Split (1)

train · 369k rows

abstract stringlengths 0 122k

India reported its first case of covid-19 on 30th Jan 2020. Though we did not notice a significant rise in the number of cases in the month of February and like many other countries, this number escalated like anything from March 2020. This research paper will include analysis of covid-19 data initially at a global level and then drilled down to the scenario of India. Data is gathered from multiple data sources from several authentic government websites. The paper will also include analysis of various features like gender, geographical location, age using Python and Data Visualization techniques. Getting insights on Trend pattern and time series analysis will bring more clarity to the current scenario as analysis is totally on real-time data(till 19th June). Finally we will use some machine learning algorithms and perform predictive analytics of the near future scenario. We are using a sigmoid model to give an estimate of the day on which we can expect the number of active cases to reach its peak and also when the curve will start to flatten sigmoid model gives us a count of date which is a unique feature of analysis in this paper. We are also using certain feature engineering techniques to transfer data into logarithmic scale for better comparison removing any data extremities or outliers. Based on the predictions of the short-term interval, our model can be tuned to forecast long time intervals. Needless to mention there are a lot of factors responsible for the cases to come in the upcoming days. It depends on the people of the country and how strictly they obey the rules and restriction imposed by the Government.
Despite prophylactic anticoagulant treatments, thrombotic complications may develop in patients with coronavirus disease 2019 (COVID-19). This study aimed to evaluate the factors influencing anti-factor Xa activity in COVID-19 patients receiving low molecular weight heparin (LMWH). We prospectively evaluated 80 COVID-19 patients, diagnosed using polymerase chain reaction test, who were admitted to our clinic and administered LMWH; LMWH (enoxaparin) was applied according to the weight, D-dimer levels, and clinical condition of patients. Anti-factor Xa activity in blood, drawn 4 h after the 3rd dose of LMWH, was measured and an activity of < 0.2 IU/mL was considered subprophylactic. Patients were followed up clinically, and anti-factor Xa activity was re-examined before discharge. Groups 1 and 2 included 13 and 67 patients with subprophylactic (mean ± SD: 0.18 ± 0.06) and prophylactic (mean ± SD: 0.43 ± 0.23) anti-factor Xa activity, respectively. The proportion of eosinophils in patients was significantly higher in group 1 than in group 2 (mean ± SD; 2.96 ± 2.55 vs 0.90 ± 1.28; p = 0.001). At the time of discharge, the eosinophilic proportion of patients was significantly higher (eosinophil %, mean ± SD; 3.06 ± 1.49 vs 2.07 ± 1.92; p = 0.001), but the activated partial thromboplastin time was significantly lower (22.34 ± 1.38 vs 24.38 ± 3.58; p = 0.01) in group 1 than in group 2. Of 14 patients with eosinophil content > 4%, 6 were in group 1 ((6/13) 46.2%), while 8 were in group 2 ((8/63) 11.9%); (p = 0.009), and all had a D-dimer level < 1 μg/mL (p = 0.03). ROC analysis for the presence of anticoagulation at subprophylactic level revealed an area under curve of 0.79 (95% CI: 0.64–0.93); p = 0.001). In conclusion; Elevated eosinophil count is related to lower anti-factor Xa activity in patients with COVID-19 receiving LMWH. The clinical significance of the subprophylactic anti-factor Xa activity should be studied in COVID-19 patients (NCT04507282).
Infectious bronchitis virus (IBV) control is mainly based on wide vaccine administration. Although effective, its efficacy is not absolute, the viral circulation is not prevented and some side effects cannot be denied. Despite this, the determinants of IBV epidemiology and the factors affecting its circulation are still largely unknown and poorly investigated. In the present study, 361 IBV QX (the most relevant field genotype in Italy) sequences were obtained between 2012 and 2016 from the two main Italian integrated poultry companies. Several biostatistical and bioinformatics approaches were used to reconstruct the history of the QX genotype in Italy and to assess the effect of different environmental, climatic and social factors on its spreading patterns. Moreover, two structured coalescent models were considered in order to investigate if an actual compartmentalization occurs between the two integrated poultry companies and the role of a third “ghost” deme, representative of minor industrial poultry companies and the rural sector. The obtained results suggest that the integration of the poultry companies is an effective barrier against IBV spreading, since the strains sampled from the two companies formed two essentially-independent clades. Remarkably, the only exceptions were represented by farms located in the high densely populated poultry area of Northern Italy. The inclusion of a third deme in the model revealed the likely role of other poultry companies and rural farms (particularly concentrated in Northern Italy) as sources of strain introduction into one of the major poultry companies, whose farms are mainly located in the high densely populated poultry area of Northern Italy. Accordingly, when the effect of different environmental and urban parameters on IBV geographic spreading was investigated, no factor seems to contribute to IBV dispersal velocity, being poultry population density the only exception. Finally, the different viral population pattern observed in the two companies over the same time period supports the pivotal role of management and control strategies on IBV epidemiology. Overall, the present study results stress the crucial relevance of human action rather than environmental factors, highlighting the direct benefits that could derive from improved management and organization of the poultry sector on a larger scale.

BACKGROUND: M. pneumoniae pneumonia (MP) has been reported in 10-40% of community-acquired pneumonia cases. We aimed to evaluate the difference of clinical features in children with MP, according to their age and chest radiographic patterns. METHODS: The diagnosis of MP was made by examinations at both admission and discharge and by two serologic tests: the indirect microparticle agglutinin assay (≥1:40) and the cold agglutinins titer (≥1:32). A total of 191 children with MP were grouped by age: ≤2 years of age (29 patients), 3-5 years of age (81 patients), and ≥6 years of age (81 patients). They were also grouped by pneumonia pattern: bronchopneumonia group (96 patients) and segmental/lobar pneumonia group (95 patients). RESULTS: Eighty-six patients (45%) were seroconverters, and the others showed increased antibody titers during hospitalization. Among the three age groups, the oldest children showed the longest duration of fever, highest C-reactive protein (CRP) values, and the most severe pneumonia pattern. The patients with segmental/lobar pneumonia were older and had longer fever duration and lower white blood cell (WBC) and lymphocyte counts, compared with those with bronchopneumonia. The patient group with the most severe pulmonary lesions had the most prolonged fever, highest CRP, highest rate of seroconverters, and lowest lymphocyte counts. Thrombocytosis was observed in 8% of patients at admission, but in 33% of patients at discharge. CONCLUSIONS: In MP, older children had more prolonged fever and more severe pulmonary lesions. The severity of pulmonary lesions was associated with the absence of diagnostic IgM antibodies at presentation and lymphocyte count. Short-term paired IgM serologic test may be mandatory for early and definitive diagnosis of MP.
OBJECTIVES: To provide an overview of the three major deadly coronaviruses and identify areas for improvement of future preparedness plans, as well as provide a critical assessment of the risk factors and actionable items for stopping their spread, utilizing lessons learned from the first two deadly coronavirus outbreaks, as well as initial reports from the current novel coronavirus (COVID-19) epidemic in Wuhan, China. METHODS: Utilizing the Centers for Disease Control and Prevention (CDC, USA) website, and a comprehensive review of PubMed literature, we obtained information regarding clinical signs and symptoms, treatment and diagnosis, transmission methods, protection methods and risk factors for Middle East Respiratory Syndrome (MERS), Severe Acute Respiratory Syndrome (SARS) and COVID-19. Comparisons between the viruses were made. RESULTS: Inadequate risk assessment regarding the urgency of the situation, and limited reporting on the virus within China has, in part, led to the rapid spread of COVID-19 throughout mainland China and into proximal and distant countries. Compared with SARS and MERS, COVID-19 has spread more rapidly, due in part to increased globalization and the focus of the epidemic. Wuhan, China is a large hub connecting the North, South, East and West of China via railways and a major international airport. The availability of connecting flights, the timing of the outbreak during the Chinese (Lunar) New Year, and the massive rail transit hub located in Wuhan has enabled the virus to perforate throughout China, and eventually, globally. CONCLUSIONS: We conclude that we did not learn from the two prior epidemics of coronavirus and were ill-prepared to deal with the challenges the COVID-19 epidemic has posed. Future research should attempt to address the uses and implications of internet of things (IoT) technologies for mapping the spread of infection.
BACKGROUND: The global epidemic of diabetes mellitus continues to grow and affects developed and developing countries alike. Intensive glycemic control is thought to modify the risks for vascular complications, hence the risks for diabetes-related death. We investigated the trend of diabetic vascular complication-related deaths between 2000 and 2016 in the global diabetes landscape. METHODS: We collected 17 years of death certificates data from 108 countries in the World Health Organization mortality database between 2000 and 2016, with coding for diabetic complications. Crude and age-standardized proportions and rates were calculated. Trend analysis was done with annual average percentage change (AAPC) of rates computed by joinpoint regression. RESULTS: From 2000 through 2016, 7,108,145 deaths of diabetes were reported in the 108 countries. Among them, 26.8% (1,904,787 cases) were attributed to vascular complications in damaged organs, including the kidneys (1,355,085 cases, 71.1%), peripheral circulatory (515,293 cases, 27.1%), nerves (28,697 cases, 1.5%) and eyes (5751 cases, 0.3%). Overall, the age-standardized proportion of vascular complication-related mortality was 267.8 [95% confidence interval (95% CI), 267.5–268.1] cases per 1000 deaths and the rate was 53.6 (95% CI 53.5–53.7) cases per 100,000 person-years. Throughout the 17-year period, the overall age-standardized proportions of deaths attributable to vascular complications had increased 37.9%, while the overall age-standardized mortality rates related to vascular complications had increased 30.8% (AAPC = 1.9% [1.4–2.4%, p < 0.05]). These increases were predominantly driven by a 159.8% increase in the rate (AAPC = 2.7% [1.2–4.3%, p < 0.05]) from renal complications. Trends in the rates and AAPC of deaths varied by type of diabetes and of complications, as well as by countries, regions and domestic income. CONCLUSION: Diabetic vascular complication-related deaths had increased substantially during 2000–2016, mainly driven by the increased mortality of renal complications.
BACKGROUND: Recently, three randomized clinical trials on coronavirus disease (COVID-19) treatments were completed: one for lopinavir-ritonavir and two for remdesivir. One trial reported that remdesivir was superior to placebo in shortening the time to recovery, while the other two showed no benefit of the treatment under investigation. OBJECTIVE: The aim of this paper is to, from a statistical perspective, identify several key issues in the design and analysis of three COVID-19 trials and reanalyze the data from the cumulative incidence curves in the three trials using more appropriate statistical methods. METHODS: The lopinavir-ritonavir trial enrolled 39 additional patients due to insignificant results after the sample size reached the planned number, which led to inflation of the type I error rate. The remdesivir trial of Wang et al failed to reach the planned sample size due to a lack of eligible patients, and the bootstrap method was used to predict the quantity of clinical interest conditionally and unconditionally if the trial had continued to reach the originally planned sample size. Moreover, we used a terminal (or cure) rate model and a model-free metric known as the restricted mean survival time or the restricted mean time to improvement (RMTI) to analyze the reconstructed data. The remdesivir trial of Beigel et al reported the median recovery time of the remdesivir and placebo groups, and the rate ratio for recovery, while both quantities depend on a particular time point representing local information. We use the restricted mean time to recovery (RMTR) as a global and robust measure for efficacy. RESULTS: For the lopinavir-ritonavir trial, with the increase of sample size from 160 to 199, the type I error rate was inflated from 0.05 to 0.071. The difference of RMTIs between the two groups evaluated at day 28 was –1.67 days (95% CI –3.62 to 0.28; P=.09) in favor of lopinavir-ritonavir but not statistically significant. For the remdesivir trial of Wang et al, the difference of RMTIs at day 28 was –0.89 days (95% CI –2.84 to 1.06; P=.37). The planned sample size was 453, yet only 236 patients were enrolled. The conditional prediction shows that the hazard ratio estimates would reach statistical significance if the target sample size had been maintained. For the remdesivir trial of Beigel et al, the difference of RMTRs between the remdesivir and placebo groups at day 30 was –2.7 days (95% CI –4.0 to –1.2; P<.001), confirming the superiority of remdesivir. The difference in the recovery time at the 25th percentile (95% CI –3 to 0; P=.65) was insignificant, while the differences became more statistically significant at larger percentiles. CONCLUSIONS: Based on the statistical issues and lessons learned from the recent three clinical trials on COVID-19 treatments, we suggest more appropriate approaches for the design and analysis of ongoing and future COVID-19 trials.
Prompt detection and effective control of porcine reproductive and respiratory syndrome virus (PRRSV) during outbreaks is important given its immense adverse impact on the swine industry. However, the diagnostic process can be challenging due to the high genetic diversity and high mutation rate of PRRSV. A diagnostic method that can provide more detailed genetic information about pathogens is urgently needed. In this study, we evaluated the ability of Oxford Nanopore MinION direct RNA sequencing to generate a PRRSV whole genome sequence and detect and discriminate virus at the strain-level. A nearly full length PRRSV genome was successfully generated from raw sequence reads, achieving an accuracy of 96% after consensus genome generation. Direct RNA sequencing reliably detected the PRRSV strain present with an accuracy of 99.9% using as few as 5 raw sequencing reads and successfully differentiated multiple co-infecting strains present in a sample. In addition, PRRSV strain information was obtained from clinical samples containing 10(4) to 10(6) viral copies or more within 6 hours of sequencing. Overall, direct viral RNA sequencing followed by bioinformatic analysis proves to be a promising approach for identification of the viral strain or strains involved in clinical infections, allowing for more precise prevention and control strategies during PRRSV outbreaks.
There is no effective drug to treat EV71 infection yet. Traditional Chinese herbs are great resources for novel antiviral compounds. Here we showed that Oblongifolin M (OM), an active compound isolated from Garcinia oblongifolia, potently inhibited EV71 infection in a dose dependent manner. To identify its potential effectors in the host cells, we successfully identified 18 proteins from 52 differentially expressed spots by comparative proteomics studies. Further studies showed that knockdown of ERp57 inhibited viral replication through downregulating viral IRES (internal ribosome entry site) activities, whereas ectopic expression of ERp57 increased IRES activity and partly rescued the inhibitory effects of OM on viral replication. We demonstrated that OM is an effective antiviral agent; and that ERp57 is one of its cellular effectors against EV71 infection.
Angiotensin-converting enzyme 2 (ACE2) is a recently described member of the renin-angiotensin system that hydrolyzes angiotensin (Ang) II to Ang-(1-7), and may thereby protect against cardiovascular and renal diseases. ACE2 is a type 1 integral membrane protein and contains a catalytically active ectodomain that can be shed from the cell surface into the extracellular space, via cleavage by a disintegrin and metalloproteinase-17 (ADAM-17). ACE2 enzymatic activity and protein can be detected in biological fluids, including urine, plasma, and conditioned cell culture media. We present a detailed method for measurement of ACE2 activity in biological fluids, using hydrolysis of an intramolecularly quenched fluorogenic ACE2 substrate, in the absence or presence of the ACE2 inhibitors MLN-4760 or DX600. Recombinant human or mouse ACE2 is used to generate standard curves for this assay, with ACE2 detection ranging from 1.56 to 50 ng/ml. While MLN-4760 potently inhibits the activity of both human and mouse ACE2, DX600 (linear form) only effectively blocks human ACE2 activity in this assay. In biological samples of human and mouse urine, cell culture medium from mouse proximal tubular cells, and mouse plasma, the mean intra- and inter-assay coefficients of variation (CVs) of the assay range from 1.43 to 4.39 %, and from 7.01 to 13.17 %, respectively. We present data on the time and substrate concentration dependence of the assay, and show that exogenous d -glucose, creatinine, urea, and albumin do not interfere with its performance. In biological fluids, this assay is a simple and reliable method to study the role of ACE2 and its shed fragments in cardiovascular and renal diseases.
Introduction Tandis que le pic épidémique du COVID-19 semble passé dans la majorité des pays européens, le nouveau challenge est d’évaluer l’immunité de la population à grande échelle. De nombreux tests sérologiques aux performances très variables sont proposés. Il est nécessaire et urgent d’en réaliser la validation qualitative afin de ne pas mésestimer la séroprévalence COVID-19. Nous proposons l’évaluation des performances du test de diagnostic rapide (TDR) Orient Gene (OG) COVID-19 IgG/IgM en comparaison au test ELISA-Abbott SARS-CoV-2 IgG immunoassay (ASIA). Matériels et méthodes Il s’agit d’un test immuno-chromatographique à flux latéral permettant l’obtention d’un résultat en 10minutes. Un total de 102 sérums provenant de patients ayant eu une RT-PCR SARS-CoV-2 positive ont été testé. Ces patients étaient asymptomatiques (n =2), présentaient des symptômes légers (n =37), des symptômes sévères nécessitant l’hospitalisation (n =35) ou ont dû être admis en réanimation (n =28). La spécificité a été évaluée à partir de 42 sérums provenant de patients présentant diverses pathologies virales (dont des coronavirus endémique), parasitaires ou avec un taux de facteur rhumatoïde élevé et prélevé en période pré-pandémique. Résultats La sensibilité de l’OG était de 95,8 % (IC95 %: 89,6–98,8) pour les échantillons collectés ≥10jours après le début des symptômes ce qui était équivalent à la sensibilité 90,5 % (IC95 %: 82,8–95,6) de l’ASIA. L’OG a permis de détecter 6 sérums négatifs en ASIA parmi lesquels 2 présentaient uniquement des IgM sur l’OG. Parmi les 7 sérums négatifs en l’OG, 3 avaient été prélevés moins de 10jours avant le début des symptômes et les 4 autres sérums provenaient de patients présentant des déficits immunitaires acquis pouvant expliquer la négativité du test malgré une PCR positive antérieure. La spécificité était de 100 % (IC95 %: 93,4–100) avec les deux tests. Conclusion Les caractéristiques de l’OG indique que ce TDR est approprié à une utilisation en routine au laboratoire avec une sensibilité équivalente à un test ELISA classique. Ce test s’adapte également à une utilisation ambulatoire en raison de sa facilité d’utilisation. L’évaluation de ce test sur un plus grand nombre de personnes asymptomatiques peut être nécessaire afin de confirmer nos résultats dans cette population.
Porcine astrovirus (PAstV) belongs to genetically divergent lineages within the genus Mamastrovirus. In this study, 25/129 (19.4 %) domestic pig and 1/146 (0.7 %) wild boar fecal samples tested in South Korea were positive for PAstV. Positive samples were mainly from pigs under 6 weeks old. Bayesian inference (BI) tree analysis for RNA-dependent RNA polymerase (RdRp) and capsid (ORF2) gene sequences, including Mamastrovirus and Avastrovirus, revealed a relatively geographically divergent lineage. The PAstVs of Hungary and America belong to lineage PAstV 4; those of Japan belong to PAstV 1; and those of Canada belong to PAstV 1, 2, 3, and 5, but not to 4. This study revealed that the PAstVs of Korea belong predominantly to lineage PAstV 4 and secondarily to PAstV 2. It was also observed that PAstV infections are widespread in South Korea regardless of the disease state in domestic pigs and in wild boars as well.

Twenty-seven field samples that showed positive in PEDV detection were collected from different farms of Fujian province from 2010 to 2012. Their heterogeneity was investigated by analysis of the ORF3 gene because of its potential function as a representation of virulence. According to the results, six Fujian strains in Group 1 showed a different genotype with unique point mutations, which might be used in differentiation between PEDV groups and brought potential antigenic variation. P55 and five reference strains in Group 2 had a long length deletion, showing another genotype and might be involved in the variation of virulence. Phylogenetic analysis revealed that the collected Fujian strains were very distant from the vaccine development strain CV777, which might be the reason why the vaccine was inefficient to control the disease. The results can help to reconsider the strategy of PEDV vaccine management and prevent outbreaks of PEDV-induced diarrhea more efficiently.
BACKGROUND: The data on the seasonality of respiratory viruses helps to ensure the optimal vaccination period and to monitor the possible outbreaks of variant type. OBJECTIVES: This study was designed to describe the molecular epidemiology and seasonality of acute respiratory infection (ARI)‐related respiratory viruses in the United Arab Emirates (UAE). METHODS: Both upper and lower respiratory specimens were collected for the analysis from all the patients who visited the Sheikh Khalifa Specialty Hospital (SKSH) with ARI for over 2 years. The multiplex real‐time reverse transcription polymerase chain reaction (rRT‐PCR) test was used to detect respiratory viruses, which include human adenovirus, influenza virus (FLU) A and B, respiratory syncytial virus, parainfluenza viruses, human rhinovirus (HRV), human metapneumovirus, human enterovirus, human coronavirus, and human bocavirus. RESULTS: A total of 1,362 respiratory samples were collected from 733 (53.8%) male and 629 (46.2%) female patients with ARI who visited the SKSH between November 2015 and February 2018. The rRT‐PCR test revealed an overall positivity rate of 37.2% (507/1362). The positive rate increased during winter; it was highest in December and lowest in September. FLU was the most frequently detected virus (273/1362 [20.0%]), followed by human rhinovirus (146/1362 [10.7%]). The FLU positivity rate showed two peaks, which occurred in August and December. The peak‐to‐low ratio for FLU was 2.26 (95% confidence interval: 1.52‐3.35). CONCLUSIONS: The pattern of FLU in the UAE parallels to that of temperate countries. The trend of the small peak of FLU in the summer suggests a possibility of semi‐seasonal pattern in the UAE.
Time is of the essence in evaluating potential drugs and biologics for the treatment and prevention of COVID‐19. There are currently 876 randomized clinical trials (phase 2 and 3) of treatments for COVID‐19 registered on clinicaltrials.gov. Covariate adjustment is a statistical analysis method with potential to improve precision and reduce the required sample size for a substantial number of these trials. Though covariate adjustment is recommended by the U.S. Food and Drug Administration and the European Medicines Agency, it is underutilized, especially for the types of outcomes (binary, ordinal and time‐to‐event) that are common in COVID‐19 trials. To demonstrate the potential value added by covariate adjustment in this context, we simulated two‐arm, randomized trials comparing a hypothetical COVID‐19 treatment versus standard of care, where the primary outcome is binary, ordinal, or time‐to‐event. Our simulated distributions are derived from two sources: longitudinal data on over 500 patients hospitalized at Weill Cornell Medicine New York Presbyterian Hospital, and a Centers for Disease Control and Prevention (CDC) preliminary description of 2449 cases. In simulated trials with sample sizes ranging from 100 to 1000 participants, we found substantial precision gains from using covariate adjustment–equivalent to 4–18% reductions in the required sample size to achieve a desired power. This was the case for a variety of estimands (targets of inference). From these simulations, we conclude that covariate adjustment is a low‐risk, high‐reward approach to streamlining COVID‐19 treatment trials. We provide an R package and practical recommendations for implementation. This article is protected by copyright. All rights reserved
Background Lifestyle factors including obesity and smoking are suggested to be related to increased risk of COVID-19 severe illness or related death. However, little is known about whether these relationships are causal, or the relationships between COVID-19 severe illness and other lifestyle factors, such as alcohol consumption and physical activity. Methods Genome-wide significant genetic variants associated with body mass index (BMI), lifetime smoking, alcohol consumption and physical activity identified by large-scale genome-wide association studies (GWAS) were selected as instrumental variables. GWAS summary statistics of these genetic variants for relevant lifestyle factors and severe illness of COVID-19 were obtained. Two-sample Mendelian randomization (MR) analyses were conducted. Results Both genetically predicted BMI and lifetime smoking were associated with about 2-fold increased risks of severe respiratory COVID-19 and COVID-19 hospitalization (all P<0.05). Genetically predicted physical activity was associated with about 5-fold (95% confidence interval [CI], 1.4, 20.3; P=0.02) decreased risk of severe respiratory COVID-19, but not with COVID-19 hospitalization, though the majority of the 95% CI did not include one. No evidence of association was found for genetically predicted alcohol consumption, but associations were found when using pleiotropy robust methods. Conclusion Evidence is found that BMI and smoking causally increase and physical activity causally decreases the risk of COVID-19 severe illness. This study highlights the importance of maintaining a healthy lifestyle in protecting from COVID-19 severe illness and its public health value in fighting against COVID-19 pandemic.
The natural reservoirs of influenza viruses are aquatic birds. After adaptation, avian viruses can acquire the ability to infect humans and cause severe disease. Because domestic poultry serves as a key link between the natural reservoir of influenza viruses and epidemics and pandemics in human populations, an effective measure to control influenza would be to eliminate or reduce influenza virus infection in domestic poultry. The development and distribution of influenza-resistant poultry represents a proactive strategy for controlling the origin of influenza epidemics and pandemics in both poultry and human populations. Recent developments in RNA interference and transgenesis in birds should facilitate the development of influenza-resistant poultry.
The incubation period and generation time are key characteristics in the analysis of infectious diseases. The commonly used contact‐tracing based estimation of incubation distribution is highly influenced by the individuals' judgment on the possible date of exposure, and might lead to significant errors. On the other hand, interval censoring based methods are able to utilize a much larger set of traveling data but may encounter biased sampling problems. The distribution of generation time is usually approximated by observed serial intervals. However, it may result in a biased estimation of generation time, especially when the disease is infectious during incubation. In this paper, the theory from renewal process is partially adopted by considering the incubation period as the inter‐arrival time, and the duration between departure from Wuhan and onset of symptoms as the mixture of forward time and inter‐arrival time with censored intervals. In addition, a consistent estimator for the distribution of generation time based on incubation period and serial interval is proposed for incubation‐infectious diseases. A real case application to the current outbreak of COVID‐19 is implemented. We find that the incubation period has a median of 8.50 days (95% CI: 7.22, 9.15). The basic reproduction number in the early phase of COVID‐19 outbreak based on the proposed generation time estimation is estimated to be 2.96 (95% CI: 2.15, 3.86). This article is protected by copyright. All rights reserved
In this study, we reported for the first time the existence of complemented palindrome small RNAs (cpsRNAs) and proposed cpsRNAs and palindrome small RNAs (psRNAs) as a novel class of small RNAs. The first discovered cpsRNA UCUUUAACAAGCUUGUUAAAGA from SARS coronavirus named SARS-CoV-cpsR-22 contained 22 nucleotides perfectly matching its reverse complementary sequence. Further sequence analysis supported that SARS-CoV-cpsR-22 originated from bat betacoronavirus. The results of RNAi experiments showed that one 19-nt segment of SARS-CoV-cpsR-22 significantly induced cell apoptosis. These results suggested that SARS-CoV-cpsR-22 could play a role in SARS-CoV infection or pathogenicity. The discovery of psRNAs and cpsRNAs paved the way to find new markers for pathogen detection and reveal the mechanisms in the infection or pathogenicity from a different point of view. The discovery of psRNAs and cpsRNAs also broaden the understanding of palindrome motifs in animal of plant genomes.
Treatments targeting the Ebola virus may eventually be shown to work, but they will not have an impact on overall Ebola mortality in West Africa. Endothelial dysfunction is responsible for the fluid and electrolyte imbalances seen in Ebola patients. Because inexpensive generic statins and angiotensin receptor blockers restore endothelial barrier integrity, they can be used to treat the host response in these patients. In Sierra Leone, approximately 100 Ebola patients were treated with this combination, and reports indicate that survival was greatly improved.
[Figure: see text]
BACKGROUND: Waste collection is a common practice in Vietnam. In general, the working and living conditions of waste collectors are poor. Thus, they might be exposed to occupational and environmental risk factors, which affect their health or could further exacerbate their health vulnerabilities. Moreover, they have difficulties to access to health services. OBJECTIVE: The aim of this study was to understand factors affecting the access to health services among waste collectors in Hanoi, Vietnam. METHODS: The qualitative design was used for this study. A total of 30 in-depth interviews with waste collectors and 3 focused group discussions were conducted in Hanoi, Vietnam in 2017. RESULTS: Findings showed the participants considered factors that affect the access to health services among waste collectors such as geographical accessibility, the availability of health facilities, the acceptance of the quality of health services, health insurance, and affordability. CONCLUSIONS: Policy makers concerned with public health and social work need to have the suitable policies in order to promote actions on the access to health services among waste collectors.
Since December 2019, the COVID‐19 (1) has spread throughout the world at a staggering speed. As of March 30, 2020, the confirmed case number has reached 693,224 globally and the COVID‐19 has claimed 33,106 lives(2). Current researches emphasize on understanding of transmission patterns, severity, clinical features, and risk factors for infection, but the data remain limited.
There is broad agreement that current food systems are not on a sustainable trajectory that will enable us to reach the Sustainable Development Goals by 2030, particularly in the face of anthropogenic climate change. Guided by a consideration of some food system reconfigurations in the past, we outline an agenda of work around four action areas: rerouting old systems into new trajectories; reducing risks; minimising the environmental footprint of food systems; and realigning the enablers of change needed to make new food systems function. Here we highlight food systems levers that, along with activities within these four action areas, may shift food systems towards more sustainable, inclusive, healthy and climate-resilient futures. These actions, summarised here, are presented in extended form in a report of an international initiative involving hundreds of stakeholders for reconfiguring food systems.
In this month’s editorial, the PLOS Medicine Editors propose ideal qualities for the World Health Organization's next Director General, for whom the selection process is now underway.
This study examines how experience of severe acute respiratory syndrome (SARS) influences the impact of coronavirus disease (COVID-19) on international tourism demand for four Asia-Pacific Economic Cooperation (APEC) economies, Taiwan, Hong Kong, Thailand, and New Zealand, over the 1 January–30 April 2020 period. To proceed, panel regression models are first applied with a time-lag effect to estimate the general effects of COVID-19 on daily tourist arrivals. In turn, the data set is decomposed into two nation groups and fixed effects models are employed for addressing the comparison of the pandemic-tourism relationship between economies with and without experiences of the SARS epidemic. Specifically, Taiwan and Hong Kong are grouped as economies with SARS experiences, while Thailand and New Zealand are grouped as countries without experiences of SARS. The estimation result indicates that the number of confirmed COVID-19 cases has a significant negative impact on tourism demand, in which a 1% COVID-19 case increase causes a 0.075% decline in tourist arrivals, which is a decline of approximately 110 arrivals for every additional person infected by the coronavirus. The negative impact of COVID-19 on tourist arrivals for Thailand and New Zealand is found much stronger than for Taiwan and Hong Kong. In particular, the number of tourist arrivals to Taiwan and Hong Kong decreased by 0.034% in response to a 1% increase in COVID-19 confirmed cases, while in Thailand and New Zealand, a 1% national confirmed cases increase caused a 0.103% reduction in tourism demand. Moreover, the effect of the number of domestic cases on international tourism is found lower than the effect caused by global COVID-19 mortality for the economies with SARS experiences. In contrast, tourist arrivals are majorly affected by the number of confirmed COVID-19 cases in Thailand and New Zealand. Finally, travel restriction in all cases is found to be the most influencing factor for the number of tourist arrivals. Besides contributing to the existing literature focusing on the knowledge regarding the nexus between tourism and COVID-19, the paper’s findings also highlight the importance of risk perception and the need of transmission prevention and control of the epidemic for the tourism sector.
The coronavirus disease 2019 (COVID‐19) pandemic witnessed several clusters of children with fever and multisystem inflammation resembling Kawasaki disease (KD). Due to the evidence of a preceding severe acute respiratory syndrome coronavirus 2 (SARS‐CoV‐2) infection in most of these patients, post‐viral immunological reactions were thought to play an important role in the pathogenesis.(1,2) The condition, called “pediatric inflammatory multisystem syndrome temporally associated with SARS‐CoV‐2 infection (PIMS‐TS)”, has thus far been reported mainly from Europe and the United States,(1,2) and no cases have been diagnosed in Asia. We herein analyzed the clinical data on patients in whom KD was diagnosed during a local COVID‐19 epidemic to investigate the relationship between KD and SARS‐CoV‐2 infections in Japan, which has the highest KD incidence in the world.

Chloroquine is a 4-aminoquinoline previously used in malaria therapy and now becoming an emerging investigational antiviral drug due to its broad spectrum of antiviral activities. To explore whether the low pH-dependency of influenza A viruses might affect the antiviral effects of chloroquine at clinically achievable concentrations, we tested the antiviral effects of this drug on selected human and avian viruses belonging to different subtypes and displaying different pH requirements. Results showed a correlation between the responses to chloroquine and NH(4)Cl, a lysosomotropic agent known to increase the pH of intracellular vesicles. Time-of-addition experiments showed that the inhibitory effect of chloroquine was maximal when the drug had been added at the time of infection and was lost after 2 h post-infection. This timing approximately corresponds to that of virus/cell fusion. Moreover, there was a clear correlation between the EC(50 )of chloroquine in vitro and the electrostatic potential of the HA subunit (HA2) mediating the virus/cell fusion process. Overall, the present study highlights the critical importance of a host cell factor such as intravesicular pH in determining the anti-influenza activity of chloroquine and other lysosomotropic agents.
Abstract Background The response to the global SARS-CoV-2 pandemic culminated in mandatory isolation throughout the world, with nation-wide confinement orders issued to decrease viral spread. These drastic measures were successful in “flattening the curve” and maintaining the prior rate of COVID-19 infections and deaths. To date, the effects of the COVID-19 pandemic on neuro-trauma has not been reported. Methods We retrospectively analyzed hospital admissions from Ryder Trauma Center at Jackson Memorial Hospital, during the months of March and April from 2016-2020. Specifically, we identified all patients who had cranial neuro trauma consisting of traumatic brain injury (TBI) and/or skull fractures, as well as spinal neuro trauma consisting of vertebral fractures and/or spinal cord injury (SCI). We then performed chart review to determine mechanism of injury and if emergent surgical intervention was required. Results Compared to previous years, we saw a significant decline in the number of neuro-traumas during the pandemic, with a 62% decline after the lockdown began. The number of emergent neuro-trauma surgical cases also significantly decreased by 84% in the month of April. Interestingly, while the number of vehicular traumas decreased by 77%, there was a significant 100% increase in the number of gunshot wounds. Conclusions Population seclusion had a direct effect on the frequency of neuro-trauma, while the change in relative proportion of certain mechanisms may be associated with the psychosocial effects of social distancing and quarantine.
As the Severe Acute Respiratory Syndrome Coronavirus 2 (SARS-CoV-2) pandemic continues to expand, healthcare resources globally have been spread thin. Now, the disease is rapidly spreading across South America, with deadly consequences in areas with already weakened public health systems. The Amazon region is particularly susceptible to the widespread devastation from Coronavirus disease 2019 (COVID-19) because of its immunologically fragile native Amerindian inhabitants and epidemiologic vulnerabilities. Herein, we discuss the current situation and potential impact of COVID-19 in the Amazon region and how further spread of the epidemic wave could prove devastating for many Amerindian people living in the Amazon rainforest.
Severe acute respiratory syndrome (SARS) coronavirus (CoV) contains a spike (S) protein that binds to a receptor molecule (angiotensin-converting enzyme 2; ACE2), induces membrane fusion, and serves as a neutralizing epitope. To study the functions of the S protein, we describe here the generation of SARS-CoV S protein-bearing vesicular stomatitis virus (VSV) pseudotype using a VSV∆G∗/GFP system in which the G gene is replaced by the green fluorescent protein (GFP) gene (VSV-SARS-CoV-St19/GFP). Partial deletion of the cytoplasmic domain of SARS-CoV S protein (SARS-CoV-St19) allowed efficient incorporation into the VSV particle that enabled the generation of a high titer of pseudotype virus. Neutralization assay with anti-SARS-CoV antibody revealed that VSV-SARS-St19/GFP pseudotype infection is mediated by SARS-CoV S protein. The VSV∆G∗/SEAP system, which secretes alkaline phosphatase instead of GFP, was also generated as a VSV pseudotype having SARS-CoV S protein (VSV-SARS-CoV-St19/SEAP). This system enabled high-throughput analysis of SARS-CoV S protein-mediated cell entry by measuring alkaline phosphatase activity. Thus, VSV pseudotyped with SARS-CoV S protein is useful for developing a rapid detection system for neutralizing antibody specific for SARS-CoV infection as well as studying the S-mediated cell entry of SARS-CoV.
With the outbreak of COVID-19, maintaining the healthcare system is a crucial issue. In Japan, the number of COVID-19 cases is increasing rapidly day by day with a risk of overshooting initial estimations (WHO, 2020a). Public health nurses (PHNs) working in public health centers in prefectures and designated centers in cities or core cities, play a critical role in controlling COVID-19 (Yoshioka-Maeda, Honda, Iwasaki-Motegi, 2020). Providing care for COVID-19 patients, their families, and the community, the workload of PHNs has been reaching the maximum limit.
Some diseases can be cured by medical interventions, others not. When not, are there other approaches to control or cure? One possibility is to try to publish a disease to death, a therapy strategy first proposed by my late colleague Prof. David Golde from UCLA (see below). Here I consider whether this strategy is working in the fight against severe acute respiratory syndrome‐cornavirsu‐2 (SARS‐CoV‐2) pandemic and the associated coronavirus infectious disease‐2019 (COVID‐19).
[Figure: see text]
The SARS-CoV-2 spike employs mobile receptor-binding domains (RBDs) to engage the human ACE2 receptor and to facilitate virus entry, which can occur through low pH-endosomal pathways. To understand how ACE2 binding and low pH impact spike conformation, we determined cryo-EM structures –at serological and endosomal pH– delineating spike recognition of up to three ACE2 molecules. RBDs freely adopted ‘up’ conformations required for ACE2 interaction, primarily through RBD movement combined with smaller alterations in neighboring domains. In the absence of ACE2, cryo-EM structures revealed single-RBD-up conformations to dominate at pH 5.5, resolving into a solitary all-down conformation at lower pH. Notably, a pH-dependent refolding region (residues 824-858) at the spike-interdomain interface displayed dramatic structural rearrangements and mediated RBD positioning through coordinated movements of the entire trimer apex. These findings provide insight into how receptor interactions and endosomal pH alter RBD positioning and potentially facilitate immune evasion from RBD-up binding antibody.

Official estimates of the prevalence of foodborne disease are highly biased, failing to account for underdiagnosis and underreporting of laboratory-confirmed clinical disease in people. To overcome the biases inherent in routine surveillance there has been a burgeoning in methods used to assess the prevalence of foodborne disease in Europe. These show that prevalence of foodborne illness across Europe is very high no matter what method is used to measure it. Salmonella and Campylobacter are consistently found to be the leading foodborne pathogens in Europe.
Since the detection of COVID-19 in December 2019, the rapid spread of the disease worldwide has led to a new pandemic, with the number of infected individuals and deaths rising daily. Early experience shows that it predominantly affects older age groups with children and young adults being generally more resilient to more severe disease (1–3). From a health standpoint, children and young people are less directly affected than adults and presentation of the disease has shown different characteristics. Nonetheless, COVID-19 has had severe repercussions on children and young people. These indirect, downstream implications should not be ignored. An understanding of the issues is essential for those who hope to advocate effectively for children to prevent irreversible damage to the adults of the future. This article reviews some of the evidence of harm to children that may accrue indirectly as a result of pandemics. It explores the physical and psychological effects, discusses the role of parenting and education, offering practical advice about how best to provide support as a health care professional.
OBJECTIVES: To investigate whether the transient reduction in rheumatology services imposed by virus containment measures during the COVID-19 pandemic was associated with disease worsening in axial spondyloarthritis (axSpA), rheumatoid arthritis (RA) or psoriatic arthritis (PsA). METHODS: Patient-reported disease activity assessed during face-to-face visits and/or via a smartphone application were compared between three periods of each 2 months duration (before, during and after the COVID-19-wave) from January to June 2020 in 666 patients with axSpA, RA and PsA in the Swiss Clinical Quality Management cohort. RESULTS: The number of consultations dropped by 52%, whereas the number of remote assessments increased by 129%. The proportion of patients with drug non-compliance slightly increased during the pandemic, the difference reaching statistical significance in axSpA (19.9% vs 13.2% before the pandemic, p=0.003). The proportion of patients with disease flares remained stable (<15%). There was no increase in mean values of the Bath Ankylosing Disease Activity Index, the Rheumatoid Arthritis Disease Activity Index-5 and the Patient Global Assessment in patients with axSpA, RA and PsA, respectively. CONCLUSION: A short interruption of in-person patient–rheumatologist interactions had no major detrimental impact on the disease course of axSpA, RA and PsA as assessed by patient-reported outcomes.
This introductory chapter starts by reviewing worrying warming patterns that have been recently worsened by positive-feedback vicious cycles. These patterns suggest that the rate of global warming will be faster than projected in the recent IPCC special report. The deep adaptation agenda is discussed. Some studies concerning the social impacts of heat waves, considered to be the most important and dangerous hazards related to the current climate emergency, combined with urban heat islands, are reviewed. An expanded outline of the book is also included.
In the current COVID-19 pandemic, tremendous pressure is been exerted on the existing health infrastructure of many developing nations. Limb salvage surgeries in bone and soft tissue sarcomas cannot be delayed beyond a certain time-period and constitute an orthopaedic emergency in certain situations. Evaluation of intra-operative surgical margins forms an important step especially in cases with planned close margins or intercalary resections. Techniques such as imprint cytology can be preferred over frozen sections for evaluation of the surgical margins especially in COVID-19 positive patients. The advantages it offers such as completion of the procedure within the operation room complex, no generation of aerosols, and almost equal sensitivity and specificity when compared with frozen section method do warrant a modification of current surgical practice in the current health crisis especially in resource-constrained nations. Awareness and better communication regarding the same from the pathologist to the surgical team will go a long way in conserving resources and avoid unnecessary exposure to potentially infected aerosols.
Utilizing the WHO COVID-19 pandemic statement, we test Bitcoin and Ethereum as safe-havens for stocks. We find that the two largest cryptocurrencies are suitable as short-term safe-havens. The DCC and cDCC results show that their daily returns tend to correlate with S&P500 return negatively during the pandemic. The regression results also robustly support the safe-haven features and uncover that Ethereum is possibly a better safe-haven than Bitcoin. However, we note that both coins exhibit high volatilities. Before (during) the pandemic daily volatilities of Bitcoin, Ethereum, gold, and the S&P500 are 3.44% (9.11%), 4.34% (10.96%), 0.89% (2.19%), and 1.27% (6.07%), respectively.
BACKGROUND: New York City has a heterogeneous population with many undocumented and uninsured immigrants from equatorial areas who have a higher incidence of ocular surface squamous neoplasia. To the best of our knowledge, this is the first documented selection of this cost-effective treatment of ocular surface squamous neoplasia (the use of absolute ethanol along the corneal margin, primary excision, double freeze-thaw cryopexy, and primary conjunctival closure) for an undocumented and uninsured New York City patient. CASE PRESENTATION: A 35-year-old man from Ecuador presented to a New York City emergency department due to worsening discomfort of a long-standing left eye pterygium. A slit-lamp examination of the left eye demonstrated a nasally located conjunctival mass measuring 6 × 8 mm extending onto the cornea (3 mm superiorly and 6 mm inferiorly on the cornea). Histological diagnosis confirmed squamous cell carcinoma in situ arising from the pterygium. Surgical excision with adjunctive absolute alcohol with additive double freeze-thaw cryopexy was performed. Our patient has remained free of tumor recurrence at year 2 postoperative visit. CONCLUSIONS: Our case highlights the need to choose a cost-effective treatment for ocular surface squamous neoplasia in an at-risk population among undocumented and uninsured patients. Areas in the world with similar types of populations or treatment challenges may need to consider this approach as a primary treatment option.

According to the United Nations, about 1 billion persons live in so-called slums. Numerous studies have shown that this population is particularly vulnerable to infectious diseases. The current COVID-19 pandemic, caused by the novel coronavirus SARS-CoV-2, emphatically underlines this problem. The often high-density living quarters coupled with a large number of persons per dwelling and the lack of adequate sanitation are reasons why measures to contain the pandemic only work to a limited extent in slums. Furthermore, assignment to risk groups for severe courses of COVID-19 caused by noncommunicable diseases (eg, cardiovascular diseases) is not possible due to inadequate data availability. Information on people living in slums and their health status is either unavailable or only exists for specific regions (eg, Nairobi). We argue that one of the greatest problems with regard to the COVID-19 pandemic in the context of slums in the Global South is the lack of data on the number of people, their living conditions, and their health status.
We studied by questionnaire 530 subjects with chronic myeloid leukaemia (CML) in Hubei Province during the recent SARS-CoV-2 epidemic. Five developed confirmed (N = 4) or probable COVID-19 (N = 1). Prevalence of COVID-19 in our subjects, 0.9% (95% Confidence Interval, 0.1, 1.8%) was ninefold higher than 0.1% (0, 0.12%) reported in normals but lower than 10% (6, 17%) reported in hospitalised persons with other haematological cancers or normal health-care providers, 7% (4, 12%). Co-variates associated with an increased risk of developing COVID-19 amongst persons with CML were exposure to someone infected with SARS-CoV-2 (P = 0.037), no complete haematologic response (P = 0.003) and co-morbidity(ies) (P = 0.024). There was also an increased risk of developing COVID-19 in subjects in advanced phase CML (P = 0.004) even when they achieved a complete cytogenetic response or major molecular response at the time of exposure to SARS-CoV-2. 1 of 21 subjects receiving 3rd generation tyrosine kinase-inhibitor (TKI) developed COVID-19 versus 3 of 346 subjects receiving imatinib versus 0 of 162 subjects receiving 2nd generation TKIs (P = 0.096). Other co-variates such as age and TKI-therapy duration were not significantly associated with an increased risk of developing COVID-19. Persons with these risk factors may benefit from increased surveillance of SARS-CoV-2 infection and possible protective isolation.
BACKGROUND: The epidemiological evidence on the association of sleep quality on anxiety symptoms has been inconclusive. This study aimed to explore the association between sleep quality and anxiety symptoms in rural Chinese population and investigate whether age, lifestyles, and chronic diseases modified this association. METHODS: A total of 27,911 participants aged 18–79 years from the Henan Rural Cohort Study were included in the study. Sleep quality was assessed using the Pittsburgh Sleep Quality Index (PSQI) scale. Poor sleep quality was defined as PSQI ≥6. Anxiety symptoms were evaluated with the two-item generalized anxiety disorder scale (GAD-2). Individual with score ≥ 3 was viewed as having anxiety symptoms. Logistic regression and restricted cubic spline were conducted to examine the association of sleep quality with anxiety symptoms. RESULTS: Altogether, 6087 (21.80%) participants were poor sleepers and 1557 (5.58%) had anxiety symptoms. The odds of anxiety were increased with increment of PSQI score after fitting restricted cubic splines. The poor sleep quality was associated with a higher possibility of anxiety symptoms [odd ratio (OR): 4.60, 95% confidence interval (CI): 3.70–5.72] in men, and (OR: 3.56, 95% CI: 3.10–4.09) in women for multivariable analysis. Further, stratified analyses showed that the effect of sleep quality on anxiety symptoms could be modified by age, marital status, smoking status, drinking status, hypertension, and type 2 diabetes mellitus. CONCLUSIONS: A dose-response association between PSQI score and anxiety symptoms was found. In addition, the relationship between poor sleep quality and greater anxiety symptoms was observed in this rural population, especially in participants aged ≥60 years and those with unhealthy habits or had a chronic disease. TRIAL REGISTRATION: The trial was prospectively registered on July 6, 2015 and available online at ClinicalTrials.gov ID: ChiCTR-OOC-15006699.
Enabling innovation and access to health technologies remains a key strategy in combating infectious diseases in low- and middle-income countries (LMICs). However, a gulf between paying markets and the endemicity of such diseases has contributed to the dearth of R&D in meeting these public health needs. While the pharmaceutical industry views emerging economies as potential new markets, most of the world’s poorest bottom billion now reside in middle-income countries--a fact that has complicated tiered access arrangements. However, product development partnerships--particularly those involving academic institutions and small firms--find commercial opportunities in pursuing even neglected diseases; and a growing pharmaceutical sector in BRICS countries offers hope for an indigenous base of innovation. Such innovation will be shaped by 1) access to building blocks of knowledge; 2) strategic use of intellectual property and innovative financing to meet public health goals; 3) collaborative norms of open innovation; and 4) alternative business models, some with a double bottom line. Facing such resource constraints, LMICs are poised to develop a new, more resource-effective model of innovation that holds exciting promise in meeting the needs of global health. ELECTRONIC SUPPLEMENTARY MATERIAL: The online version of this article (doi:10.1186/2049-9957-1-2) contains supplementary material, which is available to authorized users.
The nucleocapsid (N) protein of SARS-COV-2, a virus responsible for the current COVID-19 pandemic, is considered a potential candidate for the design of new drugs and vaccines. The protein is central to several critical events in virus production, with its highly druggable nature and rich antigenic determinants making it an excellent anti-viral biomolecule. Docking-based virtual screening using the Asinex anti-viral library identified binding of drug molecules at three specific positions: loop 1 region, loop 2 region and β-sheet core pockets, the loop 2 region being the most common binding and stable site for the bulk of the molecules. In parallel, the protein was characterized by vaccine design perspective and harboured three potential B cell-derived T cell epitopes: PINTNSSPD, GVPINTNSS, and DHIGTRNPA. The epitopes are highly antigenic, virulent, non-allergic, non-toxic, bind with good affinity to the highly prevalent DRB*0101 allele and show an average population coverage of 95.04%. A multi-epitope vaccine ensemble which was 83 amino acids long was created. This was highly immunogenic, robust in generating both humoral and cellular immune responses, thermally stable, and had good physicochemical properties that could be easily analyzed in in vivo and in vitro studies. Conformational dynamics of both drug and vaccine ensemble with respect to the receptors are energetically stable, shedding light on favourable conformation and chemical interactions. These facts were validated by subjecting the complexes to relative and absolute binding free energy methods of MMGB/PBSA and WaterSwap. A strong agreement on the system stability was disclosed that supported ligand high affinity potential for the receptors. Collectively, this work sought to provide preliminary experimental data of existing anti-viral drugs as a possible therapy for COVID-19 infections and a new peptide-based vaccine for protection against this pandemic virus.

BACKGROUND: Recent epidemiological data indicate that there may be a gender predisposition to COVID‐19, with men predisposed to being most severely affected, and older men accounting for most deaths. OBJECTIVES: Provide a review of the research literature, propose hypotheses and therapies based on the potential link between testosterone (T) and COVID‐19 induced mortality in elderly men. MATERIALS AND METHODS: A search of publications in academic electronic databases, and government and public health organization web sites on T, aging, inflammation, severe acute respiratory syndrome (SARS) due to coronavirus (CoV) 2 (SARS‐CoV‐2) infection, and COVID‐19 disease state and outcomes was performed. RESULTS: The link between T, the immune system and male aging is well‐established, as is the progressive decline in T levels with aging. In women, T levels drop before menopause and variably increase with advanced age. Elevated IL‐6 is a characteristic biomarker of patients infected with COVID‐19 and has been linked to the development of the acute respiratory distress syndrome (ARDS). Thus far, half of the admitted COVID‐19 patients developed ARDS, half of these patients died, and elderly male patients have been more likely to develop ARDS and die. Low T is associated with ARDS. These data suggest that low T levels may exacerbate the severity of COVID‐19 infection in elderly men. It may also stand to reason that normal T levels may offer some protection against COVID‐19. SARS‐CoV‐2 binds to the angiotensin‐converting enzyme 2, present in high levels in the testis. CONCLUSION: At present, it is not known whether low T levels in aging hypogonadal males create a permissive environment for severe responses to COVID‐19 infection or if the virus inhibits androgen formation. Given the preponderance of COVID‐19 related mortality in elderly males, additional testing for gonadal function and treatment with T may be merited.
: This article highlights recent guidance from the National Institute for Health and Care Excellence (NICE). It provides an overview of the COVID-19 rapid guidance produced since March 2020, along with an account of how the organization adapted during the pandemic, developing resources to guide practice with the limited time and evidence available. The growing COVID-19 evidence base is also considered, with reference to international initiatives supporting production of the best possible information to guide the global pandemic response. WHAT’S NEW? Since March 2020, the NICE has developed 21 rapid guidelines with NHS England and NHS Improvement (NHSE&I) and a cross-speciality clinical group, supported by specialist societies and royal colleges. The 21 guidelines can be summarized into three groups—managing symptoms and complications, managing conditions that increase risk, and providing services during the pandemic. The rapid guidelines are part of a suite of rapid resources, including innovative technology briefings, shared learning examples and rapid evidence summaries, such as that for Vitamin D in COVID-19 (ES28).
Nipah virus (NiV) and Hendra virus (HeV) are zoonotic henipaviruses (HNVs) responsible for outbreaks of encephalitis and respiratory illness with fatality rates of 50–100%. No vaccines or licensed therapeutics currently exist to protect humans against NiV or HeV. HNVs enter host cells by fusing the viral and cellular membranes via the concerted action of the attachment (G) and fusion (F) glycoproteins, the main targets of the humoral immune response. Here, we describe the isolation and humanization of a potent monoclonal antibody cross-neutralizing NiV and HeV. Cryo-electron microscopy, triggering and fusion studies show the antibody binds to a prefusion-specific quaternary epitope, conserved in NiV F and HeV F glycoproteins, and prevents membrane fusion and viral entry. This work supports the importance of the HNV prefusion F conformation for eliciting a robust immune response and paves the way for using this antibody for prophylaxis and post-exposure therapy with NiV- and HeV-infected individuals.
Abstract: Development of nanoparticles for drug delivery has progressed by leaps and bounds over the last few decades, facilitating the possibility of an efficacious therapy for some fatal diseases. This development has stemmed from either the unsuitable physicochemical characteristics of the existing drug molecules, such as limited solubility and hence poor bioavailability, or the inadequacy of the conventional delivery systems to provide safe and efficient delivery. This chapter focuses on the precise need for the development of these novel nanoparticulate drug carriers and reasons for their popularity with the drug delivery scientists. The text also discusses the various strategies, including different formulation and targeting approaches, which have been adopted to overcome the challenges presented by the inherent properties of the drug molecules. Examples of nanoparticulate drug delivery systems which have already gained market approval have been cited in the discussion, wherever applicable.
This paper shows the modeling and performance in deep learning computation for an Assistant Conversational Agent (Chatbot). The utilization of Tensorflow software library, particularly Neural Machine Translation (NMT) model. Acquiring knowledge for modeling is one of the most important task and quite difficult to preprocess it. The Bidirectional Recurrent Neural Networks (BRNN) containing attention layers is used, so that input sentence with large number of tokens (or sentences with more than 20–40 words) can be replied with more appropriate conversation. The dataset used in the paper for training of model is used from Reddit. The model is developed to perform English to English translation. The main purpose of this work is to increase the perplexity and learning rate of the model and find Bleu Score for translation in same language. The experiments are conducted using Tensorflow using python 3.6. The perplexity, leaning rate, Bleu score and Average time per 1000 steps are 56.10, 0.0001, 30.16 and 4.5 respectively. One epoch is completed at 23,000 steps. The paper also study MacBook Air as a system for neural network and deep learning.

Spatial inequities are deeply embedded in low-carbon energy transition processes. As a result, new forms of contestation are emerging that reveal social inequalities at the heart of community-led responses to climate change. This paper uses four tenets of energy justice – distributional, procedural, restorative and recognition justice – to critically analyse and understand the politics and geography of local renewable energy deployment in Bristol, England. Focusing on the development of two solar PV farms in and around Lawrence Weston, an area of high deprivation in North West Bristol, the paper demonstrates the critical nature of instances of both energy justice and injustice in a time of austerity. Using primary data obtained via a Participatory Action Research (PAR) approach in Bristol during 2015–2017, the paper draws on participant observation data and in-depth interviews (n = 10) with a variety of local energy actors and community members active in Lawrence Weston. The primary data details the extent to which spatial configurations of new low-carbon energy infrastructures are integral to their justice implications. Indeed, it is the proximity of projects both close to and within the Lawrence Weston community that shapes the participant’s thoughts and deliberations on how to achieve local energy justice, through appeal to the four tenets outlined. The findings emphasise the distributional justice impacts of creating new low-carbon energy infrastructures in deprived communities in a time of austerity, whilst also noting that ‘opening up’ local energy transitions to greater input from local communities’ offers opportunities to achieve procedural justice. Shifting relationships between local energy actors and Lawrence Weston highlight opportunities for the remediation of past claims of injustice, facilitating processes of restorative justice, whilst local energy schemes that seek to advance greater ‘active participant’ (skills training & employment) opportunities for deprived communities in which they, or their projects, are embedded, may be underpinned by recognition justice concerns. This ‘active participant’ approach is shown to be key to advancing beyond ‘passive recipient’ approaches to community energy transitions and enhancing spatial equity. Finally, the paper offers novel empirical insights into the contested role of geography, space and place in local transitions and contributes to bottom-up perspectives on issues of spatial (in)justice in community energy schemes.
Inequalities are prevalent across the spectrum of cancer research and patient care, with destructive repercussions for people and society. We cannot ignore them and must act against the social injustices that perpetuate them.
OBJECTIVE: To investigate the long-term effects of mild H1N1 influenza infection on the pulmonary function of a cohort of patients. METHODS: Forty-eight patients, all diagnosed with influenza A virus subtype H1N1 in 2009, were retrospectively included in this study. Each patient in the study was monitored for 11-13 months by standard pulmonary function examination. The examination included monitoring respiratory tract infection symptoms (cough, expectoration or gasping) and vital signs. Long-term changes in symptoms and changes in vital signs were correlated back to and compared with the severity of the initial H1N1 influenza infection. RESULTS: One year post discharge, mild to moderate pulmonary dysfunction was observed in the majority of patients. Further, 54.2% of patients had signs of severe abnormal pulmonary function, including diffusion disorder (33.3%) and small airway dysfunction (33.3%). Fourteen patients presented with respiratory tract infection symptoms; 12 with abnormal pulmonary function and two with normal pulmonary function. Our results indicated that the change in pulmonary function at one year post discharge was not significantly correlated with the severity of H1N1 influenza. CONCLUSION: Signs and symptoms of abnormal pulmonary function accompanied by respiratory tract infection symptoms remain for some patients after one year following discharge from the hospital for mild influenza A virus subtype H1N1 infection. These patients should continue to be monitored for any changes in condition and symptoms and rehabilitation treatment should be provided when necessary.

Drug development is one of the most significant processes in the pharmaceutical industry. Various computational methods have dramatically reduced the time and cost of drug discovery. In this review, we firstly discussed roles of multiscale biomolecular simulations in identifying drug binding sites on the target macromolecule and elucidating drug action mechanisms. Then, virtual screening methods (e.g., molecular docking, pharmacophore modeling, and QSAR) as well as structure- and ligand-based classical/de novo drug design were introduced and discussed. Last, we explored the development of machine learning methods and their applications in aforementioned computational methods to speed up the drug discovery process. Also, several application examples of combining various methods was discussed. A combination of different methods to jointly solve the tough problem at different scales and dimensions will be an inevitable trend in drug screening and design.
In light of water quality monitoring paradigms shifting to a more holistic approach, it is essential that environmental microbiologists embrace new methodological developments in clinical virology to create rapid, laboratory‐free methods for the identification of wastewater pollution. It is widely accepted that routine monitoring of fecal indicator bacteria (FIB) does not adequately reflect human health risks associated with fecal pollution, especially risks posed by viruses. Enteric viruses are typically more resistant to wastewater treatment and persist longer in the environment than FIB. Furthermore, enteric viruses often have extremely low infectious doses. Currently, the incorporation of sanitary surveys, short‐term monitoring of reference pathogens, exploratory quantitative microbial risk assessments, and predictive ecological models is being championed as the preferred approach to water management. In addition to improved virus concentration methods, simple, point‐of‐use tests for enteric viruses and/or improved viral indicators are needed to complement this emerging paradigm and ensure microbial safety worldwide.
OBJECTIVE: To estimate the seroprevalence of antibodies to SARS-CoV-2 among blood donors in the state of Rio de Janeiro, Brazil. METHODS: Data were collected on 2,857 blood donors from April 14 to 27, 2020. This study reports crude prevalence of antibodies to SARS-CoV-2, population weighted prevalence for the state, and prevalence adjusted for test sensitivity and specificity. Logistic regression models were used to establish the correlates of SARS-CoV-2 prevalence. For the analysis, we considered collection period and site, sociodemographic characteristics, and place of residence. RESULTS: The proportion of positive tests for SARS-Cov-2, without any adjustment, was 4.0% (95%CI 3.3–4.7%), and the weighted prevalence was 3.8% (95%CI 3.1–4.5%). We found lower estimates after adjusting for test sensitivity and specificity: 3.6% (95%CI 2.7–4.4%) for the non-weighted prevalence, and 3.3% (95%CI 2.6–4.1%) for the weighted prevalence. Collection period was the variable most significantly associated with crude prevalence: the later the period, the higher the prevalence. Regarding sociodemographic characteristics, the younger the blood donor, the higher the prevalence, and the lower the education level, the higher the odds of testing positive for SARS-Cov-2 antibody. We found similar results for weighted prevalence. CONCLUSIONS: Our findings comply with some basic premises: the increasing trend over time, as the epidemic curve in the state is still on the rise; and the higher prevalence among both the youngest, for moving around more than older age groups, and the less educated, for encountering more difficulties in following social distancing recommendations. Despite the study limitations, we may infer that Rio de Janeiro is far from reaching the required levels of herd immunity against SARS-CoV-2.
The 1918 Influenza pandemic had long-term impacts on the cohort exposed in utero which experienced earlier adult mortality, and more diabetes, ischemic heart disease, and depression after age 50. It is possible that the Coronavirus Disease 2019 (COVID-19) pandemic will also have long-term impacts on the cohort that was in utero during the pandemic, from exposure to maternal infection and/or the stress of the pandemic environment. We discuss how COVID-19 disease during pregnancy may affect fetal and postnatal development with adverse impacts on health and aging. Severe maternal infections are associated with an exaggerated inflammatory response, thromboembolic events, and placental vascular malperfusion. We also discuss how in utero exposure to the stress of the pandemic, without maternal infection, may impact health and aging. Several recently initiated birth cohort studies are tracking neonatal health following in utero severe acute respiratory syndrome virus 2 (SARS-CoV-2) exposure. We suggest these cohort studies develop plans for longer-term observations of physical, behavioral, and cognitive functions that are markers for accelerated aging, as well as methods to disentangle the effects of maternal infection from stresses of the pandemic environment. In utero exposure to COVID-19 disease could cause developmental difficulties and accelerated aging in the century ahead. This brief review summarizes elements of the developmental origins of health, disease, and ageing and discusses how the COVID-19 pandemic might exacerbate such effects. We conclude with a call for research on the long-term consequences of in utero exposure to maternal infection with COVID-19 and stresses of the pandemic environment.

Digital surveillance methods, such as location tracking apps on smartphones, have been implemented in many countries during the COVID-19 pandemic, but not much is known about predictors of their acceptance. Could it be that prosocial responsibility, to which authorities appealed in order to enhance compliance with quarantine measures, also increases acceptance of digital surveillance and restrictions of privacy? In their fight against the COVID-19 pandemic, governments around the world communicated that self-isolation and social distancing measures are every citizen’s duty in order to protect the health not only of oneself but also of vulnerable others. We suggest that prosocial responsibility besides motivating people to comply with anti-pandemic measures also undermines people’s valuation of privacy. In an online research conducted with US participants, we examined correlates of people’s willingness to sacrifice individual rights and succumb to surveillance with a particular focus on prosocial responsibility. First, replicating prior research, we found that perceived prosocial responsibility was a powerful predictor of compliance with self-isolation and social distancing measures. Second, going beyond prior research, we found that perceived prosocial responsibility also predicted willingness to accept restrictions of individual rights and privacy, as well as to accept digital surveillance for the sake of public health. While we identify a range of additional predictors, the effects of prosocial responsibility hold after controlling for alternative processes, such as perceived self-risk, impact of the pandemic on oneself, or personal value of freedom. These findings suggest that prosocial responsibility may act as a Trojan horse for privacy compromises.
The course of SARS-CoV-2 infection ranges from asymptomatic to a multiorgan disease. In this observational study, we investigated SARS-CoV-2 infected subjects with defined outcomes, evaluating the relationship between viral load and single nucleotide polymorphisms of genes codifying for IFNλs (interferon). The study enrolled 381 patients with laboratory-confirmed SARS-CoV-2 infection. For each patient, a standardized form was filled including sociodemographic variables and clinical outcomes. The host’s gene polymorphisms (IFNL3 rs1297860 C/T and INFL4 rs368234815 TT/ΔG) and RtReal-Time PCR cycle threshold (PCR Ct) value on SARS-CoV-2 were assessed on nasal, pharyngeal or nasopharyngeal swabs. Higher viral loads were found in patients aged > 74 years and homozygous mutant polymorphisms DG in IFNL4 (adj-OR = 1.16, 95% CI = 1.01–1.34 and adj-OR = 1.24, 95% CI = 1.09–1.40, respectively). After adjusting for age and sex, a statistically significantly lower risk of hospitalization was observed in subjects with higher RtReal-Time PCR cycle threshold values (adj-OR = 0.95, 95% CI = 0.91, 0.99; p = 0.028). Our data support the correlation between SARS-CoV-2 load and disease severity, and suggest that IFNλ polymorphisms could affect the ability of the host to modulate viral infection without a clear impact on the outcome of COVID-19.
With the Corona crisis, unemployment is increasing in Germany despite all the countermeasures taken. In previous recessions, unemployment of the low-skilled in particular has become entrenched. Today, it is becoming apparent that technological change is also affecting medium-skilled workers in particular. In order to avoid consolidation, it is important to promote new hires, support qualification and enable vocational reorientation.
Chest X-ray is a “golden standard” for the diagnosis and severity assessment of community-acquired pneumonia (CAP). However, it cannot be used as routine examination of CAP in children. The present study aims to investigate the roles of prealbumin (PA) in CAP in children and further determine the usefulness of PA in diagnosis and severity assessment of CAP in children. This was a retrospective analysis of 174 cases of hospitalized children with CAP. The following indicators were recorded: vital sign, inflammatory indexes, PA, and respiratory pathogens immunoglobulin M antibody test results. A total of 33 healthy children were selected as the control group. The results of laboratory tests between CAP and control groups were compared. CAP group was further divided into mild CAP and severe CAP groups, and vital signs and laboratory examination results of 2 groups were compared. The total positive rate of Mycoplasma pneumoniae in this study was 27.4%, and there was no significant difference in different seasons (P = 0.356). Compared with controls, there was no significant difference between procalcitonin and C-reactive protein in CAP group (P = 0.355, 0.061). The white blood cell count, percentage of neutrophils, neutrophil count, and erythrocyte sedimentation rate in the CAP group were significantly higher than those in control group, and PA was significantly lower than that in the control group (all P < 0.05). In the traditional cutoff value (<170 mg/L), the sensitivity of PA for the diagnosis of CAP was 0.847, which was significant higher than traditional inflammatory indicators. Moreover, it was found that PA was an independent protective factor for CAP in children based on multivariate analysis (odds ratio: 0.974; 95% confidence interval: 0.956–0.993; P = 0.008). PA level in severe CAP group was significantly lower than in mild CAP group (P = 0.001). With a cutoff value of 125 mg/L, the sensitivity and specificity of PA for the severity assessment of CAP were 0.703 and 0.714, respectively. Combined with traditional inflammatory markers, PA may improve the diagnostic efficacy of CAP in children. PA can be used as a reference marker to complement the chest X-rays for severity assessment of children CAP.

During 2008–2009, fifteen field infectious bronchitis viruses (IBVs) were isolated from commercial chicken farms in Thailand. After sequencing of the complete S1 gene, phylogenetic analysis was performed and this found that the Thai IBV isolates were divided into three distinct groups, unique to Thailand (group I), QX-like IBV (group II), and Massachusetts type (group III). This finding indicated that the recent Thai IBVs evolved separately and that at least three groups of viruses are circulating in Thailand. The recombination analysis of the S1 gene demonstrated that the 5′-terminus of the group I was similar to isolate THA001 which was unique to Thailand, isolated in 1998 whereas the 3′-terminus was similar to the group II. Moreover, the analysis of the S1 gene of the group II showed that the 5′-terminus was similar to QXIBV, isolated in China whereas the remaining region at the 3′-terminus was similar to the Chinese strain JX/99/01. The results indicated that the recombination events occurred in the S1 gene between the field strains. Based on these facts, the field IBV in Thailand has undergone genetic recombination.
A genome scan was conducted to seek evidence for polymorphic genes that influence cause of death in mice produced by a cross between CB6F1 females and C3D2F1 males. Loci on chromosomes 1 and 4 were found to modulate risk of lymphoma. A locus on chromosome 4 influenced risk of mammary adenocarcinoma among multiparous female mice, but had no significant effect in virgin females. A chromosome 4 locus was found to modulate risk of death from either hemangiosarcoma or fibrosarcoma. A suggestive linkage was noted (at p =.09) between a marker on chromosome 11 and hepatocellular carcinoma. Lastly, a locus on chromosome 6 was noted to influence the likelihood that pulmonary adenocarcinoma would be present at death. The collection of normal and neoplastic tissues from 1004 terminal necropsies, together with genetic information, provides a valuable resource for further studies of the genetic influences on late-life diseases in mice.
Severe acute respiratory syndrome coronavirus (SARS-CoV) membrane (M) proteins are capable of self-assembly and release in the form of membrane-enveloped vesicles, and of forming virus-like particles (VLPs) when coexpressed with SARS-CoV nucleocapsid (N) protein. According to previous deletion analyses, M self-assembly involves multiple M sequence regions. To identify important M amino acid residues for VLP assembly, we coexpressed N with multiple M mutants containing substitution mutations at the amino-terminal ectodomain, carboxyl-terminal endodomain, or transmembrane segments. Our results indicate that a dileucine motif in the endodomain tail (218LL219) is required for efficient N packaging into VLPs. Results from cross-linking VLP analyses suggest that the cysteine residues 63, 85 and 158 are not in close proximity to the M dimer interface. We noted a significant reduction in M secretion due to serine replacement for C158, but not for C63 or C85. Further analysis suggests that C158 is involved in M-N interaction. In addition to mutations of the highly conserved 107-SWWSFNPE-114 motif, substitutions at codons W19, W57, P58, W91, Y94 or F95 all resulted in significantly reduced VLP yields, largely due to defective M secretion. VLP production was not significantly affected by a tryptophan replacement of Y94 or F95 or a phenylalanine replacement of W19, W57 or W91. Combined, these results indicate the involvement of specific M amino acids during SARS-CoV virus assembly, and suggest that aromatic residue retention at specific positions is critical for M function in terms of directing virus assembly.
In critically ill patients with coronavirus disease 2019, there has been considerable debate about when to intubate patients with acute respiratory failure. Early expert recommendations supported early intubation. However, as we learned more about this disease, the risks versus benefits of early intubation are less clear. We report our findings from an observational study aimed to compare the difference in outcomes of critically ill patients with coronavirus disease 2019 who were intubated early versus later in the disease course. Early need for intubation was defined as intubation either at admission or within 2 days of having a documented Fio(2) greater than or equal to 0.5. In the final sample of 111 patients, 76 (68%) required early intubation. The mean age among those who received early intubation was significantly higher (69.79 ± 12.15 vs 65.03 ± 8.37 years; p = 0.038). Also, the patients who required early intubation had significantly higher Sequential Organ Failure Assessment scores at admission (6.51 vs 3.48; p ≤ 0.0001). The outcomes were equivocal among both groups. In conclusion, we suggest that the timing of intubation has no impact on clinical outcomes among patients with coronavirus disease 2019 pneumonia.


Viruses have evolved different strategies to hijack subcellular organelles during their life cycle to produce robust infectious progeny. Successful viral reproduction requires the precise assembly of progeny virions from viral genomes, structural proteins, and membrane components. Such spatial and temporal separation of assembly reactions depends on accurate coordination among intracellular compartmentalization in multiple organelles. Here, we overview the rearrangement and morphology remodeling of virus-triggered intracellular organelles. Focus is given to the quality control of intracellular organelles, the hijacking of the modified organelle membranes by viruses, morphology remodeling for viral replication, and degradation of intracellular organelles by virus-triggered selective autophagy. Understanding the functional reprogram and morphological remodeling in the virus-organelle interplay can provide new insights into the development of broad-spectrum antiviral strategies.
Epidemiological studies suggest that the Bacillus Calmette-Guerin (BCG) vaccine may have protective effects against coronavirus disease 2019 (COVID-19); and, there are now more than 15 ongoing clinical trials seeking to determine if BCG vaccination can prevent or reduce the severity of COVID-19 (1). However, the mechanism by which BCG vaccination can induce a severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) specific T cell response is unknown. Here, in silico, we identify 8 BCG derived peptides with significant sequence homology to either SARS-CoV-2 NSP3 or NSP13 derived peptides. Using an in vitro co-culture system, we show that human CD4+ and CD8+ T cells primed with a BCG derived peptide developed enhanced reactivity to its corresponding SARS-CoV-2 derived peptide. As expected, HLA differences between individuals meant that not all persons developed immunogenic responses to all 8 BCG derived peptides. Nevertheless, all of the 20 individuals that were primed with BCG derived peptides developed enhanced T cell reactivity to at least 7 of 8 SARS-CoV-2 derived peptides. These findings provide a mechanistic basis for the epidemiologic observation that BCG vaccination confers protection from COVID-19; and supports the use of BCG vaccination to induce cross-reactive SARS-CoV-2 specific T cell responses.
Since COVID-19 emerged in early December, 2019 in Wuhan and swept across China Mainland, a series of large-scale public health interventions, especially Wuhan lock-down combined with nationwide traffic restrictions and Stay At Home Movement, have been taken by the government to control the epidemic. Based on Baidu Migration data and the confirmed cases data, we identified two key factors affecting the later (e.g February 27, 2020) cumulative confirmed cases in non-Wuhan region (y). One is the sum travelers from Wuhan during January 20 to January 26 (x1), which had higher infected probability but lower transmission ability because the human-to-human transmission risk of COVID-19 was confirmed and announced on January 20. The other is the seed cases from Wuhan before January 19, which had higher transmission ability and could be represented with the confirmed cases before January 29 (x2) due to a mean 10-day delay between infection and detection. A simple yet effective regression model then was established as follow: y= 70.0916+0.0054x1+2.3455x2 (n = 44, R2 = 0.9330, P<10-7). Even the lock-down date only delay or in advance 3 days, the estimated confirmed cases by February 27 in non-Wuhan region will increase 35.21% or reduce 30.74% - 48.59%. Although the above interventions greatly reduced the human mobility, Wuhan lock-down combined with nationwide traffic restrictions and Stay At Home Movement do have a determining effect on the ongoing spread of COVID-19 across China Mainland. The strategy adopted by China has changed the fast-rising curve of newly diagnosed cases, the international community should learn from lessons of Wuhan and experience from China. Efforts of 29 Provinces and 44 prefecture-level cities against COVID-19 were also assessed preliminarily according to the interpretive model. Big data has played and will continue playing an important role in public health.
Background The Bacille Calmette-Guerin (BCG) tuberculosis vaccine has immunity benefits against respiratory infections. Accordingly, it has been hypothesized that it may have a protective effect against COVID-19. Recent research found that countries with universal BCG childhood vaccination policies tend to be less affected by the COVID-19 pandemic. However, such ecological studies are biased by numerous confounders. Instead, this paper takes advantage of a rare nationwide natural experiment that took place in Sweden in 1975, where discontinuation of newborns BCG vaccination led to a dramatic fall of the BCG coverage rate from 92% to 2% , thus allowing us to estimate the BCG's effect without all the biases associated with cross-country comparisons. Methods Numbers of COVID-19 cases and hospitalizations were recorded for birth cohorts born just before and just after that change, representing 1,026,304 and 1,018,544 individuals, respectively. We used regression discontinuity to assess the effect of BCG vaccination on Covid-19 related outcomes. This method used on such a large population allows for a high precision that would be hard to achieve using a classical randomized controlled trial. Results The odds ratio for Covid-19 cases and Covid-19 related hospitalizations were 0.9997 (CI95: [0.8002-1.1992]) and 1.1931 (CI95: [0.7558-1.6304]), respectively. We can thus reject with 95% confidence that universal BCG vaccination reduces the number of cases by more than 20% and the number of hospitalizations by more than 24% Conclusions While the effect of a recent vaccination must be evaluated, we provide strong evidence that receiving the BCG vaccine at birth does not have a protective effect against COVID-19.
The role of the hospital environment in the transmission of infection is well described. With an emerging infection whose mode of transmission is under investigation, strict infection prevention and control measures, including patient isolation, hand hygiene, personal protective equipment that is doffed on exiting the patient room, and environmental cleaning should be implemented to prevent spread. Environmental testing demonstrated that COVID-19 patients contaminated the patient area (11/26, 42.3% of tests) but contamination of general ward areas was minimal (1/30, 3%) and the virus was detected after cleaning on one item only (1/25, 4%) which was noted to be in disrepair.
The SARS-CoV-2 emerged in December 2019 and quickly spread around the world forcing global health authorities to develop protocols for its diagnosis. Here we report dimer formation in the N2 primers-probe set (CDC 2019-nCoV Real-Time RT-PCR) used in diagnostic routine, and propose alternatives to reduce dimerization events. Late unspecific amplifications were visualized in 56.4% and 57.1% of negative samples and no-template control, respectively, but not in positive samples and positive control. In silico analysis and gel electrophoresis confirm the dimer formation. The RT-qPCR parameters were optimized and the late unspecific amplifications decreased to 11.5% in negative samples and no-template control. The adjustment of PCR parameters was essential to reduce the risk of false positives results and to avoid inclusive results that require repetition of tests, which increases the costs and generates delays in results or even unnecessary requests for new samples.


Background: The outbreak of Coronavirus Disease 2019 (COVID-19) is threatening a surging number of populations worldwide, including women in breastfeeding period. Limited evidence is available concerning breastfeeding in women with COVID-19. Methods: Twenty-three pregnant women and puerperae were enrolled in the study. To evaluate the effect of breastfeeding on SARS-CoV-2 transmission, the presence of SARS-CoV-2, IgG and IgM in breast milk, maternal blood and infant blood were assessed. Feeding patterns were also recorded in follow-up. Results: No positive detection for SARS-CoV-2 of neonates was found. All breast milk samples were negative for the detection of SARS-CoV-2. The presence of IgM ofSARS-CoV-2 in breast milk was correlated with maternal blood. The results of IgG detection for SARS-CoV-2 were negative in all breast milk samples. All the infants were in healthy condition while six of them were fed with whole or partial breast milk. Eight infants received antibody test for SARS-CoV-2 in one month after birth and the results were all negative. Conclusion: Findings from this small number of cases suggest that there is currently no evidence for mother-to-child transmission via breast feeding in women with COVID-19 in the third trimester and puerperium.

Abstract Unidentified human remains with unknown medical history can always pose biological hazards to forensic pathologists and odontologists, including hepatitis C, HIV infection, Middle East respiratory syndrome (MERS), hemorrhagic fever viruses such as Ebola, meningitis and now Sars-Cov2. The pandemic of the new coronavirus disease (COVID-19) has reached 185 Countries with an increasing number of deaths. Forensic pathologists and odontologists may find themselves having to perform an identification autopsy to confirmed or suspected Sars-Cov2 positive deaths. By respecting the entire set of universal precautions and recommendations the highlighted risks can be minimized, and best practice in human identification should always be a priority for human rights of the dead. The following article is a summary of the recommendations for conducting dental autopsies and management of suspected COVID-19 cases.
COVID-19 pandemic, a global health disaster, has resulted in substantial morbidity and mortality across the globe since emerging on December 2019. Studies have shown that cardiovascular manifestations and complications linked to COVID-19 can be attributed to unfavorable clinical outcome and poor prognosis. Adult patients with laboratory-confirmed COVID-19 requiring hospitalization in participating centers between March and June 2020 were included. Data including demographics, laboratory findings, comorbidities, treatments and interventions were collected. Mortality and clinical outcomes in patients with and without cardiac injury were compared. A total of 143 hospitalized patients with confirmed COVID-19 were included (86.7% male; age 49.36 ± 15.32 years). Cardiovascular diseases (CVDs) including hypertension, cardiomyopathy, coronary heart disease, and rhythm disturbances were noted in 34.3% of the study population and 21.7% had cardiac injury. In comparison with patients without cardiac injury, patients with cardiac injury were older (59 [33–89] vs 47 [22–94] years; P < 0.0001) and had more co-morbidities and cardiovascular (CV) risk factors (hypertension in 61.3% vs 24.1%; P < 0.0001, chronic heart failure in 16.1% vs 0%; P < 0.00001, diabetes mellitus 54.8% vs 31.3%; P 0.015, COPD/asthma 19.4% vs 3.6%; P 0.002); more patients with cardiac injury required invasive mechanical ventilation (77.4% vs 38.4%; P 0.00012). Complications were more prevalent in patients with cardiac injury than those without cardiac injury and included acute respiratory distress syndrome (87% vs 42.9%; P < 0.00001), acute kidney injury (67.7% vs 11.6%; P < 0.00001), and anemia (38.7% vs 3.6%;P < 0.00001). The need for renal replacement therapy was also higher in patients with cardiac injury (48.4% vs 3.6%; P < 0.00001). Noticeably, patients with cardiac injury had higher mortality than those without cardiac injury (53.3% vs 7.1%; P < 0.00001). In summary, myocardial injury is common among hospitalized patients with COVID-19 in Oman in relation to older patients with more CV risk factors and comorbidities, and is associated with higher risk of in-hospital mortality and unfavorable clinical outcomes.

COVID-19 has spread with unequal efficiency in various parts of the world. In several European countries including Italy, the increase in the number of COVID-19 cases has followed a consistent, exponential pattern of spread. However, some countries, notably Taiwan and Hong Kong, have achieved a different outcome and have managed to bring the COVID-19 outbreak in their countries rapidly under control, without entering the exponential pattern and with very few cases. They have used several different approaches to COVID-19 outbreak control, including the innovative use of smartphone technology and the widespread use of surgical face masks. We show through our models, that Canada has followed the same, consistent COVID-19 exponential growth pattern that is seen in Italy. Both nationally and in its most heavily affected provinces, there is exponential growth of COVID-19 cases, making it possible to make predictions for the future, if no further interventions are made in public health policy. In particular, we argue for the urgent introduction of surgical face masks in health care and other settings and the harnessing of the power of smartphone technology on a national scale.
A device that can identify all bacteria, viruses and fungi known to cause disease in humans should make diagnosis less of a guessing game, helping to curb the problem of antibiotic resistance
To monitor oseltamivir-resistant influenza viruses A (H1N1) (ORVs) with H275Y in neuraminidase (NA) in Japan during 2 influenza seasons, we analyzed 3,216 clinical samples by NA sequencing and/or NA inhibition assay. The total frequency of ORVs was 2.6% (45/1,734) during the 2007–08 season and 99.7% (1,477/1,482) during the 2008–09 season, indicating a marked increase in ORVs in Japan during 1 influenza season. The NA gene of ORVs in the 2007–08 season fell into 2 distinct lineages by D354G substitution, whereas that of ORVs in the 2008–09 season fell into 1 lineage. NA inhibition assay and M2 sequencing showed that almost all the ORVs were sensitive to zanamivir and amantadine. The hemagglutination inhibition test showed that ORVs were antigenetically similar to the 2008–09 vaccine strain A/Brisbane/59/2007. Our data indicate that the current vaccine or zanamivir and amantadine are effective against recent ORVs, but continuous surveillance remains necessary.
BACKGROUND: Nosocomial, or healthcare-associated infections (HAI), exact a high medical and financial toll on patients, healthcare workers, caretakers, and the health system. Interpersonal contact patterns play a large role in infectious disease spread, but little is known about the relationship between health care workers’ (HCW) movements and contact patterns within a heath care facility and HAI. Quantitatively capturing these patterns will aid in understanding the dynamics of HAI and may lead to more targeted and effective control strategies in the hospital setting. METHODS: Staff at 3 urban university-based tertiary care hospitals in Canada completed a detailed questionnaire on demographics, interpersonal contacts, in-hospital movement, and infection prevention and control practices. Staff were divided into categories of administrative/support, nurses, physicians, and “Other HCWs” - a fourth distinct category, which excludes physicians and nurses. Using quantitative network modeling tools, we constructed the resulting HCW “co-location network” to illustrate contacts among different occupations and with locations in hospital settings. RESULTS: Among 3048 respondents (response rate 38%) an average of 3.79, 3.69 and 3.88 floors were visited by each HCW each week in the 3 hospitals, with a standard deviation of 2.63, 1.74 and 2.08, respectively. Physicians reported the highest rate of direct patient contacts (> 20 patients/day) but the lowest rate of contacts with other HCWs; nurses had the most extended (> 20 min) periods of direct patient contact. “Other HCWs” had the most direct daily contact with all other HCWs. Physicians also reported significantly more locations visited per week than nurses, other HCW, or administrators; nurses visited the fewest. Public spaces such as the cafeteria had the most staff visits per week, but the least mean hours spent per visit. Inpatient settings had significantly more HCW interactions per week than outpatient settings. CONCLUSIONS: HCW contact patterns and spatial movement demonstrate significant heterogeneity by occupation. Control strategies that address this diversity among health care workers may be more effective than “one-strategy-fits-all” HAI prevention and control programs. ELECTRONIC SUPPLEMENTARY MATERIAL: The online version of this article (10.1186/s12879-018-3093-x) contains supplementary material, which is available to authorized users.
This study determines the relative survival (RS) of Bacillus subtilis spores loaded on an N95 filtering facepiece respirator (FFR) after decontamination by five methods under worst‐case conditions. Relative survival was obtained by testing after decontamination and after storing the FFRs at 37°C and 95% relative humidity for 24 hours. The decontamination methods involved ethanol, bleach, ultraviolet irradiation (UVA 365 nm, UVC 254 nm), an autoclave, and a traditional electric rice cooker (TERC) that was made in Taiwan. Without decontamination, 59 ± 8% of the loaded spores survived for 24 hours. When 70% ethanol was added to the N95 FFR at a packing density of 0.23, the RS was 73 ± 5% initially and decayed to 22 ± 8% in 24 hours. Relative survival remained above 20% after 20 minutes of UVA irradiation. The other four decontamination measures achieved 99%‐100% biocidal efficacy, as measured immediately after the methods were applied to the test FFRs. Relative survival is a useful parameter for measuring sterilization or degree of disinfection. Bleach, UVC, an autoclave, and a TERC provide better biocidal efficacy than ethanol and UVA. Not only a higher filter quality but also a lower value of RS produced the most decontaminated FFR.
COVID-19 is lasting longer than expected, which has a huge impact on the economy and on personal life. Each country has a different response method, and the damage scale is also distinct. This study aims to find out how COVID-19-related news was handled in the domestic media to seek ways to minimize the pandemic. The paper focuses on the number of news features by period and by disaster and analyzes related words based on big data. The results of the analysis are as follows. First, in the initial response phase, keywords to identify accurate sources of actual broadcast contents, fake news, social networking service (SNS), etc. were also ranked in the top 20. Second, in the active response phase, when the number of confirmed persons and the government’s countermeasures were announced, more than 100 COVID-19-related articles were issued, and the related words increased rapidly from the initial response stage. Therefore, the fact that COVID-19 has been expressed as a keyword indicates that our society is watching with great interest in the government’s response to the disease.
Our ability to predict the effects of climate change on the spread of infectious diseases is in its infancy. Numerous, and in some cases conflicting, predictions have been developed, principally based on models of biological processes or mapping of current and historical disease statistics. Current debates on whether climate change, relative to socioeconomic determinants, will be a major influence on human disease distributions are useful to help identify research needs but are probably artificially polarized. We have at least identified many of the critical geophysical constraints, transport opportunities, biotic requirements for some disease systems, and some of the socioeconomic factors that govern the process of migration and establishment of parasites and pathogens. Furthermore, we are beginning to develop a mechanistic understanding of many of these variables at specific sites. Better predictive understanding will emerge in the coming years from analyses regarding how these variables interact with each other.

Subsets and Splits

No community queries yet

The top public SQL queries from the community will appear here once available.