Plant foundation DNA large language models

The plant DNA large language models (LLMs) contain a series of foundation models based on different model architectures, which are pre-trained on various plant reference genomes.
All the models have a comparable model size between 90 MB and 150 MB, BPE tokenizer is used for tokenization and 8000 tokens are included in the vocabulary.

Developed by: zhangtaolab

Model Sources

Architecture

The model is trained based on the InstaDeepAI/agro-nucleotide-transformer-1b model.

This model is fine-tuned for predicting open chromatin.

How to use

Install the runtime library first:

pip install transformers

Here is a simple code for inference:

from transformers import AutoModelForSequenceClassification, AutoTokenizer, pipeline

model_name = 'agront-1b-open_chromatin'
# load model and tokenizer
model = AutoModelForSequenceClassification.from_pretrained(f'zhangtaolab/{model_name}', trust_remote_code=True)
tokenizer = AutoTokenizer.from_pretrained(f'zhangtaolab/{model_name}', trust_remote_code=True)

# inference
sequences = ['TTTTGATTCAGTGATTTTCGTCCTTTACAAAAGCTAATCCTTTTGGCCGCTTGACATAGATGATGCAGATCTTATCTGAATATCATTCCAGGTGCGTCGCGAGGGAATTGCTGTCGCGAATCGATCGATAAGAGACGGCTGGGTACGGGGTGGGTATGGATATGAACTTTTGCTTCC',
             'GATGCTACTGCTAGCTAATCAGTAATCACCAATGCATAAACACAACACATGCCTTCGTTCCAAAGTTTTCATTCCTCGTCATAGACTTAAAGAAGGGGCAACAAGTTCTCTACGAGTCTTCTGGACTGGACTGGCTACCCCCTCGGCCCATTCTGGCCCAGTTGCGGGCGGCCTTTCATTTAATAAATATTTCTAATAGATATAAATTATTTTATCTAATATTATTAATTTTTTTCTTATAAAACATATAAT']
pipe = pipeline('text-classification', model=model, tokenizer=tokenizer,
                trust_remote_code=True, top_k=None)
results = pipe(sequences)
print(results)

Training data

We use EsmForSequenceClassification to fine-tune the model.
Detailed training procedure can be found in our manuscript.

Hardware

Model was trained on a NVIDIA RTX4090 GPU (24 GB).

Downloads last month
3
Safetensors
Model size
1.0B params
Tensor type
F32
·
Inference Providers NEW
This model isn't deployed by any Inference Provider. 🙋 Ask for provider support