, cardiac mMCC responded to immunotherapy and/or radiotherapy and was not associated with worse prognosis compared to mMCC at other anatomic sites. These results are timely as cardiac mMCC may be increasingly encountered in the era of immunotherapy as patients with metastatic MCC live longer.
Given the anatomic location, cardiac mMCC poses diagnostic and therapeutic challenges, and optimal management of cardiac mMCC is unclear. Within a large prospective registry, we reviewed patient and imaging characteristics, management, and outcomes of MCC patients who developed metastasis to the heart. We also conducted a review of previously published cases of cardiac mMCC. As a secondary objective, we explored whether cardiac mMCC is associated with a worse prognosis by matching our cases to a control cohort. To the best of our knowledge, this represents the largest reported cohort of mMCC to the heart and its management.
Patient Cohort and Eligibility
We queried a prospective MCC observational registry, which included patients with pathologically confirmed MCC. These patients were enrolled after informed consent between February 2003 and October 2021. The date of data lock was 29 October 2021. The registry was approved by the Institutional Review Board (IRB) at Fred Hutchinson Cancer Research Center (FHCRC IRB #6585, Seattle, WA, USA). Established protocols were followed for data entry and updates. At least annually, patients were contacted by email and/or phone for changes in disease status, recurrence/progression, and treatments. Patients with missing treatment details or inadequate follow-up to assess response and/or survival were excluded from the cohort. A matched reference cohort of patients with non-cardiac metastases was also selected from the registry, as described in the statistical analysis section. Patients were staged following the guidelines of the American Joint Cancer Committee (AJCC) eighth staging system [28].
Analysis of Pathological Data
Pathology of the primary site for all patients was independently reviewed by pathologists at our institution to confirm an initial diagnosis of MCC, with the exception of one patient. For the single patient whose specimens were not available for institutional pathological specimen review, the pathological report was reviewed to verify MCC diagnosis. MCPyV status was determined either by MCPyV oncoprotein antibody serology assay [29] or immunohistochemistry using anti-MCPyV T-antigen antibody (CM2B4) [30]. Pathological data were collected in cases with biopsy-confirmed cardiac mMCC.
Analysis of Radiological Imaging Studies
A single radiologist with expertise in both cardiothoracic imaging and nuclear medicine retrospectively reviewed pertinent imaging to confirm the location of cardiac metastasis. In addition, imaging studies at the time of and immediately prior to cardiac metastasis were reviewed to identify concurrent sites of metastasis. Radiological assessment of response was determined by Response Evaluation Criteria in Solid Tumors (RECIST) version 1.1 [31].
Literature Search
We performed a literature search using PubMed (National Center for Biotechnology Information, Bethesda, MD, USA), conducted on 19 May 2022. Search keywords included "Merkel cell carcinoma", "cardiac", "heart", "metastasis", or "metastatic". Non-English reports were excluded, except 1 French report with an English abstract. Additionally, excluded were reports of cases that metastasized only to pleura or pericardiac lymph nodes. One case report was also excluded because the same patient had previously been reported.
Statistical Analysis
Descriptive analyses were performed to summarize clinical and patient data. Overall survival (OS) time was defined as time of cardiac mMCC diagnosis to all-cause mortality; OS rates and median OS was estimated using the Kaplan-Meier estimator. Duration of local control was defined as time from cardiac mMCC diagnosis to time of progression at the site of the initial treated cardiac lesion with death considered as a competing risk. Local control rates and median duration of local control was estimated using the empirical cumulative incidence function [32]. Outcomes were censored at the time of the last follow-up available by the study cut-off date.
To explore whether patients with cardiac mMCC have worse OS compared to patients with non-cardiac mMCC, we selected a reference cohort with non-cardiac mMCC from the same prospective MCC observational registry. The reference cohort was matched to the cardiac mMCC patients using the following covariates that may influence OS: immune suppression status, age (±10 years), sex, disease status of stage IV at initial diagnosis (versus at relapse/progression), and number of prior metastatic episodes. OS time for the non-cardiac mMCC patients was defined as the time from the matching non-cardiac mMCC diagnosis to all-cause mortality to be comparable with the definition of OS used for the cardiac mMCC patients. The matching non-cardiac mMCC diagnosis was the one with the same number of prior metastatic episodes as the matched cardiac mMCC patient at the time of the cardiac mMCC diagnosis. Because of the small sample size of cardiac mMCC patients, all available non-cardiac mMCC matches were included for each cardiac mMCC patient. Calculations were weighted to account for a variable number of matches per cardiac mMCC patient [33]. A detailed description of the selection of the reference cohort is provided in the Supplementary Material Text S1. The non-parametric bootstrap was used to calculate 95% confidence intervals (CIs) for the cardiac and non-cardiac mMCC OS curves [34]. The OS curves were compared using the stratified log-rank test, and thus, each cardiac mMCC patient was only compared with matching non-cardiac mMCC patients [35,36] All statistical calculations were conducted with the statistical computing language R (version 4.0.3; R Foundation for Statistical Computing, Vienna, Austria).
Patients and Tumor Baseline Characteristics
Among 1625 patients with MCC in our registry, 582 patients (36%) had distant metastases identified either at the time of initial MCC diagnosis (n = 130; 8%) or after initial treatment on surveillance (n = 452; 28%). Among these 582 patients, 9 (1.5%) had mMCC to the heart. One cardiac metastasis was identified at initial diagnosis, while the other 8 developed after initial diagnosis (range 302-1494 days). Patient baseline characteristics at the initial MCC diagnosis are summarized in Table 1. The median age at initial diagnosis was 69 (range 52-86), with a male predominance. The most common initial primary site was the extremity (n = 4; 44%). Most patients had local/regional disease at diagnosis (1 stage I, 6 stage III), and the majority were MCPyV-positive.
Cardiac Metastatic MCC
In all 9 patients, cardiac mMCC was detected incidentally on surveillance or baseline imaging. Cardiac mMCC was first noted on fluorodeoxyglucose (FDG) positron emission tomography/computed tomography (PET/CT) with intensive FDG uptake in 6 patients and on contrast CT in 3 patients (Table 2). Among a total 5 patients who had contrast CT (with or without PET), the cardiac lesions were broad-based/sessile in 3 patients and pedunculated in 2 patients. For 2 patients (patient #4 and #5), the right atrial lesion was initially overlooked as a contrast mixing artifact.
Upon further evaluation, only 2 patients (patient #2, 5) were symptomatic at the time of cardiac mMCC diagnosis. The other 7 patients initially denied cardiac symptoms, but 2 of 7 (patient #4, 8) eventually developed cardiac complications such as pericardial effusion and atrial fibrillation due to progression of cardiac MCC, and both patients died from heart failure ( Table 3).
Nearly all initial cardiac lesions (8 of 9 cases) were observed in the right atrium and/or adjacent pericardium; only 1 patient presented with a cardiac lesion in the left atrium. Cardiac metastasis usually occurred as a later distant metastatic event. The median time between initial MCC diagnosis and first distant metastasis was 274 days [range 0-1494], while the interval between initial diagnosis and cardiac mMCC was 925 days [range 0-1494]. Only 1 patient had cardiac mMCC at the time of initial MCC diagnosis. The remaining 8 patients developed cardiac mMCC after 1 or more events of metastases (regional; n = 2, distant; n = 6). Of these 8, 5 patients had received systemic therapy prior to developing cardiac mMCC (Table 2).
Median follow-up after diagnosis of cardiac mMCC until death or last follow-up date was 325 days (range 85-2596). A detailed clinical vignette for a representative patient is presented in Figure 1. a: Overall survival is defined as "days from the date of cardiac mMCC diagnosis to the date of death". Patients who were alive at the time of data cut-off were censored at the date last known to be alive. b: Prior to developing cardiac mMCC, the patient was treated with pembrolizumab with progression disease, then switched to a combination therapy of nivolumab and ipilimumab with progression disease. Thus, chemotherapy was initiated. c: Developed grade 3 immune-mediated pneumonitis 8 months into avelumab treatment. d: Immunotherapy was not available at that time. e: Achieved complete response to pembrolizumab monotherapy without radiotherapy, including the initial lesion in the right side of the heart. However, the patient had a local cardiac recurrence at the site of the initial right-sided heart lesion about 2 years later and eventually developed a new metastasis in the left side of the heart. f: Immunotherapy was not available, and the patient first started systemic therapy with carboplatin and etoposide for metastatic MCC lesions in the heart and pancreas with a progressive disease of the pancreatic lesion. On subsequent cardiac magnetic resonance imaging (MRI), there was an irregular mass in the right atrium that was attached to the interatrial septum and extended superiorly to the distal superior vena cava (panel c-i). This mass demonstrated high signal intensity on the T2 black-blood sequence (panel c-ii), weak perfusion on perfusion MRI (panel c-iii), and late gadolinium enhancement on late postcontrast sequence (panel c-iv), which indicated that this did not represent a thrombus. The cardiac mass was biopsied under intracardiac echocardiography (panel d) with pathology confirming metastatic MCC. The patient started first-line systemic therapy with avelumab followed by palliative radiation therapy to the primary MCC of the left buttock with 30 Gray (Gy) in 10 fractions and to the right atrium mass with 20 Gy in 8 fractions. Compared to contrast CT performed before RT (panel e), a restaging CT scan performed 1 month after RT completion showed complete resolution of the right cardiac MCC mass (panel f). His primary MCC disease on the buttock also had a complete response. He discontinued avelumab due to grade 3 immune-related pneumonitis 8 months after, without clinically apparent evidence of MCC.
Unfortunately, approximately 6 months after avelumab discontinuation, he was found to have a new enhancing left pericardial lesion measuring 1.9 × 1.2 cm in size on contrast CT outside the radiation field. On a Gallium-68 (Ga 68 ) Dotatate PET/CT, there was no uptake in the initially treated right atrium (panel g-i), but there was a new intense radiotracer uptake in the left pericardial lesion (blue arrow. Red * showed physiological uptakes) (panel g-ii). He had a single 8 Gy fraction of radiation therapy to the new left pericardial mass, but the lesion progressed. Monthly somatostatin analog therapy was initiated but discontinued after 7 doses due to disease progression. The patient then switched to combination therapy with ipilimumab and nivolumab, but he passed away from non-MCC causes 6 months after initiating the combination immunotherapy. The red arrow shows the cardiac mMCC in the right atrium. His primary MCC disease on the buttock also had a complete response. He discontinued avelumab due to grade 3 immune-related pneumonitis 8 months after, without clinically apparent evidence of MCC. Unfortunately, approximately 6 months after avelumab discontinuation, he was found to have a new enhancing left pericardial lesion measuring 1.9 × 1.2 cm in size on contrast CT outside the radiation field. On a Gallium-68 (Ga 68 ) Dotatate PET/CT, there was no uptake in the initially treated right atrium (panel g-i), but there was a new intense radiotracer uptake in the left pericardial lesion (blue arrow. Red * showed physiological uptakes) (panel g-ii). He had a single 8 Gy fraction of radiation therapy to the new left pericardial mass, but the lesion progressed. Monthly somatostatin analog therapy was initiated but discontinued after 7 doses due to disease progression. The patient then switched to combination therapy with ipilimumab and nivolumab, but he passed away from non-MCC causes 6 months after initiating the combination immunotherapy. The red arrow shows the cardiac mMCC in the right atrium.
Treatment for Cardiac mMCC
Patients were heterogeneously treated for cardiac mMCC at their discretion of their oncologist ( Table 3). Five of 9 patients (patient #2, 3, 4, 5, and 7) received both radiotherapy to the cardiac lesion and immunotherapy such as programmed death-1 (PD-1) pathway blocking agents and/or anti-cytotoxic T lymphocyte antigen-4 (CTLA-4) agents. The other 4 patients received immunotherapy alone (patient #8), somatostatin analog alone (patient #6; immunotherapy was not available at that time), and chemotherapy (patient #1 developed cardiac mMCC while on immunotherapy; patient #9 initiated chemotherapy when immunotherapy was not yet available but later switched to immunotherapy). Figure 2 describes each patient's disease trajectory, the timing of cardiac metastasis, and treatment. No patients developed therapy-related cardiac complications such as radiationor immunotherapy-induced pericarditis.
Treatment for Cardiac mMCC
Patients were heterogeneously treated for cardiac mMCC at their discretion of their oncologist ( Table 3). Five of 9 patients (patient #2, 3, 4, 5, and 7) received both radiotherapy to the cardiac lesion and immunotherapy such as programmed death-1 (PD-1) pathway blocking agents and/or anti-cytotoxic T lymphocyte antigen-4 (CTLA-4) agents. The other 4 patients received immunotherapy alone (patient #8), somatostatin analog alone (patient #6; immunotherapy was not available at that time), and chemotherapy (patient #1 developed cardiac mMCC while on immunotherapy; patient #9 initiated chemotherapy when immunotherapy was not yet available but later switched to immunotherapy). Figure 2 describes each patient's disease trajectory, the timing of cardiac metastasis, and treatment. No patients developed therapy-related cardiac complications such as radiation-or immunotherapy-induced pericarditis. The clinical course of this patient is described in Figure 1. Patient #8 received immunotherapy without radiation. Although Patient #8 achieved complete response including the initial lesion in the right side of the heart, the patient had a local cardiac recurrence about 2 years later and eventually developed a new metastasis in the left side of the heart. (a) Local response at the treated 1st cardiac mMCC.
Prognosis of Patients with Cardiac mMCC
Overall, 6 of 7 patients treated with immunotherapy achieved objective response in the cardiac lesion, either complete response (CR; n = 5) or partial response (PR; n = 1). Among these 6 patients, 1 patient (patient #8) treated with immunotherapy alone developed a local recurrence at the site of the initial cardiac lesion about 2 years after CR. The other 5 patients (patient #2, 3, 5, 7, 9) treated with a combination of immunotherapy and cardiac radiotherapy of 20-25 Gray (Gy) had durable local disease control, and only one of them (patient #5) developed local recurrence in the treated cardiac lesion. The one patient (patient #4) who did not respond to immunotherapy received 8Gy cardiac RT concurrently and rapidly declined. The remaining 2 patients (patient #1, 6) treated without The heavy black lines represent responses to cardiac metastasis-directed treatment. Patient #3 developed the new subsequent cardiac metastasis outside the radiation field in the left side of the heart and did not recur in the initial treated cardiac lesion. The clinical course of this patient is described in Figure 1. Patient #8 received immunotherapy without radiation. Although Patient #8 achieved complete response including the initial lesion in the right side of the heart, the patient had a local cardiac recurrence about 2 years later and eventually developed a new metastasis in the left side of the heart. (a) Local response at the treated 1st cardiac mMCC.
Prognosis of Patients with Cardiac mMCC
Overall, 6 of 7 patients treated with immunotherapy achieved objective response in the cardiac lesion, either complete response (CR; n = 5) or partial response (PR; n = 1). Among these 6 patients, 1 patient (patient #8) treated with immunotherapy alone developed a local recurrence at the site of the initial cardiac lesion about 2 years after CR. The other 5 patients (patient #2, 3, 5, 7, 9) treated with a combination of immunotherapy and cardiac radiotherapy of 20-25 Gray (Gy) had durable local disease control, and only one of them (patient #5) developed local recurrence in the treated cardiac lesion. The one patient (patient #4) who did not respond to immunotherapy received 8Gy cardiac RT concurrently and rapidly declined. The remaining 2 patients (patient #1, 6) treated without immunotherapy/cardiac RT also developed local disease progression. The median duration of local control of the initial cardiac lesion was 679 days. Local control rates were 56% at 1 year and 44% at 3 years.
At the data cut-off date, 2 of 9 patients were still alive (1 had ongoing CR, 1 relapsed with a new non-cardiac metastasis 4 years after immunotherapy discontinuation in the setting of CR), and 7 have died. OS was 44% and 15% at 1 year and 3 years, respectively, following cardiac metastasis (Figure 3). A total of 296 non-cardiac mMCC patients were matched to our cardiac mMCC cohort. Each of the 9 cardiac mMCC patients had at least one matching non-cardiac mMCC patient, with 3-109 matches per cardiac mMCC patient [median : 13]. In the matched non-cardiac mMCC cohort, the median OS was 257 days, with OS at 1 year and 3 years of 45% and 36%, respectively. As shown in Figure 3, there was a substantial overlap between the 95% CIs for OS among the cardiac mMCC and matched non-cardiac mMCC patients. The difference between survival in the two cohorts was not statistically significant (p = 0.96 by stratified log-rank test).
Review of Published Literature
There were 14 unique patients with cardiac mMCC reported in the published case reports between 1990 to 2019 (Table 4) [14][15][16][17][18][19][20][21][22][23][24][25][26][27]. The median age at diagnosis was 67.5 years (range 23-82 years) with a male predominance (male 9, female 5). The most common site of cardiac metastasis was the right side of the heart (n = 11, 79%; right atrium n = 8, 57% and/or right ventricle n = 4, 29%). The most common primary site was the extremity (n = 6; 43%), followed by head/neck (n = 4; 29%). Cardiac metastasis was the first distant metastasis event for 8 of 14 patients (57%) and the second event for 6 (43%). Cardiac mMCC was detected simultaneously with other distant metastasis sites (lung, pancreas, stomach) in 4 patients. immunotherapy/cardiac RT also developed local disease progression. The median duration of local control of the initial cardiac lesion was 679 days. Local control rates were 56% at 1 year and 44% at 3 years. At the data cut-off date, 2 of 9 patients were still alive (1 had ongoing CR, 1 relapsed with a new non-cardiac metastasis 4 years after immunotherapy discontinuation in the setting of CR), and 7 have died. OS was 44% and 15% at 1 year and 3 years, respectively, following cardiac metastasis (Figure 3). A total of 296 non-cardiac mMCC patients were matched to our cardiac mMCC cohort. Each of the 9 cardiac mMCC patients had at least one matching non-cardiac mMCC patient, with 3-109 matches per cardiac mMCC patient [median : 13]. In the matched non-cardiac mMCC cohort, the median OS was 257 days, with OS at 1 year and 3 years of 45% and 36%, respectively. As shown in Figure 3, there was a substantial overlap between the 95% CIs for OS among the cardiac mMCC and matched non-cardiac mMCC patients. The difference between survival in the two cohorts was not statistically significant (p = 0.96 by stratified log-rank test). The OS time was calculated starting from the date of cardiac mMCC diagnosis for the cardiac mMCC patients and starting from the date of the matching non-cardiac mMCC diagnosis for the non-cardiac mMCC patients. The matching non-cardiac mMCC diagnosis was the one with the same number of prior metastatic episodes as the matched cardiac mMCC patient at the time of the cardiac mMCC diagnosis (see the supplemental materials for more detail on the matching). The 95% confidence intervals for the two survival curves are shown using the blue dashed lines and solid gray region, respectively. The tick marks on each curve indicate censoring times. The two curves were not statistically significantly different (p = 0.96 by the stratified log-rank test).
Review of Published Literature
There were 14 unique patients with cardiac mMCC reported in the published case reports between 1990 to 2019 (Table 4) [14][15][16][17][18][19][20][21][22][23][24][25][26][27]. The median age at diagnosis was 67.5 years (range 23-82 years) with a male predominance (male 9, female 5). The most common site of cardiac metastasis was the right side of the heart (n = 11, 79%; right atrium n = 8, 57% Figure 3. Overall survival among cardiac mMCC patients and non-cardiac mMCC patients matched by number of prior metastases. Overall survival (OS) of the cardiac mMCC patients (blue line) and matched non-cardiac mMCC patients (gray line). The OS time was calculated starting from the date of cardiac mMCC diagnosis for the cardiac mMCC patients and starting from the date of the matching non-cardiac mMCC diagnosis for the non-cardiac mMCC patients. The matching non-cardiac mMCC diagnosis was the one with the same number of prior metastatic episodes as the matched cardiac mMCC patient at the time of the cardiac mMCC diagnosis (see the Supplemental Materials for more detail on the matching). The 95% confidence intervals for the two survival curves are shown using the blue dashed lines and solid gray region, respectively. The tick marks on each curve indicate censoring times. The two curves were not statistically significantly different (p = 0.96 by the stratified log-rank test). Of the 14 previously described cases, 9 patients were treated for cardiac mMCC with systemic therapy (7 received chemotherapy, 2 immunotherapy) and/or radiotherapy. Immunotherapy was not available when these 7 patients were initially treated with chemotherapy. In the remaining 5 patients, 2 had radiotherapy alone, 1 underwent surgery, and 2 patients received no treatment-one due to a combination of age, comorbidities, and economic status, and the other because the patient died within days of cardiac mMCC diagnosis.
Approximate survival data, including follow-up time and survival status, were reported for 10 of 14 patients. Six of 10 patients died within 1 year of cardiac mMCC diagnosis, one patient died approximately 4.5 years after cardiac mMCC diagnosis, and three patients survived at least 8-12 months after cardiac mMCC diagnosis. OS at 1 year for the previously reported patients was estimated as 34%.
Discussion
Though a rare event in a rare disease, our case-control study and comparison with previously reported patients highlight several important patterns in cardiac metastases from MCC. Management of mMCC has advanced over the last 5-10 years. Immunotherapy has improved progression-free survival (PFS) and OS compared to conventional chemotherapy, which was associated with short durability (median PFS 90 days) and life expectancy (median OS 9.5 months) [1,[37][38][39][40][41][42]. Avelumab, an anti-programmed death-ligand 1 (PD-L1) inhibitor, was the first FDA-approved drug for MCC in March 2017, and pembrolizumab, an anti-PD-1 inhibitor, was approved in December 2018. All patients with cardiac mMCC within our cohort were diagnosed between 2014-2021, and all but 3 were diagnosed in 2018 or later (i.e., in the era of immunotherapy) despite an eligibility period of 2003-2021. Moreover, cardiac involvement by MCC was a late, distant event. With improved survival associated with immunotherapy, late spread of MCC, including cardiac metastases, may be increasingly observed as patients survive longer. Our study is, therefore, timely to increase awareness of this pattern of relapse and to provide early therapeutic data. Despite the atypical location, cardiac involvement does not appear to be associated with worse survival compared to MCC with non-cardiac distant disease.
The majority of patients in our cohort were asymptomatic, and all were diagnosed incidentally by imaging, suggesting that cardiac metastases from MCC are likely underdiagnosed. This may be true of cardiac metastases from cancer in general. In a large autopsy series of over 18,751 patients, metastatic disease involving the heart was identified in 622 3.3%) patients, with most frequent primary cancers including mesothelioma, melanoma, lung carcinoma, and breast carcinoma [43]. The pericardium was the most frequent site of cardiac metastasis (69.4%), followed by the epicardium (34.2%), myocardium (31.8%), and endocardium (5%) [43]. Metastasis to the heart has been reported through three mechanisms; (1) direct invasion, (2) lymphatic spread or (3) hematogenic spread [43]. Pericardial involvement is thought to be the result of either direct invasion by an intrathoracic or mediastinal tumor or retrograde lymphatic invasion through tracheal or broncho mediastinal lymphatic channels, while endocardial metastases stem from hematogenic spread [43]. Contrary to what was observed in the autopsy series, all patients in our cohort had endocardium lesions. Both within our series and previously reported cases, the predominance of endocardial lesions involved in the right side of the heart supports the hypothesis that cardiac mMCC disseminates via hematogenous spread [14][15][16][17][18][19][20][21][22][23][24][25][26][27]. The predilection of the right atrium/ventricle may be a characteristic feature of cardiac metastasis in MCC. It is also of interest that extremity was the most common primary site among both our cohort and the previously reported cases [14][15][16][17][18][19][20][21][22][23][24][25][26][27].
In the absence of a standard approach, we advocate for multidisciplinary care with the goal to palliate symptoms if present and prevent or delay symptom recurrence. Beyond utilization of immunotherapy, which had evidence of efficacy within our cohort (6 out of 7 with CR or PR), local therapy with cardiac radiotherapy can also be incorporated, given the radio responsiveness of MCC and its potential synergism with immunotherapy [1,[44][45][46]. While single fraction 8Gy cardiac RT was insufficient due to lack of local disease control in the cardiac lesion, moderate radiation doses of 20-25 Gy (given over 5-8 fractions) were associated with clinically meaningful, durable disease control (CR or PR). Almost all patients who received 20-25Gy did not have local disease progression, including those who developed cardiac MCC while on immunotherapy.
While our study is limited by small numbers, adding radiotherapy to immunotherapy was not associated with increased cardiotoxicity. No patients in this cohort or in the reported literature experienced cardiac complications due to radiation or immunotherapy. There may be the potential for "treatment inertia" with immune checkpoint inhibitors, due to potential risk for immunotherapy-associated myocarditis, but none of the patients in our series experienced myocarditis. Additionally, there may be hesitancy to pursue cardiacdirected radiation due to risk for acute cardiotoxicity including inflammatory related changes such as myocarditis or pericarditis. In our series, no patients experienced any acute adverse events (AEs), arguing that with careful radiation therapy planning, focused cardiacdirected radiation therapy may be well-tolerated. Instead, cardiac complications (including pericardial effusion and atrial fibrillation) were encountered at the time of cardiac mMCC diagnosis or disease progression.
Radiologic imaging plays a critical role in diagnosis and follow-up of cardiac mMCC [47,48]. All patients in our series were incidentally noted to have a cardiac mass by routine surveillance or staging imaging studies, such as FDG PET/CT, CT, and/or magnetic resonance imaging (MRI). Once cardiac involvement is suspected, further imaging workup can be pursued with transthoracic echocardiography (TTE), a readily available, noninvasive imaging technique [47,49]. On contrast-enhanced CT, intracardiac lesions can often be seen as a filling defect within the cardiac chambers [47]. Cardiac MRI can be utilized to pursue noninvasive tissue characterization, since cardiac tumors show low intensity on T1-weighted images and intermediate to high intensity on T2-weighted images [49,50]. Additionally, cardiac tumors have heterogeneous gadolinium enhancement on cardiac MRI, which is an important feature in differentiating the mass from thrombus [50]. Furthermore, resting first-pass perfusion can assess for vascularity as a clue to presence of tumor [47,49]. These findings were observed in all our patients who underwent a cardiac MRI study. Though an endomyocardial biopsy is needed for definitive confirmation, this invasive procedure can be associated with complications and is also subject to sampling error and false negatives [51]. Therefore, a cardiac biopsy is often deferred, and the diagnosis of cardiac mMCC is most often made by imaging, especially when the patient already has confirmation of distant MCC elsewhere. An important radiological differential diagnosis for cardiac mass is benign thrombus, which may be difficult to differentiate on echocardiogram or CT. Cardiac MRI or FDG PET/CT scan is useful for differentiation of thrombus from tumor [47], given that, in contrast to a thrombus, cardiac MCC is associated with intralesional enhancement or high FDG uptake, respectively. An alternative imaging technique is a somatostatin-seeking nuclear medicine study, as the majority of MCC (85%) exhibits somatostatin receptors on the tumor cell surface, which may be useful to differentiate from other malignant etiologies [48,52].
Several limitations should be noted within this study, including first, the modest patient numbers of this rare entity. Despite this, to our knowledge, this represents the largest series of MCC cardiac metastases to date. Second, due to the retrospective nature of this study, management and workup of patients was heterogeneous. However, there are no established standard of care treatments for these patients, and the varied management allowed us to identify potentially efficacious treatment paradigms.
Conclusions
Cardiac mMCC generally occurs later in the disease course, and most commonly involves the right side of the heart, in particular the right atrium. Involvement of the heart was not associated with worse survival compared to other distant metastasis sites. We found that immunotherapy and moderate dose of cardiac radiotherapy (20)(21)(22)(23)(24)(25) were associated with high rates of response and were well tolerated.
Supplementary Materials:
The following supporting information can be downloaded at: https: //www.mdpi.com/article/10.3390/cancers14235914/s1, Text S1: Selection of the matched reference cohort of non-cardiac mMCC patients.
Acknowledgments:
The authors thank all the patients and their families who participated in this study. We also thank Emily Gong for assistance with French translation during our systematic review.
Conflicts of Interest
: Paul Nghiem has served as a consultant for: EMD Serono, Merck, and Pfizer/Regeneron; his institution has received research funding from Bristol-Myers Squibb and EMD Serono. Shailender Bhatia has served as a consultant for: Bristol Myers Squibb, Castle Biosciences, Exicure, and Regeneron/Sanofi; his institution has received research funding from 4SC, Agenus, Bristol Myers Squibb, Regeneron (formerly Checkmate Pharmaceuticals), EMD Serono, Exicure, Immune Design, Kuni Foundation, Merck, NantKwest, Nektar Therapeutics, Novartis, Trisalus Life Sciences, Xencor, Incyte. Evan Hall has institutional research funding from Bristol-Myers Squibb, Regeneron (formerly Checkmate Pharmaceuticals), NiKang Therapeutics, Neoleukin Therapeutics and Replimune. Daniel S. Hippe reports research grants from GE Healthcare, Philips Healthcare, and Canon Medical Systems USA outside the submitted work. Tomoko Akaike, Kelsey Cahill, Gensuke Akaike, Emily T. Huynh, Michi M. Shinohara, Jay Liao, Smith Apisarnthanarax, Upendra Parvathaneni, Richard K. Cheng, Yolanda D. Tseng declare no conflict of interest with this work. The funders had no role in the design of the study; in the collection, analyses, or interpretation of data; in the writing of the manuscript; or in the decision to publish the results.
|
v2
|
2022-12-07T19:18:54.577Z
|
2022-11-30T00:00:00.000Z
|
254312390
|
s2ag/train
|
Management of patients with the atrophic variant of vulvar lichen sclerosus
Aim.The objective is to optimize the diagnosis and management of the atrophic variant of the vulvar lichen sclerosus (LS).
Materials and methods. We examined 58 female patients from 20 to 70 years old with the atrophic variant of the vulvar LS. The control group included 30 deemed healthy females 2070 years old. The atrophic variant of LS was diagnosed based on symptoms (dryness and discomfort in the vulva, superficial vulvodynia and dyspareunia, mild itching) and signs (marked atrophy of the external genitalia tissue up to aplasia of the labia minora and clitoris, vaginal stenosis, minimal hypopigmentation, absence of sclerosis). In addition, the following cytokines were measured in the peripheral blood of patients: interleukin (IL)-20, 23, 10, tumor necrosis factor-, and interferon-. The measurements were performed before and after immunotherapy with sodium deoxyribonucleate.
Results. In all patients, there was a rapid shrinkage of the labia minora and clitoris, thinning and easy traumatization of the dermis and epidermis, contributing to secondary infection and synechiae formation up to complete vaginal occlusion. An increase in IL-23 (19.01 [18.0; 38.5] vs. 16.6 [12.98; 20.71] in the control group), 2.7-fold (p0.03) decrease in tumor necrosis factor-, interferon- and IL-20 are common for the atrophic variant of LS. The immunomodulatory and clinical efficacy of sodium deoxyribonucleate was demonstrated. Severe vulvodynia before treatment was noted in 29 (50%) patients and no patient (0%) after therapy; 44 (75.8%) patients reported complete reversal of superficial vulvodynia after treatment, and there were no patients without vulvodynia before treatment (0%). Mild itching before treatment was noted by 20 (40%) patients and 2 (3.4%) patients after treatment. Considering the cytokine levels, topical glucocorticoids in atrophic LS are inappropriate and can lead to atrophy and immunosuppression aggravation, contributing to the secondary infection.
Conclusion. The observed differences in cytokine levels in patients with atrophic vulvar LS confirm the relevance of LS clinical classification by variants, support their use for LS diagnosis and immunotherapy efficacy control, and also suggest a differentiated approach to the treatment of different LS variants considering the effect of the drugs used on cytokine status.
|
v2
|
2022-12-07T19:36:39.625Z
|
2022-11-30T00:00:00.000Z
|
254358503
|
s2orc/train
|
Gender Dimorphism in Hepatic Carcinogenesis-Related Gene Expression Associated with Obesity as a Low-Grade Chronic Inflammatory Disease
Non-alcoholic fatty liver disease (NAFLD) and hepatocellular carcinoma (HCC) show clear evidence of sexual dimorphism, with a significantly higher incidence in males. Among the determining factors that could explain this sex-based difference, the specific distribution of fat by sex has been suggested as a primary candidate, since obesity is a relevant risk factor. In this context, obesity, considered a low-grade chronic inflammatory pathology and responsible for the promotion of liver disease, could lead to sexual dimorphism in the expression profile of genes related to tumor development. When we compared the expression levels of genes associated with the early stages of carcinogenesis in the liver between male and female diet-induced obesity (DIO) rats, we observed that the expression pattern was similar in obese male and female animals. Interestingly, the SURVIVIN/BIRC5 oncogene showed a higher expression in male DIO rats than in female DIO and lean rats. This trend related to sexual dimorphism was observed in leukocytes from patients with obesity, although the difference was not statistically significant. In conclusion, this study evidenced a similar pattern in the expression of most carcinogenesis-related genes in the liver, except SUVIVIN/BIRC5, which could be a predictive biomarker of liver carcinogenesis predisposition in male patients with obesity.
Introduction
In mammals, sexual dimorphism appears in numerous biological processes as well as in parameters such as the incidence, prevalence and mortality of diseases [1,2]. The liver exhibits a high degree of sexual dimorphism under normal health conditions, with hundreds of genes that are differentially expressed between the two sexes [3,4], contributing to the physiology, homeostasis and metabolism of compounds [5][6][7]. These sex differences also interfere with liver function and the susceptibility, development and consequences of liver diseases, such as non-alcoholic fatty liver disease (NAFLD) or its most severe manifestation and the most common primary liver tumor, hepatocellular carcinoma (HCC) [8][9][10][11]. In fact, it has been described that in both NAFLD and HCC, there is clear evidence of sexual dimorphism in both rodents and humans, with a significantly higher incidence in males [8]. In almost all populations, regardless of etiologies, men have higher rates of liver cancer than women, with an estimated male:female ratio of 2 to 3:1 for HCC [12]; however, the reasons for this gender disparity are complex and not well understood. It is believed that it could probably be related to a set of behavioral and metabolic risk factors, environmental exposure, the biology of the tumor and the treatments received [13,14], as well as being due to the differences in sexual hormones in terms of the stimulating effect of androgens compared to the protective effect of estrogens in the development and progression of HCC [13,15,16].
In this regard, in recent years, several reports have suggested that sex-specific fat distribution could be one of the determining factors that could explain, at least in part, the different incidence of HCC between both sexes [17], as adiposity-related liver diseases increasingly emerge as the most common cause of chronic liver disease. In addition, it is known that the main cause of HCC is NAFLD associated with obesity [18][19][20][21], which is the most common form of chronic liver disease globally, affecting approximately 25-30% of the general population [22], 58% of individuals who are overweight and up to 90% of patients with obesity [20,23,24]. Thus, the prevalence of HCC is estimated to increase concomitantly with the current obesity epidemic, and is expected to account for approximately 90% of the >1 million cases of liver cancer estimated by 2025 [12,25,26].
Previous studies by our research group showed that the factors secreted by dysfunctional obese adipose tissue are responsible for triggering inflammation and oxidative stress, acting as potential promoters in the development of a favorable microenvironment for the initiation of carcinogenesis [27][28][29][30][31]. Specifically, when we analyzed the effect of excessive adiposity on the promotion of hepatocarcinogenesis in the liver of genetically obese rats, we observed that the regulation of genes related to tumor development depended directly on the state of adiposity and its effects on systemic inflammation and oxidative stress, even before the manifestation of a detectable tumor mass in the liver of these animals [27]. However, these results were observed in male animals, and the possibility that a gender bias interferes with the predisposition and future development of obesity-associated HCC is an open question that highlights the need for more studies in this field of research. To date, male subjects have been favored in human and animal biomedical research [32].
Considering the differences in the prevalence of liver disease between males and females, we hypothesized that the described effects of the excessive adiposity characteristic of obesity, such as inflammation and oxidative stress, in promoting hepatocarcinogenesis may be sexually dimorphic in the expression profile of the set of genes previously studied in relation to the early stages of tumor development. Therefore, the current study aimed to evaluate the differences due to sex in the expression levels of genes associated with the early steps of carcinogenesis in the liver of male and female rats with diet-induced obesity (DIO) and to explore whether this difference can be detected in blood leukocytes from patients with obesity.
Sex-Biased Carcinogenesis-Related Gene Expression in Livers from Obese Rats
Statistically significant differences in body weight, fat mass, and fat-free mass were observed between the male and female rats ( Table 1). As expected, in both male and female rats, the body composition analysis revealed that the obesity group had a higher body weight and fat mass than the lean group (Table 1). These parameters were significantly higher in male rats than in their female counterparts (Table 1).
Hepatic expression of the studied genes in relation to the onset of carcinogenesis was first evaluated by comparing rats with obesity and lean rats separated by sex ( Figures 1A and 2). In both male and female rats, the obesity group of animals showed an upregulation of the oncogenes SURVIVIN/BIRC5 and MYC, together with a downregulation of genes linked to antioxidant protection, GSTM2, SIRT1 and SIRT6, and the tumor suppressors TGFB1, TP53 and PTEN ( Figure 1A,B). Specifically, these differences were statistically significant for all the genes studied, except for the MYC and TP53 genes analyzed in the livers of female rats ( Figure 1B). To further evaluate the effect of sex on gene expression, the interaction between the obese phenotype and sex was evaluated ( Table 2). Under these conditions, independent of sex, statistically significant differences according to the obesity phenotype were found in all studied genes. Considering the sex of the animals, the analysis did not reveal a differential gene expression biased by sex, except in the SURVIVIN/BIRC5 oncogene, which showed higher levels of gene expression in males than in females (p = 0.041) ( Table 2).
Discussion
The present study demonstrated in a DIO animal model that the expression pattern of a set of genes involved in the early phases of carcinogenesis in the liver based on obesity status was similar in male and female animals. In male and female rats with obesity, we found an overexpression of the oncogenes SURVIVIN/BIRC5 and MYC, which are involved in cell proliferation and the inhibition of apoptosis [33,34]; a decrease in the transcriptional levels of the GSTM2, SIRT1 and SIRT6 genes, which are involved in protection against cellular oxidative stress and in the repair of DNA damage [35,36]; and a decrease in the tumor suppressors TGFB1, TP53 and PTEN, which are involved in the regulation of cell growth [37][38][39]. Further analysis revealed that the SURVIVIN/BIRC5 oncogene, which is overexpressed in most tumors [40,41], showed statistically higher transcriptional levels in male DIO rats than in female DIO rats and lean animals. These data suggest that gene expression of the SURVIVIN/BIRC5 oncogene could be considered as a potential biomarker of increased susceptibility to liver disease and subsequent development of HCC in obese men.
Several epidemiological studies have shown that the excessive accumulation of body fat, characteristic of obesity and leading to low-grade systemic inflammation, is a relevant risk factor that contributes to the appearance of NAFLD and the subsequent development of HCC [42,43], and it has been suggested that the increase in its prevalence is concomitant with the growing epidemic of obesity [44][45][46]. Furthermore, extensive literature suggests that chronic liver disease is influenced by sexual dimorphism. Recent studies have revealed significant differences between men and women in the prevalence, risk factors, pathophysiology, complications and treatments of NAFLD [17,47,48]. HCC is the fifth most common malignancy in men and the eighth in women [47,48]. Compared to women, men have a higher incidence of NAFLD, exhibit greater accumulation of visceral fat, experience more severe liver fibrosis and have a higher incidence of liver cancer. Furthermore, once NAFLD occurs, women show more rapid progression of liver fibrosis and higher levels of liver cell damage and inflammation [17,49]. However, despite the To further evaluate the effect of sex on gene expression, the interaction between the obese phenotype and sex was evaluated ( Table 2). Under these conditions, independent of sex, statistically significant differences according to the obesity phenotype were found in all studied genes. Considering the sex of the animals, the analysis did not reveal a differential gene expression biased by sex, except in the SURVIVIN/BIRC5 oncogene, which showed higher levels of gene expression in males than in females (p = 0.041) ( Table 2).
Sexual Dimorphism in SURVIVIN/BIRC5 Oncogene Expression According to the Degree of Adiposity in Animals and Humans
Taking into account that male rats showed higher fat mass than female (Table 1), an ANCOVA was performed, adjusting for fat mass of the animals at the end of the study. In this analysis, the interaction between the obesity phenotype and sex for the expression of SURVIVIN/BIRC5 was statistically significant (p = 0.026).
The SURVIVIN/BIRC5 oncogene expression data were then segmented by the obesity and lean groups of rats, and an analysis was performed in relation to sex and adjusted for final fat mass. Interestingly, the expression of SURVIVIN/BIRC5 was higher in male DIO rats than in female or lean animals, and these differences were statistically significant (p = 0.032).
Additionally, sexual dimorphism in SURVIVIN/BIRC5 expression was evaluated in the blood leukocytes of patients with obesity and normal weight healthy individuals to assess the translation from animal results to humans. Transcriptional data for the SURVIVIN/BIRC5 oncogene were obtained from a previous cohort in our research group ( Table 3). Under these conditions, a previous analysis of SURVIVIN/BIRC5 expression in PBMCs revealed significantly higher levels in patients with obesity (p < 0.001) [30], mirroring the results observed in the livers of rats (Figure 1). In the current study, we analyzed the effect of sex by an ANOVA performed in relation to the degree of adiposity and sex of the subjects. No statistically significant differences were observed in the levels of SURVIVIN/BIRC5 between male and female patients (p = 0.951), but higher transcript levels of this gene were observed in subjects with obesity than in normal weight subjects of both sexes (Figure 2).
Discussion
The present study demonstrated in a DIO animal model that the expression pattern of a set of genes involved in the early phases of carcinogenesis in the liver based on obesity status was similar in male and female animals. In male and female rats with obesity, we found an overexpression of the oncogenes SURVIVIN/BIRC5 and MYC, which are involved in cell proliferation and the inhibition of apoptosis [33,34]; a decrease in the transcriptional levels of the GSTM2, SIRT1 and SIRT6 genes, which are involved in protection against cellular oxidative stress and in the repair of DNA damage [35,36]; and a decrease in the tumor suppressors TGFB1, TP53 and PTEN, which are involved in the regulation of cell growth [37][38][39]. Further analysis revealed that the SURVIVIN/BIRC5 oncogene, which is overexpressed in most tumors [40,41], showed statistically higher transcriptional levels in male DIO rats than in female DIO rats and lean animals. These data suggest that gene expression of the SURVIVIN/BIRC5 oncogene could be considered as a potential biomarker of increased susceptibility to liver disease and subsequent development of HCC in obese men.
Several epidemiological studies have shown that the excessive accumulation of body fat, characteristic of obesity and leading to low-grade systemic inflammation, is a relevant risk factor that contributes to the appearance of NAFLD and the subsequent development of HCC [42,43], and it has been suggested that the increase in its prevalence is concomitant with the growing epidemic of obesity [44][45][46]. Furthermore, extensive literature suggests that chronic liver disease is influenced by sexual dimorphism. Recent studies have revealed significant differences between men and women in the prevalence, risk factors, pathophysiology, complications and treatments of NAFLD [17,47,48]. HCC is the fifth most common malignancy in men and the eighth in women [47,48]. Compared to women, men have a higher incidence of NAFLD, exhibit greater accumulation of visceral fat, experience more severe liver fibrosis and have a higher incidence of liver cancer. Furthermore, once NAFLD occurs, women show more rapid progression of liver fibrosis and higher levels of liver cell damage and inflammation [17,49]. However, despite the evidence in the literature, the underlying molecular mechanisms of sexual dimorphism in NALFD are not clear. Therefore, evaluating whether these sex differences should be considered in the prevention and personalized treatment of NAFLD and HCC is a necessary approach in the near future. In this context, new advances in understanding sexual dimorphism in the liver provide exciting clues about sex differences in NAFLD pathogenesis, which could inspire new therapeutic strategies. Furthermore, as obesity contributes greatly to the overall burden of NAFLD and HCC [20,21,44], there is an urgent need to delineate the molecular mechanisms of sex-biased obesity-associated hepatocarcinogenesis risk. Consequently, the present study evaluated gender dimorphism in the expression of a set of genes related to the first steps of carcinogenesis in the liver of rodents according to the degree of adiposity. This work revealed that the differences detected in the expression levels of most of the genes studied related to obesity were independent of sex, suggesting that differential gene expression is modulated by the excess adiposity characteristic of obese individuals, as previously proposed [27,28].
Interestingly, among the genes studied, we detected a relevant gender dimorphism in the obesity-related expression of the SURVIVIN/BIRC5 oncogene. Specifically, significantly higher transcriptional levels of SURVIVIN/BIRC5 were detected in male rats with obesity than in female rats with obesity and lean rats, after adjusting for fat mass. These results reflected an upregulation of SURVIVIN/BIRC5 associated with excess adiposity, which was especially manifested in males. When we transferred these results to blood leukocytes in humans, involving a minimally invasive procedure considered useful and effective for reflecting tissue-specific gene expression, we observed that the expression of the SURVIVIN/BIRC5 oncogene showed statistically significant differences due to the state of obesity, without being subject to a sex effect. These data were consistent with a previously detected increase in SURVIVIN/BIRC5 in the visceral adipose tissue of male animals with obesity and blood leukocytes in humans [30]. In fact, in recent years, this oncogene has generated great interest as a biomarker of prognostic importance and therapeutic relevance in many malignant neoplasms such as HCC [33,[50][51][52]. Thus, SURVIVIN/BIRC5 overexpression has been associated with the onset and progression of several types of cancer [40,50,[53][54][55], and, regarding HCC, the expression of SURVIVIN/BIRC5 has been reported in 41% of cases and its high expression has been associated with a poor prognosis in patients [40,[56][57][58]. In addition, to the best of our knowledge, this is the first study to evidence sex differences in the expression of the SURVIVIN/BIRC5 oncogene associated with the state of obesity, which was detected even before the manifestation of a tumor mass in the liver. Our data show that SURVIVIN/BIRC5 expression was particularly higher in males with obesity; therefore, the SURVIVIN/BIRC5 oncogene could be postulated as a potential biomarker of susceptibility to HCC in male patients with obesity.
One limitation of this study could be the difference in age and body composition between the male and female rats. Consequently, the statistical analyses were adjusted for body fat mass. Moreover, the lack of differences between sexes in the expression of SURVIVIN/BIRC5 in blood leukocytes could be due to the relatively small sample size in the human cohort. Another limitation could be the lack of data about other cancer risk factors, such as tobacco [59,60] or saturated fats [59,61] consumption among study patients, which could be factors that influenced the results. However, the trend in gene expression was similar to that observed in the animal model, suggesting that smoking was not a relevant confounding factor in this analysis. Regarding saturated fat consumption, a previous study from our research group demonstrated that excess adiposity is the main factor involved in the susceptibility to carcinogenesis rather than a high-fat diet [28].
Animals with Diet-Induced Obesity (DIO)
Twenty male and twenty female Sprague-Dawley rats (6-8 weeks of age) were obtained from the central animal facility at the University of Santiago de Compostela. After an acclimatization period (1 week), the animals were randomly distributed into two groups: (a) the lean or control group (n = 10 males/females) was fed ad libitum with a standard diet (SAFE-Panlab, Barcelona, Spain) consisting of 5.5% lipids, 23% protein and 70% carbohydrates; (b) and the obese or DIO group (n = 10 males/females) was provided ad libitum access to a high-fat diet (HFD) (Open Source Diets, Research Diets; Brogaarden, Denmark, Reference D 12492) composed of 60% fat, 20% protein and 20% carbohydrates.
The rats were housed in air-conditioned rooms (22-24 • C) under a controlled lightdark cycle (12:12 h) with free access to food and water. Body weight and food intake were measured periodically throughout the experimental period (9 weeks). Body composition was assessed weekly in all animals by nuclear magnetic resonance (NMR) using an EchoMRI-700 system (Echo Medical Systems, Houston, TX, USA) ( Table 1). After the 9-week experimental period, the animals were sacrificed by decapitation, their livers were excised, immediately frozen on dry ice and stored at −80 • C until RNA was extracted and analyzed.
Patients with Obesity and Normal Weight Individuals
The study included a group of healthy subjects with normal weight (n = 29; 10 men; 40.2 ± 8.9 years, 23.5 ± 2.3 kg/m 2 ) and a group of patients with obesity (n = 22; 10 men, 42.5 ± 10.8 years, 38.04 ± 6.9 kg/m 2 ) ( Table 3). All participants were in good health according to their medical history, a physical examination and routine hematologic and biochemical laboratory test results. The participants reported no use of vitamin supplements, mineral supplements or regular prescription medications during the previous three months. Blood samples were obtained after overnight fasting and peripheral blood mononuclear cells (PBMCs) were isolated with differential centrifugation using a Polymorphprep (Axis Shield PoC AS, Norway). The cell pellet was resuspended in TRIzol reagent (Invitrogen, Carlsbad, CA, USA) and immediately frozen at −80 • C until RNA extraction and analysis.
Gene Expression Assessment
RNA was isolated using TRIzol (Invitrogen, Carlsbad, CA, USA) from liver samples of rats and from the blood leukocytes derived from subjects according to the manufacturer's recommendations. RNA concentration was measured using a Nanodrop 2000 spectrophotometer (Thermo Scientific, Waltham, MA, USA). From the total extracted RNA, 1 µg was purified with a DNase treatment using a DNA-free kit as a template (Thermo Scientific, USA), and first-strand cDNA was synthesized using a High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Waltham, MA, USA).
Gene expression was assessed using real-time quantitative polymerase chain reaction (RT-qPCR) and was performed using a TaqMan Universal PCR Master Mix, TaqMan Probes (Supplementary Table S1) and the Step OnePlus Real-Time PCR System (Applied Biosystems, USA). All experiments were performed in duplicate. For data analysis, gene expression levels were normalized to the levels of the housekeeping gene (beta-actin or GAPDH) and expressed as the average value for the control group calculated using the 2 −∆∆Ct relative quantitation method according to the manufacturer's guidelines (Applied Biosystems, USA). RT-qPCR experiments were performed in compliance with the Minimum Information for Publication of Quantitative Real-Time PCR Experiments guidelines (http:// www.rdml.org/miqe).
Statistical Analysis
Normal distributions were explored using the Kolmogorov-Smirnov test and Shapiro-Wilk test. Differences in body weight, body composition and gene expression levels among groups comprising subjects with normal weight and obesity were evaluated using a Student's t-test. An analysis of variance (ANOVA) or analysis of covariance (ANCOVA), adjusted for sex or the amount of fat mass at the end of the study, was used to analyze the differences between groups of obese and lean rats.
Data are reported as the mean ± standard error of the mean (SEM) or means ± standard deviation (SD). All values were considered statistically significant when p-value < 0.05, and a p-value ≤ 0.1 was considered a trend for significance. Statistical analysis was performed using GraphPad Prism 7 (GraphPad Software Inc., San Diego, CA, USA) and SPSS 25 software (SPSS Inc., Chicago, IL, USA) for Windows 10 (Microsoft, Redmond, WA, USA).
Conclusions
The findings of the present study demonstrated the effect of obesity per se on the deregulation of the expression of genes involved in the early steps of hepatic carcinogenesis, even before the manifestation of a tumor mass in the liver; these findings were consistent with previous data from our research group on an animal model of genetic obesity using male Zucker rats [27]. Our results showed that the regulation of most of the genes studied in relation to the early process of liver carcinogenesis depended directly on the state of adiposity and did not show significant differences with respect to the sex of the subjects, with the exception of the SURVIVIN/BIRC5 oncogene. To the best of our knowledge, this work has shown for the first time that the upregulation of SURVIVIN/BIRC5 in obese subjects is significantly higher in males, which highlights the potential role of the SURVIVIN/BIRC5 oncogene as a predictive biomarker of susceptibility to HCC in male patients with obesity. Funding: This work was supported by Xunta de Galicia-Gain (IN607B2020/09), CIBERobn from the Instituto de Salud Carlos III (ISCIII) as well as research projects (PI20/00650; PI20/00628); and was co-financed by the European Regional Development Fund (FEDER). Andrea G. Izquierdo was funded by a posdoctoral grant from the Health Research Institute of Santiago de Compostela (IDIS). Ana B. Crujeiras is a Miguel Servet researcher (ISCIII; CP17/0008) from the ISCIII.
Institutional Review Board Statement: All experimental protocols and animal procedures used in this study were approved by the Animal Care Committee of the University of Santiago de Compostela (code 15005/2015/003) in accordance with our institutional guidelines and the European Union standards for the care and use of experimental animals. For human cohort, the study was conducted in accordance with the Declaration of Helsinki, and the protocol was approved by the Ethics Committee of the institution (CEIC Galicia No. 2009/076).
Informed Consent Statement:
All subjects gave their informed consent for inclusion before they participated in the study.
Data Availability Statement:
The datasets generated for this study are available on request to the corresponding author.
|
v2
|
2022-12-07T19:36:39.752Z
|
2022-11-30T00:00:00.000Z
|
254364858
|
s2orc/train
|
Epigenetics in Pancreatic Ductal Adenocarcinoma: Impact on Biology and Utilization in Diagnostics and Treatment
Simple Summary Epigenetic alterations contribute to the distinct biology of pancreatic ductal adenocarcinoma (PDAC) and thus allow a better understanding of molecular mechanisms active in progression, metastasis and therapeutic resistance. Exploiting such knowledge for the development and instalment of clinically impactful biomarkers and epigenetically targeted therapies will open novel and improved avenues for personalized patient care. In this review, we aim to summarize the recent advances in PDAC biology, biomarker development and therapeutic options from an epigenetic perspective. Abstract Pancreatic ductal adenocarcinoma (PDAC) is one of the most aggressive malignancies with high potential of metastases and therapeutic resistance. Although genetic mutations drive PDAC initiation, they alone do not explain its aggressive nature. Epigenetic mechanisms, including aberrant DNA methylation and histone modifications, significantly contribute to inter- and intratumoral heterogeneity, disease progression and metastasis. Thus, increased understanding of the epigenetic landscape in PDAC could offer new potential biomarkers and tailored therapeutic approaches. In this review, we shed light on the role of epigenetic modifications in PDAC biology and on the potential clinical applications of epigenetic biomarkers in liquid biopsy. In addition, we provide an overview of clinical trials assessing epigenetically targeted treatments alone or in combination with other anticancer therapies to improve outcomes of patients with PDAC.
Background
Pancreatic ductal adenocarcinoma (PDAC) is one of the most aggressive solid tumors with a 5-year survival rate of 11% in the United States, making it one of the leading causes of cancer-related mortality [1]. This dismal prognosis is due to several disease-and patientrelated factors, such as the diagnosis at advanced stages, tumor localization, age, patient performance status and comorbidities [2,3]. More than 80-90% of patients are diagnosed with irresectable or metastasized disease or develop relapse or metastases after resection, thus require palliative treatment [4]. Depending on the performance status, combination therapies of 5-fluoruracil, irinotecan and oxaliplatin (FOLFIRINOX) or of gemcitabine and nab-paclitaxel or a monotherapy with gemcitabine are the current first-line standard chemotherapy protocols for PDAC patients in the palliative setting [5,6]. However, despite advances, these treatments show modest improvement in overall survival (OS), and can pose a high risk of toxicity.
Early studies have demonstrated the association of initial PDAC histological changes with driver mutations involving, amongst others, the activation of oncogenic KRAS [7] or inactivation of tumor suppressor TP53 [8], SMAD4 [9] or CDKN2A [10], while PDAC progression may rather be related to epigenetic changes [11,12]. In fact, genetic, environmental, and tumor-intrinsic factors, such as the tumor microenvironment (TME), likely collaborate to establish distinct epigenetic landscapes, which shape PDAC heterogeneity [11]. Moreover, uniformity in driver gene mutations between primary tumor and metastatic sites in PDAC patients [13,14] highlight the fact that epigenetic reprogramming is probably a major determinant of clonal fitness and tumor evolution required for PDAC expansion and metastatic spread.
The term "epigenetics" was first proposed in the 1940s to describe the mechanism by which a specific genotype could generate different phenotypic effects [15]. In other words, epigenetics bring about divergent gene expression profiles, without altering DNA sequence, but by modulating accessibility of transcription machinery to target genes, a process which is essential to develop cellular identity [16]. Alterations in this mechanism can contribute to tumor evolution by increased cancer cell proliferation and metastasis via silencing tumor suppressor genes or activating oncogenes [17]. Aberrant DNA methylation and post-translational histone modifications are among the main epigenetic alterations, also contributing to PDAC heterogeneity and progression [17]. PDAC harboring mutations in chromatin modifiers (e.g., ARID1A, KMT2C, KMT2D) are more likely to develop a more aggressive squamoid/squamous morphology and metastasis [18]. Moreover, genome-wide analysis of PDAC samples linked the evolution of malignant traits contributing to distant metastasis to widespread epigenetic changes involving global reprogramming of histone H3K9 and DNA methylation within large heterochromatin domains [19]. In that light, ongoing efforts are aiming to develop diagnostic and therapeutic modalities for PDAC based on the dysregulated epigenetic state of the tumor. This should ideally be deployed through a two-way evidence exchange process between preclinical models of varying complexities and data from clinical trials ( Figure 1). Figure 1. Development of new biomarkers and therapeutic approaches for cancer treatment: A bidirectional process. Bench to bedside; Experimental models used in cancer research can vary from 2D-cell culture to murine in vivo models to more complex 3D patient-derived cancer organoids. These models can identify cancer-related genetic and epigenetic signatures using a plethora of sequencing and targeted qPCR techniques, which can then be utilized to predict novel cancer biomarkers and therapeutic targets to be eventually translated into clinical practice. Bedside to bench; the poor performance of some biomarkers or the emergence of drug resistance to anticancer agents may contribute to their failure to reach the clinic. This urges preclinical studies to test new biomarker panels or to find new strategies to overcome drug resistance with the aim to improve therapeutic outcomes of cancer patients. Figure 1. Development of new biomarkers and therapeutic approaches for cancer treatment: A bi-directional process. Bench to bedside; Experimental models used in cancer research can vary from 2D-cell culture to murine in vivo models to more complex 3D patient-derived cancer organoids. These models can identify cancer-related genetic and epigenetic signatures using a plethora of sequencing and targeted qPCR techniques, which can then be utilized to predict novel cancer biomarkers and therapeutic targets to be eventually translated into clinical practice. Bedside to bench; the poor performance of some biomarkers or the emergence of drug resistance to anticancer agents may contribute to their failure to reach the clinic. This urges preclinical studies to test new biomarker panels or to find new strategies to overcome drug resistance with the aim to improve therapeutic outcomes of cancer patients.
DNA Methylation
DNA methylation describes the addition of a methyl group to the DNA. Changes in global DNA methylation and of local patterns are among the earliest and most frequent events in cancer development [20]. 5-Methylcytosine (5mC) is the most abundant and best-studied nucleotide modification in eukaryotes. It is generated through the addition of a methyl group to the 5 carbon of the cytosine pyrimidine ring and predominantly occurs at CpG dinucleotides. Of particular relevance is the cytosine methylation status in the approximately 30,000 CpG islands of the human genome, which are clusters of CpGs located in the gene promoter regions or gene bodies (frequently serving as alternative promoters), the hypermethylation of which typically leads to transcriptional gene silencing [21,22]. Repression of gene expression is facilitated via inhibition of transcription factor binding to the DNA and via chromatin remodeling through the binding of methyl-CpGbinding domain proteins (MBDs) and subsequent recruitment of additional proteins [23,24]. DNA methylation is facilitated by DNA methyltransferases (DNMT) [25]. DNMT3A and DNMT3B establish de novo methylation and DNMT1 maintains methylation in daughter DNA strands. 5mC can be actively demethylated via oxidation to 5-hydroxymethylcytosine (5hmC) by Ten-eleven translocation (TET) dioxygenases which requires α-ketoglutarate (α-KG), which in turn is provided by isocitrate dehydrogenases (IDH) [26].
DNA methylation likely plays a key role in PDAC progression. DNA methylation patterns (globally and at specific loci) differ between PDAC and normal tissue and among PDAC subtypes [27][28][29]. For example, high promoter methylation of the putative tumor suppressor ISL2 in PDAC correlates with poor patient survival and its depletion in human PDAC cells leads to increased oxidative phosphorylation as source for cell energy [30]. Using bisulfite sequencing and methylation-specific PCR (MSP) in PDAC primary tumors and cell lines, DNA hypomethylation and subsequent overexpression of genes altered during tumorigenesis (such as PSCA and S100A4) have been shown to contribute to tumor progression [31]. DNA methylation profiling can distinguish between distinct PDAC subtypes [32]. The more aggressive squamous-/basal-like tumors features hypomethylation of repetitive elements and execution of an intrinsic IFN signaling program that is associated with worse overall survival, compared to the progenitor-like/classical subtype. Moreover, 5hmC has been linked with transcriptional programs defining PDAC subtypes [33]. Loss of 5hmC due to reduced TET2 expression can result in squamous-like PDAC, and enhancing TET2 stability restores 5hmC and GATA6 levels and reverts the phenotype to the classical subtype that features more favorable treatment responses.
Altered DNA methylation may also be a key player in regulating tumor-associated macrophages (TAMs), a main component of the desmoplastic TME in PDAC [34][35][36]. Studies in macrophage cell lines have linked DNMT1-mediated suppression of SOCS1 expression or of KLF4 expression with macrophage M1 activation [34,35]. In PDAC-specific models, PDAC cells were able to reprogram M1-like macrophages by inducing DNA methylation which leads to a suppressed glucose metabolic status and a switch of M1like to M2-like macrophages [36]. In accordance, M1-like macrophages (but not M2-like macrophages) required DNA methylation to promote metastasis in a PDAC mouse model. Moreover, direct contact of PDAC cells with cancer-associated fibroblasts (CAF), another essential component of the TME, induced SOCS1 methylation with downstream activation of STAT3 and insulin-like growth factor (IGF)-1 expression [37]. These results are in line with PDAC cells being in constant interaction with the TME to support their growth, progression and metastasis formation.
Changes in DNA methylation patterns strongly correlate with aging [38,39], with "epigenetic clocks", i.e., the methylation status of a set of CpG sites, being able to reliably predict an individual's age. The methylation status is under the influence of extrinsic factors (e.g., nutrition, microbiome) and of a process called "epigenetic drift" [38]. In this process, errors occur in the transfer of epigenetic marks to the daughter DNA strands due to the relatively low fidelity of DNMTs. PDAC is usually referred to as a disease of the elderly [40], with less than 10% of the patients being younger than 55 years [41]. This raises the question whether DNA methylation patterns may be associated with PDAC development in younger patients. However, a study by Raffenne and colleagues using publicly available DNA methylation data found no difference in the DNA methylation profiles between early-and late-onset PDAC [42]. In another study, DNA methylation (as a sign of aging) in leukocytes were found to be associated with an increased risk for PDAC [43]. Given for example the potential for identifying younger individuals at higher risk for cancer development (including PDAC) through age-associated DNA methylation and other epigenetic marks, extended research in this context appears warranted.
Histone Modifications
In eukaryotic cells, nucleosomes are the basic structural unit of DNA packaging, where DNA is wrapped around histone octamers allowing its condensation to chromatin [44]. N-terminal histone tails protruding from nucleosomes are prone to posttranslational modifications. Acetylation and deacetylation of lysine residues in these histone tails, mediated by histone acetyltransferases (HATs) and histone deacetylases (HDACs), are important mechanisms to regulate chromatin accessibility and gene transcription [16]. Enhanced acetylation is associated with a more relaxed chromatin accessible to the transcription machinery, while the reverse reaction facilitates gene silencing. While the function of HATs (e.g., p300) in PDAC could be either tumor suppressing or promoting depending on the targeted genes [45,46], the role of HDACs seems to be more consistent. HDACs are able to mediate tumorigenesis, and their activity is associated with poor outcomes in PDAC patients [47,48], for example owing to the suppression of genes encoding proapoptotic proteins such as BH3-only protein NOXA and Nur77 with subsequent enhancement of cellular proliferation [48].
Acetylated lysine residues are recognized by proteins of the bromodomain and extraterminal (BET) family (including BRD2, BRD3, BRD4, BRDT) [49]. Binding to hyperacetylated chromatin regions leads to formation of a super enhancer protein complex and interaction with the positive transcription elongation factor (P-TEFb) which promotes gene transcription and elongation [50,51]. BET protein dysregulation can for example be involved in tumor development and progression by promoting the expression of classical oncogenes such as MYC [52].
Lysine residues in the histone tails can also serve as methylation targets for histone methyltransferases (HMTs), while these marks can be removed by histone demethylases (HDMs) [16]. The effect of histone methylation on gene expression is context-dependent and relates to the lysine position [53]. For instance, trimethylation of lysine 4 in histone 3 (H3K4me3) is generally associated with gene activation, while the contrary occurs with trimethylation of lysine 27 (H3K27me3). Aberrant histone methylation of cancer-related genes has been involved in abnormal proliferation, cell cycle dysregulation, immune escape and metabolic reprogramming of tumor cells [54]. ChIP-seq data demonstrated that gain of H3K27me3 and loss of H3K4me3 at acinar cell fate genes enhanced acinar-toductal metaplasia which is essential for PDAC development and progression [55]. Loss of KDM6A, an HDM of H3K27me3, in a PDAC mouse model induced aggressive squamouslike, metastatic disease related to the activation of H3K27ac-marked enhancers regulating ∆Np63, MYC and RUNX3 [56]. The HMT enhancer-of-zeste homolog 2 (EZH2), the catalytic component of the polycomb repressive complex 2 (PRC2), mediates generation of H3K27me3 [57]. EZH2 was found to be overexpressed in the nucleus in PDAC cell lines and in 68% of PDAC cases, and depletion of EZH2 decreases PDAC cell proliferation [58] and induces a less aggressive and more chemotherapy-susceptible, classical PDAC subtype (likely via increased GATA6 expression) [59].
Epigenetic Characteristics of Metastatic PDAC
PDAC is characterized by high frequency of metastases [60] with common sites of dissemination including liver, peritoneum and lungs [61]. Epithelial to mesenchymal transition (EMT) is considered a major regulator of tumor spread, where cancer cells lose their epithelial markers such as E-cadherin, while gaining mesenchymal and fibroblast-like properties [62]. Clinical and preclinical studies showed an inverse correlation between EZH2 expression and E-cadherin in PDAC [63], where high EZH2 expression was associated with advanced disease stage and lymph node metastasis [64]. Moreover, expression of CDH1, encoding E-cadherin, is downregulated in pancreatic cancer cells by binding of repressor complexes comprised of HDACs and certain transcription factors such as ZEB1 or Snail [65,66].
FOXA1 and FOXA2 are transcription factors which induce the expression of E-cadherin [67]. Consequently, their downregulation was associated with EMT induction and cancer progression in in vivo and in vitro PDAC models. It was also implicated, by results of ChIP-seq, RNA-seq and ATAC-seq, that FOXA1 enhanced H3K27ac in certain genomic regions in PDAC cells, which activated foregut developmental genes, thus promoting cellular growth in vitro and metastasis in vivo [68]. Further studies are required to explain these observations.
Aberrant DNA methylation has also been implicated in PDAC metastasis [69][70][71]. TFPI-2, a proteinase inhibitor which prevents extracellular matrix degradation and thereby tumor invasion and metastasis, is downregulated in PDAC tumors and cell lines owing to its hypermethylated promoter as revealed by MSP and bisulfite sequencing [69]. Restoration of its expression reduced the malignant behavior of PDAC in vitro. Similar effects were observed for the promoter methylation of the RELN gene, which encodes an extracellular matrix serine protease regulating neuronal migration and the low expression of which associated with worse survival in pancreatic cancer [70]. In addition, DNA hypomethylation of MET (encoding c-Met) and ITGA2 (encoding Integrin α-2) correlated with high gene expression and with poor patient outcomes [71].
Hence, epigenetic modifications (e.g., chromatin remodeling or altered DNA methylation) can initiate transcriptional changes in PDAC and thus promote the gain of aggressive and metastatic disease characteristics.
DNA Methylation in Liquid Biopsies as Marker for the Diagnosis of PDAC
As discussed earlier, most PDAC cases are diagnosed at advanced stages which is related to the absence of specific signs and symptoms during the early phases of PDAC and the tendency to early spread [72]. Due to this delay in detection, less than 20% of patients qualify for primary surgical resection [73]. The standard tumor biomarker at PDAC diagnosis is carbohydrate antigen 19-9 (CA 19-9) [74]. However, owing to its low sensitivity and specificity, its application for early PDAC screening is not recommended. Biomarkers which provide a better performance for early diagnosis of PDAC are required.
Liquid biopsy refers to the detection of cancer cells or cell material in blood and other body fluids [75]. Liquid biopsy approaches are currently usually based on the analysis of plasma cell free DNA (cfDNA). Most of the (particularly initial) liquid biopsy studies in PDAC focused on the detection of gene variants, especially KRAS mutations [76][77][78][79][80]. However, DNA methylation marks in cfDNA of PDAC patients have also been studied, and they may add clinically relevant information, in particular in combination with genetic analyses.
Melnikov et al. were among the first to study methylation changes of cfDNA in PDAC [81]. They were able to determine a classifier based on the promoter methylation of five genes that differentiated patients with PDAC from healthy controls, but sensitivity (76%) and specificity (59%) were still modest. The ability of cfDNA methylation to identify patients with PDAC has since then been investigated in numerous studies [82][83][84][85][86][87][88][89][90]. In another early study comprising 104 patients with PDAC and assessing NPTX2 hypermethylation in cfDNA, sensitivity and specificity were 80% and 76% to identify patients with PDAC [83]. The hypermethylation of NPTX2, together with that of SPARC, in cfDNA also correlated with PDAC diagnosis (vs. chronic pancreatitis) and with poor survival in another study [84]. The promoter methylation of BNC1 and ADAMTS1 were also identified as promising cfDNA markers for the detection of PDAC [86]. This was recently corroborated by the observation that the combined assessment of these markers achieved a sensitivity of 97.4% and specificity of 91.6% to distinguish patients with PDAC from controls [85]. Henriksen and colleagues analyzed a 28-gene panel and defined a prediction model comprising higher age and methylation status of 8 genes (BMP3, RASSF1A, BNC1, MESTv2, TFPI2, APC, SFRP1, SFRP2) to differentiate between PDAC patients and those with pancreatitis or no pancreatic disease with a sensitivity of 76% and specificity of 83% [87]. The concurrent analyses of hundreds of methylation marks in cfDNA also allowed for the differentiation among various gastrointestinal cancers, including PDAC [89]. In a recent study, a set of 10 cfDNA methylation markers (MIR129-2, LINC01158, CCDC181, PRKCB, TBR1, ZNF781, MARCH11, VWC2, SLC9A3, HOXA7) demonstrated a very good performance with 100% sensitivity at 95% specificity to distinguish between metastatic pancreatic cancer and benign pancreatic cysts [91].
Adding another diagnostic modality (CA19-9 levels, KRAS mutation status etc.) to the assessment of cfDNA methylation can improve accuracy [90,92,93]. Evaluating CA 19-9 levels together with the methylation status of RUNX3 in cfDNA was able to increase sensitivity to detect PDAC from 50.9% (RUNX3 DNA methylation alone) to 85.5% [92]. In another study, cfDNA analyses of 13 methylation markers among 120 advanced-stage and 50 early-stage PDAC patients and 170 controls showed that the combined analyses of the DNA methylation markers and CA19-9 levels compared significantly better with either assays alone, with an overall sensitivity and specificity of 92% at the pre-set specificity of 97.5% [90].
DNA methylation markers have also been investigated in body fluids other than plasma or serum [94][95][96]. In one study, 14 markers were studied in pancreatic juice samples from 38 patients with PDAC or intraductal papillary mucinous neoplasms (IPMN) with high grade dysplasia and were compared with controls (N = 73) [94]. A group of 3 markers (C13orf18, FER1L4, BMP3) was sufficient to distinguish patients with pancreatic cancer from controls with 83% sensitivity at a pre-set specificity of 86%. The same group analyzed a set of 13 methylation markers in 134 pancreatic cyst fluid samples, including 21 cases with PDAC or high grade dysplasia and 113 controls [95]. Two markers (TBX15, BMP3) achieved a sensitivity and specificity of > 90%. The group had previously also assessed DNA testing (methylation markers and KRAS mutations) from stool for the detection of PDAC [96]. At 90% specificity, the combination of methylated BMP3 and mutant KRAS detected 67% of PDAC patients.
DNA Methylation in Liquid Biopsies as Marker for Prognostication and Treatment Monitoring of PDAC
The importance of analyzing cfDNA methylation cannot only be limited to PDAC diagnosis, it may become of clinical significance for prognostication of the disease and treatment monitoring [91,[97][98][99][100].
In one study, the mean number of hypermethylated genes in cfDNA was significantly higher in metastatic (that means prognostically unfavorable) disease than in earlier stages of PDAC [97]. The same group showed that patients with more than 10 hypermethylated genes of a 28 gene panel had worse survival outcomes than those with fewer [98].
In addition to the mere number of hypermethylated genes, the specific set of aberrantly methylated genes in cfDNA can have prognostic potential [97][98][99][100]. For example, hypermethylation of ALX4, BNC1, HIC1, SEPT9v2, SST, TFPI2, and TAC1 differed between stage IV and stage I-III disease in the aforementioned study [97]. Based on the gene methylation status, there have been attempts to establish prognostic models but they require further validation [98,99]. Of interest is a post hoc analyses of the Prodige 35 and Prodige 37 trials, in which cfDNA was assessed for two methylation markers (HOXD8, POU4F1) in 354 patients [100]. Median progression-free survival (PFS) and OS were 5.3 and 8.2 months in cfDNA-positive and 6.2 and 12.6 months in cfDNA-negative patients, respectively. In multivariable analyses, the cfDNA methylation status remained an independent prognosticator for PFS (hazard ratio (HR) 1.5) and OS (HR 1.62).
Owing to its non-invasive nature, plasma cfDNA allows serial monitoring of tumor burden and evolution under treatment, which cannot be realized by tissue biopsy [101]. Although data on cfDNA methylation under treatment are scarce, a decrease in cfDNA methylation levels has been reported in patients undergoing chemotherapy [91].
In summary, assessment of cfDNA methylation has promising diagnostic and prognostic value in PDAC. Further validation studies in larger patient cohorts are required to determine the most suitable DNA methylation biomarker panel for early detection, prognostication and monitoring of PDAC patients.
Histone Modifications in Liquid Biopsies as Biomarker in PDAC
As mentioned earlier, nucleosomes are complexes of DNA and histone proteins which constitute chromatin [44]. In several conditions, including cancer, mono-and oligonucleosomal fragments are released during cellular apoptosis into the blood circulation, where they can potentially be used for diagnostic purposes [102]. One study showed that markers of epigenetic modifications (e.g., histone modifications, of circulating nucleosomes were able to distinguish between PDAC patients and control cases with good performance (72% sensitivity at pre-set 90% specificity) [103]. In the same study, consideration of CA 19-9 in addition to a panel of 4 epigenetic markers enhanced the sensitivity to 92%. However, further research is needed to confirm these findings.
Liquid Biopsy to Select Epigenetically Active Treatment in PDAC
As mentioned, the analyses of certain gene mutations in cfDNA may add to the diagnostic and prognostic value of epigenetic biomarkers in PDAC. In that light, KRAS mutation status in PDAC patients may inform on the sensitivity of decitabine, a DNMT inhibitor, which exerted its anti-tumor effects in KRAS-mutated PDAC [104]. In fact, a current phase II study is aiming to provide a proof-of-concept that KRAS-dependent PDACs are responsive to decitabine treatment [105]. Similarly, mutations or loss of components of the SWI/SNF (SWItch/Sucrose Non-Fermentable) complex, which is involved in the spatial organization of chromatin, might become of relevance in PDAC [106]. In a phase I study, solid tumors bearing loss of SWI/SNF subunit expression showed increased sensitivity to the EZH2 inhibitor tazemetostat [107], which was consistent with previous preclinical findings showing oncogenic dependency of SWI/SNF mutated cells on EZH2 activity [108]. Thus, SWI/SNF status-guided treatment with EZH2 inhibitors may become a promising approach in PDAC treatment. Table 1 summarizes the hitherto mentioned studies assessing the diagnostic and prognostic value of liquid biopsy testing of epigenetic biomarkers in PDAC.
Epigenetic-Based Therapeutic Approaches
As summarized above, epigenetic modifications play a key role in PDAC development and in tumor-to-metastasis transition. It is hence not surprising to find that treatment strategies based on targeting epigenetic regulators recently became a subject of research interest in PDAC, as outlined in the following section. The clinical trials discussed in this part are summarized in Table 2.
DNMT Inhibitors (DNMTi)
While DNA hyper-and hypomethylation are both implicated in cancer development, hypermethylation of tumor suppressor genes and DNMT overexpression are established as major players in carcinogenesis [109]. The DNMTi azacitidine (5-azacytidine) and its deoxy-derivative decitabine (5-aza-2 -deoxycytidine) are cytidine analogues that are incorporated into DNA upon replication [109]. This leads to irreversible binding of DNMT1 resulting in its degradation and decreased DNA methylation. Azacitidine, in contrast to decitabine, is additionally and mostly incorporated into RNA which inhibits polyribosome assembly and protein generation. As single agents, DNMTi are currently approved for treatment of myelodysplastic syndromes (MDS) or acute myeloid leukemia (AML) [109]; in AML, also in combination with the BCL2 inhibitor venetoclax [110]. DNMTi demonstrated particular clinical benefit in patients with MDS or AML with adverse genetics, such as TP53 aberrations [111].
When treated with azacitidine, the PDAC cell line PANC-1 showed less tumorigenicity, which was associated with re-expression of antiproliferative somatostatin (SST) and its receptor 2 (SSTR2) [112]. Growth inhibition was further increased after the addition of gemcitabine. In line with these findings, a phase Ib clinical trial has been conducted to test the safety and efficacy of decitabine plus gemcitabine in patients with advanced PDAC and sarcoma [113].
Additionally, in PDAC cells isolated from a stroma-rich mouse model (KPC-Brca1 mice) IFN-inducible genes (including STAT1 and STAT2) were overexpressed upon decitabine treatment, and combination of IFN-γ with decitabine demonstrated an additive antiproliferative effect on PDAC cells [114]. Azacitidine was shown to enhance tumor T-cell infiltration and expression of transcripts for antigen presentation machinery such as MHC class I in mouse and human PDAC cell lines, which was associated with tumor regression in azacitidine treated mice [115,116]. Therefore, sensitization to immune checkpoint therapy by DNMTi has been subject to several phase I/II trials in patients with advanced PDAC [117][118][119] (Table 2).
Systemic elevation of cytidine deaminase (CDA) levels, which rapidly metabolizes cytidine analogues into inactive uridine, is a potential resistance mechanism to decitabine [120]. Accordingly, combining DNMTi with high doses of CDA inhibitors is considered a promising treatment strategy to overcome resistance in patients with advanced PDAC, although currently available clinical data have been unsatisfactory [121,122]. Further ongoing and completed phase I/II studies of DNMTi in different PDAC patients are illustrated in Table 2 [123,124].
HDAC Inhibitors (HDACi)
HDACi can modulate expression of genes involved in apoptosis, differentiation and angiogenesis and inhibit PDAC tumor growth by restoring the histone acetylation balance [125].
Similar to DNMTi, the immunomodulating effects of HDACi have increasingly moved into the focus [143][144][145]. HDACi restores MHC I surface expression in tumor cells deficient of TAP, a component of the antigen processing machinery, and enhances immunogenicity and T-cell infiltration [143]. In a metastatic PDAC mouse model, HDACi application reduced the immunosuppressive ability of granulocytic myeloid-derived suppressor cells (G-MDSCs) in the TME, leading to sensitization to immune checkpoint inhibitor treatment [144]. To that end, a current phase II trial is aiming to determine the efficacy of the HDACi entinostat with the PD1 inhibitor nivolumab in patients with unresectable PDAC [145].
Moreover, combining HDACi with other targeted therapies, for example tyrosine kinase inhibitors (TKIs), may be an approach to modify HDACi effects in PDAC, as it has been investigated in a phase II trial, which tested the combination of the HDACi vorinostat and the TKI sorafenib with gemcitabine and radiation therapy [146] (Table 2). This might extend the findings of a recent study in hepatocellular carcinoma, where the HDACi resminostat in combination with sorafenib inhibited platelet-mediated cancer promoting effects, possibly via reduction of platelet-induced CD44 expression, suppression of EMT and MEK/ERK signaling [147]. In fact, combining HDACi with inhibitors of MEK and PI3K, the downstream effectors of KRAS signaling, enhanced apoptosis and reduced metastasis, therapeutic resistance and self-renewal of PDAC cells [148,149], underscoring the potential of KRAS targeting as a promising treatment in combination with HDACi in PDAC patients.
Retinoids
Retinoids are derivatives of vitamin A. The first generation retinoid all-trans retinoic acid ATRA (Tretinoin) is approved for treatment of acute promyelocytic leukemia (APL) [150]. ATRA also increases the efficacy of decitabine, without added toxicity, in frail patients with AML other than APL [151]. ATRA treatment induces changes in chromatin conformation/accessibility [152,153] and acts synergistically with decitabine [152] and HDACi [154]. It also has demonstrated (although mostly moderate) single-agent efficacy in various solid tumors [155].
Retinoid signaling is fundamental in normal pancreas and PDAC development [156]. ATRA by itself exerts antineoplastic effects and increases cytotoxic effects of gemcitabine in PDAC [157,158]. ATRA can restore quiescence of fibroblasts (through PIN1 inhibition), which reduces desmoplastic features in the TME of PDACs and thus decreases chemotherapy resistance [159][160][161]. ATRA has been investigated in combination with gemcitabine and nab-paclitaxel in a phase I trial and showed an expectedly excellent toxicity profile and encouraging response rates and duration, which led to a planned randomized phase II trial [162][163][164] (Table 2).
Recently, the combination of the HDACi belinostat with 13-cis-retinoic acid (isotretinoin, prodrug of ATRA) was well tolerated in patients with advanced solid tumors, including three with PDAC [165], which might prompt more studies to further assess its efficacy in PDAC. Moreover, retinoids enhanced the response to immune checkpoint inhibition, by inducing interferon mediated inflammation in TME, which was characterized by increased CD8+ T cell and decreased T-reg infiltration in cancer models [166]. On that basis, a phase I study is currently underway to test the efficacy of ATRA and nivolumab combination in patients with advanced or metastatic PDAC [167] (Table 2).
BET Inhibitors (BETi)
BETi, which competitively bind the acetyl-lysine recognition motif at the bromodomain of BET proteins, can repress expression of oncogenes including those of known relevance in PDAC, such as c-MYC [168,169]. BETi displayed significant in vitro and in vivo antitumorigenic activity individually and increased the therapeutic effects of other treatment modalities in PDAC [170][171][172][173][174]. The potential benefits of BETi concluded from preclinical studies remain to be confirmed in patients [175,176]. The BETi mivebresib displayed modest efficacy, with 26 of 61 patients with solid tumors (including PDAC) achieving stable disease, while the remaining patients had disease progression [175]. While BETi monotherapy may not be an optimal therapeutic option, its role in combination with other systemic therapies or with radiotherapy requires further assessment. In line with this, the BETi JQ1 and vorinostat synergistically suppressed tumor growth in a mouse model for advanced PDAC [177]. Similar results were obtained in PDAC cell lines and xenograft models with a dual BET/HDAC inhibitor [178]. In another study, JQ1 attenuated DNA double-strand repair and consequently sensitized the tumor cells to PARP inhibitors (PARPi), both of which exerted synergistic cytotoxic activity in vitro and in patient derived xenograft (PDX) models of PDAC [179]. To test the applicability of these approaches in PDAC and other solid tumors, phase I/II studies are currently testing the combination of the HDACi entinostat with the BETi ZEN-3694 [180] and of the BETi NUV-868 with the PARPi olaparib and the antiandrogen enzalutamide [181].
Reprogramming immune response by epigenetic modifications comes into play, when a dual BET/HAT inhibitor enhanced antigen presentation of PANC-1 cells and T cell recruitment to the tumor stroma, and sensitized PDAC cells to immune checkpoint inhibition and extended survival in the KPC mouse model of advanced PDAC [182]. In a study involving PDAC PDX models and patient biopsies, recruitment of TNF-α + macrophages, mediated by BRD4-mediated cJUN/AP1 expression, shifted tumor cells from the classical to the aggressive basal subtype, which was reversed upon treatment with the BETi JQ1 [183]. Current phase I/II trials are examining this treatment approach in advanced solid tumors [184,185].
EZH2 Inhibitors (EZH2i)
The methyl group added by the HMT EZH2 is provided by S-adenosylmethionine (SAM) which is demethylated to S-adenosylhomocysteine (SAH) [186]. The majority of EZH2i (e.g., tazemetostat) competitively occupy the site for SAM in the binding pocket of EZH2. Different from that, 3-deazaneplanocin A (DZNep) inhibits SAH degradation which causes methyl accumulation, which in turn inhibits EZH2 enzyme activity. EZH2i lead to deprivation of the enzymatic activity of EZH2, which for example contributes to low H3K27me3 levels and subsequent anti-tumor effects [186].
Preclinical studies demonstrated the synergistic cytotoxic effects of EZH2i in combination with other treatment modalities in several models of solid tumors [187][188][189][190]. In a panel of PDAC cells, DZNep enhanced the anti-proliferative effects of gemcitabine and reduced cellular migration potentially via augmenting expression of E-cadherin [191]. Dual EZH2 and BET inhibition reduced colony formation, induced cell cycle arrest and caused apoptosis in PDAC cell lines, better than each individual inhibitor alone, and suppressed tumor growth in xenograft mice models [192]. Such data on EZH2i combination therapies need to be considered when seeing the minor efficacy of EZH2i monotherapy, as indicated by GSK2816126 treatment of patients with advanced hematologic or solid malignancies (including PDAC) despite its relative safety [193].
Several ongoing and completed phase I/II studies have been dedicated to further explore the safety and efficacy of EZH2i mono-and combination therapies in hematologic and solid cancers [194][195][196][197][198][199]. Of these, two studies aim to assess the potential benefits of combining tazemetostat with immune checkpoint inhibition [198,199]. This concept is supported by the finding that EZH2i treatment enhanced antigen presentation in head and neck squamous cell carcinoma cells and cytotoxicity of CD4+ and CD8+ T cells, and improved response of anti-CTLA-4 and anti-PD-1 immune checkpoint inhibitors in solid tumor models [200,201].
Most studies exploring the synergism of epigenetically active drugs with other treatment modalities studied combinations with chemo-and/or radiotherapy, targeted therapies, or immunotherapies. Two ongoing trials assess the safety and efficacy of combining epigenetically active drugs, i.e., HDACi with retinoids or with BETi, in patients with solid tumors including PDAC [165,180]. DNMTi/HDACi combinations have not demonstrated convincing added efficacy in several phase I/II trials in hematologic malignancies or solid tumors [151,202]. Considering preclinical studies in PDAC, the anti-tumoral effect of the DNMTi zebularine was augmented, when combined with the HDACi SAHA in PDAC cell lines, which was, however, not reproducible in xenograft models [203]. On the other hand, enhanced tumor suppression was observed when a BETi was combined with HDACi, HATi or EZH2i in PDAC cell lines and mouse models, as discussed earlier in this section, which may provide a promising strategy [177,178,182,192].
Conclusions and Perspective
In addition to genetic aberrations, dysregulation of epigenetic mechanisms including DNA methylation and histone modifications are main contributors to PDAC biology and heterogeneity, and hence, disease progression, metastasis and chemoresistance. Future expansion of recent single-cell RNA sequencing data by integrative single-cell sequencing analyses of genetic and epigenetic aberrations will help to even better define the spatial and intercellular heterogeneity and its changes during tumor evolution and under treatment [204][205][206].
The uniformity in driver gene mutations between primary tumors and metastatic sites but potential differences in biology and treatment response indicate that epigenetic alterations contribute to PDAC metastasis and tumor migration [13,14]. Aberrant DNA methylation and chromatin remodeling are involved in the loss of epithelial cell adherence and gain of mesenchymal-like features, while enhancing extracellular matrix degradation, which promotes PDAC migration, invasiveness and resistance to therapy [63][64][65][66][68][69][70][71].
Utilizing epigenetic information for the development of reliable biomarkers and successful therapeutic strategies is of essence. Liquid biopsy is emerging as a reliable and non-invasive biomarker approach for diagnosis, prognostication and/or treatment monitoring in PDAC. cfDNA methylation patterns are able to differentiate between PDAC and benign pancreatic conditions with already relatively high accuracy [81][82][83][84][85][86][90][91][92][94][95][96]. Moreover, cfDNA methylation markers have demonstrated promising results for identifying metastatic stage and estimating the prognosis of PDAC patients [84,[97][98][99][100]. In light of the heterogeneous nature of PDAC, future studies should be dedicated in developing biomarker panels, that combine epigenetic data with other modalities (e.g., CA 19-9 levels or gene mutation status) to improve the prediction performance and aid in developing tailored therapy [90,92,103,105,107]. As illustrated in Figure 1, the development of biomarkers has to be performed hand-in-hand with novel treatment modalities to allow for an optimum of prognostic and predictive information. Only a few studies have described the predictive value of molecular markers in the context of epigenetically active treatment in PDAC, e.g., KRAS mutation status for DNMTi [104,105], SWI/SNF status for EZH2i [107,108] or expression status of FABP5 for retinoids [207].
Combining epigenetically targeted therapies with each other or with other chemotherapeutic agents or targeted therapies showed promising anti-tumor and disease-modifying effects due to their synergistic or additive mechanisms. Moreover, combination therapy may be able to reduce or delay emergence of resistance by concurrent targeting of molecular pathways essential for cellular viability or by inhibiting compensatory escape routes.
Since epigenetic therapies have repeatedly demonstrated intrinsic immune-modulatory properties in preclinical studies, combining epigenetic therapy with immunotherapy in general and immune checkpoint inhibition in particular is a promising approach in PDAC management, and is being validated in several phase I/II trials [117][118][119]145,167,199].
Like most anti-cancer agents, epigenetic therapies may not always solely target the gene, biological process or cell of interest. Such off-target effects may particularly cause excess of side effects. However, decrease of dose can reduce frequency and severity of side effects, and, as shown for DNMTi in the past, can also increase the epigenetic/reprogramming potential of epigenetic agents (while reducing its cytotoxic impact) [208]. In addition, effects that are currently considered to be off-target may eventually be desirable. For example, beside their ability to re-activate tumor suppressor genes, DNMTi can also activate the expression of other genes silenced in normal cells and encoding for endogenous retroviruses (ERVs), latent cancer testis antigens (CTAs), Alu elements and long interspersed elements (LINEs) all of which can modulate tumor cell visibility to the host immune system [209]. Recently, the hydroxamate class of HDACi showed an off-target inhibition of MBLAC2 leading to accumulation of extracellular vesicles, thus unravelling a new HDAC-independent therapeutic mechanism [210].
Nevertheless, the large-scale changes in gene expressions induced by epigenetic therapy can pose risk to normal cells, which also rely on epigenetic plasticity in their differentiation and development. In line with that, epigenetic inhibitors frequently cause hematopoietic side effects, such as thrombocytopenia, neutropenia and anemia or nonhematologic toxicities including fatigue, diarrhea, nausea and vomiting which can reach grade 3/4 severity [211][212][213]. It remains to be established to what extent more selective agents such as the DNMT1i GSK3685032 [214], the HDAC9i nanatinostat [215] or the HDAC6i ricolinostat [216] exhibit decreased toxicity by comparable or improved efficacy.
In summary, increased understanding of the role of epigenetic alterations in PDAC progression and metastasis has paved the way for several studies to discover epigenetic biomarker panels, prediction algorithms and therapeutic strategies aiming to improve the outcomes of PDAC patients. This demonstrates that we are on the verge of implementing epigenetics in the clinical management of our patients. Relevant next steps will be to establish epigenetic biomarkers for treatment stratification and monitoring in prospective studies and to identify the most promising treatment combinations for further phase III development (under special consideration of those combinations implementing immunotherapies and/or having an optimal therapeutic index). The further investigation of epigenetic biomarkers and treatments has to be performed jointly in order to allow the identification of those patients, who may most likely benefit from the respective treatment. The optimal utilization of epigenetics in diagnostics and treatment holds the promise to significantly improve the dismal prognosis of patients with PDAC.
Conflicts of Interest:
The authors have no conflict of interest to declare.
|
v2
|
2022-12-12T16:08:34.648Z
|
2022-11-30T00:00:00.000Z
|
254560108
|
s2ag/train
|
FIBROID DISEASE PROGNOSIS AND METHODS OF TREATMENT IN KSA: A SYSTEMATIC REVIEW
Objective: A growing number of research on fibroid disease among women and methods of treatment. The goal of this systematic review was to spot light on fibroid disease prognosis and to determine the methods of treatment used in Kingdom of Saudi Arabia (KSA). Methods: Authors began with recognizing the important examination proof that spots light on fibroid disease prognosis and to determine the methods of treatment used in KSA. We led electronic writing look in the accompanying data sets: Ovid Medline (2010-present), Ovid Medline Daily Update, Ovid Medline in process and other non-filed references, Ovid Embase (2010-present), The Cochrane Library (latest issue) and Web of Science. Just examinations in English language were incorporated. The precise selection was acted in close collaboration with a clinical examination curator. Results: A total of 19 studies were identified in the search, all of them were assessed for eligibility, and 6 articles were included in this review.HIFU is now utilized therapeutically in the treatment of leiomyomas in gynecologic oncology. Since the 1990s, when clinical studies of HIFU treatment for leiomyomas first started, HIFUNIT 9000 and prototype single focus ultrasound devices have been used to treat the vast majority of leiomyoma patients. Excellent-intensity focused ultrasound (HIFU) is a non-invasive, gold-standard therapy for all sizes of leiomyomas, with high effectiveness, minimal surgical morbidity, and no systemic adverse effects. Conclusion: Fibroids of the uterus that were causing symptoms responded well to HIFU therapy. The literature on embolization of the uterine artery is sparse (UAE). HIFU is a great choiceto treat fibroids in your uterus.
|
v2
|
2022-12-15T16:13:30.864Z
|
2022-11-30T00:00:00.000Z
|
254675498
|
s2ag/train
|
A Comparative Study on the Importance of Milk and Milk Products as a Complete Food
Milk is a commonly consumed soft drink essential to many people's overall diet as it provides all crucial foods and micronutrients. Milk is considered valuable because it is synthesized before adolescence and adulthood. However, its relatively high soaked fat content raises the question of whether it can negatively affect the cardiovascular system. This study evaluates the latest publications on dairy products and human well-being, as described in epidemiological, academic, and biochemical evidence. For example, the effects of milk (especially skim milk) on body weight appear irrefutable, and the most famous studies show that the use of dairy products does not increase the incidence of cardiovascular problems or certain tumors. The study was conducted using a questionnaire and targeted two types of dairy products: packaged and unpackaged. The evidence is inconclusive, but some studies suggest that milk and its by-products may help some populations. Future studies will help clarify the role of milk and dairy products in human well-being, but their use in a proper diet should be considered without explicit contraindication fragments.
|
v2
|
2022-12-16T15:44:02.160Z
|
2022-11-30T00:00:00.000Z
|
254688480
|
s2ag/train
|
Minimally Invasive Compared With Open Surgery in High-Risk Endometrial Cancer
Minimally invasive surgery and open surgery had similar disease-free survival and overall survival in patients with high-risk endometrial cancer. OBJECTIVE: To compare outcomes between minimally invasive surgery and open surgery in patients with high-risk endometrial cancer. DATA SOURCES: A cohort study of all patients who underwent surgery for high-risk endometrial cancer between 1999 and 2016 at Mayo Clinic (Rochester, Minnesota) and a literature search of MEDLINE, EMBASE, ClinicalTrials.gov, Cochrane Central Register of Controlled Trials, and Scopus of all published studies until December 2020. METHODS OF STUDY SELECTION: The systematic review identified 2,332 patients (14 studies, all retrospective except a subanalysis of a randomized comparison) and the cohort study identified 542 additional patients. Articles were included if reporting original data on overall survival and disease-free survival among patients with high-risk endometrial cancer, defined as International Federation of Gynecology and Obstetrics grade 3 endometrioid, serous, clear cell, mixed histology, or uterine carcinosarcoma. Studies that did not report at least one of the main outcomes, those in which one surgical technique (robotic or laparoscopic surgery) was missing in the comparison analysis with open surgery, and case reports were excluded. Additional data were extracted from a retrospective cohort of patients from Mayo. A random-effect model was used for meta-analysis. TABULATION, INTEGRATION, AND RESULTS: This systematic review and meta-analysis was registered in PROSPERO. Literature search and data extraction were performed independently by two reviewers, as well as quality assessment using GRADE (Grading of Recommendations Assessment, Development and Evaluation) methodology, and the Newcastle-Ottawa Scale. PRISMA (Preferred Reporting Items for Systematic Reviews and Meta-Analyses) guidelines were followed. Meta-analysis showed that disease-free survival and overall survival in patients with high-risk endometrial cancer who underwent minimally invasive surgery were not statistically different from those of patients who underwent open abdominal surgery (relative risk [RR] 0.93, 95% CI 0.82–1.05, I2 20%, P=.23; and RR 0.92, 95% CI 0.77–1.11, I2 31%, P=.12, respectively). Subgroup analysis by stage (early vs advanced) did not identify a difference between surgical approaches. CONCLUSION: Minimally invasive surgery and open surgery had similar disease-free survival and overall survival in patients with high-risk endometrial cancer. SYSTEMATIC REVIEW REGISTRATION: PROSPERO, CRD42021275535.
|
v2
|
2022-12-18T16:57:21.387Z
|
2022-11-30T00:00:00.000Z
|
254851795
|
s2ag/train
|
Obesity related alterations in kidney function and plasma cytokines: Impact of sibutramine and diet in male Wistar rats
Obesity is a global problem due to widespread consumption of high fat diet (HFD) with implications to well-being. This study was to investigate the modulatory effect of sibutramine and normal diet on obesity-induced alteration in kidney functions and adipokines in Wistar rats. Hundred rats were divided into four groups of 25 each and fed with either normal rat chow (NRC) (group I, control group, n=25) or HFD (n=75). Obese rats were subjected to treatment with HFD (group II, Obese + HFD, n=25), Sibutramine and NRC (group III, Obese + Sibutramine + NRC, n=25); and NRC (group IV, Obese + NRC, n=25) for another 12 weeks. Five rats from each group were sacrificed, urine and blood samples collected for baseline values after the acclimatization period. Similarly, at post induction, 4, 8 and 12 weeks urine and blood samples were collected from 5 rats per group for investigations. Induction of obesity significantly (p<0.05) increased mean Lee index, urine albumin, urine albumin:creatinine ratio, serum interleukin (IL)- 1β, IL -6, tumor necrotic factor (TNF)- α, interferon (IFN) - γ, leptin and decreased urine creatinine and serum adiponectin compared to control. Sibutramine treatment and withdrawal of HFD ameliorated these effects. Obesity induced renal impairment by deranging renal and inflammatory biomarkers investigated in this study. These adverse effects on the kidney were mitigated by sibutramine10 mg/kg/day and NRC by resisting the disturbance, thereby showing nephron-protective effect. The combined treatment of sibutramine with NRC reduced progression of kidney disease to a lesser extent than NRC alone suggesting nonsynergistic effect.
|
v2
|
2022-12-29T16:10:35.136Z
|
2022-11-30T00:00:00.000Z
|
255220406
|
s2ag/train
|
MECHANISMS OF RESISTANCE IN THERAPY WITH ANGIOGENESIS BLOCKERS IN COLORECTAL CANCER
One of the fundamental events that determine carcinogenesis and its progression is angiogenesis mediated by the activation of the vascular endothelial growth factor (VEGF). The angiogenic cascade provides a comfortable micro-environment for the tumor, the creation of a metastatic niche and subsequent metastatic dissemination of neoplastic cells. The development of a recombinant hyperchimeric monoclonal antibody that selectively binds and inhibits the biological activity of VEGF - Bevacizumab, has led to a change in the therapeutic strategy for patients with cancer and, in particular, for patients with metastatic colorectal cancer (CRC), because it demonstrated an increase in their survival rate.
|
v2
|
2022-12-29T16:14:37.366Z
|
2022-11-30T00:00:00.000Z
|
255221143
|
s2ag/train
|
Utilization of Immunohistochemistry in Gynecologic Pathology: An Experience at a Tertiary Care Hospital, Lahore-Pakistan
Background: Immunohistochemistry is an adjunct tool in Surgical Pathology. The fast growing use of immunohistochemistry in gynecologic Pathology has revolutionized the fields of tumor diagnostics & research. Objective: The objective of the study was to share & discuss the experience of utility of immunohistochemistry in Gynecologic Pathology, at a tertiary care hospital in Lahore, Pakistan. Patients & Methods: This was a retrospective, descriptive, cross sectional study, carried out at the Pathology Department of Fatima Jinnah Medical University, Lahore. All cases which were diagnosed after the application of immunohistochemistry during the study period from 1st July 2019 to 31st December 2020 were included in the study. Data included age of the patient, marital status, parity, clinical & radiological presentation, histopathological findings & differentials, list of immunohistochemical markers applied to the case with results & final histopathological diagnosis. Data was analyzed using SPSS version 17. Results: A total of 196 cases were included in the study. The age of the patients ranged from 14 years to 82 years with a mean age of 41 ± 7 years. The commonest use of immunohistochemistry was for histological classification of the tumors of the female genital tract, identifying precancerous lesions, differentiating primary from metastatic CA & predicting response to chemotherapy via proliferative index Ki67. The most commonly used immunohistochemical markers were CK, CK7, CK20, CD 3, CD20, ER, PR, VIMENTIN, WT 1, Ki67, CD 117, SMA, INHIBIN, p53 & p63. Practical implication This study shares the experience of use of common immunohistochemical markers in different cases of gynecologic pathology, highlighting & discussing different panels for use in different scenarios, from which other pathologists may benefit. Conclusion: Immunohistochemistry is an important ancillary tool in the evaluation of gynecologic pathology cases. However, it cannot replace conventional histopathology. It should always be used as an adjunct to histopathology, in the proper clinical & radiological context. Keywords: immunohistochemistry, gynecologic pathology, ovarian carcinoma, leiomyoma, dysgerminoma,
|
v2
|
2022-12-29T16:15:11.109Z
|
2022-11-30T00:00:00.000Z
|
255209085
|
s2ag/train
|
Contact effects by mitochondria: biological destruction of cultivated B16 – F10 melanoma cells
In recent years therapeutic effects produced by mitochondria, transplanted to pathogenic regions in an organism, which demonstrate their high migration activity and tropicity with respect to filling of energetic vacuum, have been inspiring a renewed interest in the scientific community. In this context, this raises the question of the source of metabolically active mitochondria and their histological compatibility required for the mitochondrial transplantation. Aim. The aim of our research work is to study characteristics/ quality of mitochondria from cells of the liver and the heart in rats, which in the in vitro system have produced their impact on different biological features of the B16-F10 murine melanoma cell culture. Materials and methods. In our research work we have used cells of the B16-F10 murine melanoma cell line culture. In the framework of the study, an experiment with mitochondria harvested from the liver and the heart of a rat has been conducted. Mitochondria have been isolated using differential centrifugation with a high-speed refrigerated centrifuge. With the B16-F10 culture cells, we have designed the following variants of our experiments: 1) use of cardiac mitochondria (1 mg/mL, in terms of total protein); 2) use of cardiac mitochondria (1 mg/mL) + succinic acid (10-4%); 3) mitochondria of the liver (1 mg/mL, in terms of total protein); 4) use of mitochondria of the liver (1 mg/mL) + succinic acid (10-4%); 5) use of succinic acid (10-4%) solely; 6) the reference specimen with no use of mitochondria and the above agents. An assessment of the impact made by mitochondria on the migration of the B16-F10 cells has been performed with the scratch wound healing test. For the purpose of an analysis of the effect produced by mitochondria on the energetic metabolism of the B16-F10 cell culture we have measured main parameters of the cell respiration and glycolysis in stress tests with adding some toxic chemicals. The rate of the cellular respiration has been assessed by measuring the amount of oxygen taken in (oxygen consumption rate, OCR), and the glycolysis level has been evaluated by the extracellular acidification rate (ECAR). Results. Adding cardiac and hepatic mitochondria to the cultivated B16-F10 cells has produced a pronounced cytopathic effect, which has become more remarkable upon expiration of two days of the cell cultivation and which has consisted in cytoplasm granulation and partial detaching of the cells. Introducing mitochondria of the heart to the cultivated B16-F10 cells has induced a considerable decrease both in the background-related and the maximum level of oxygen consumption by the B16-F10 cells as against the reference samples without adding of mitochondria. Adding the cardiac mitochondria has led to a statistically significant decrease in the base level of ECAR by 14,36 mpH/min (t = 3,12, df = 10) as compared with the reference values. Introducing hepatic mitochondria has also resulted in a reduction of the average value of ECAR as against the background by 4,8 mpH/min. Conclusion. Metabolically active mitochondria are capable of reformatting energetic fluxes in tumor cells and change their cellular respiration that leads to the most effectively realized death of the cultivated B16-F10 tumor cells.
|
v2
|
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.